Oral administration of Enterococcus faecalis FK-23 suppresses Th17 cell development and attenuates allergic airway responses in mice (original) (raw)

Evidence is increasing that oral administration of probiotics can attenuate asthmatic responses both in murine models and clinical trials. T-helper 17 (Th17) cells, a subset of CD4+ T cells have been implicated as having an important role in the development of several allergic disorders, but the relationship between oral administration of probiotics and Th17 development has not been well studied. BALB/c mice were given lysed Enterococcus faecalis FK-23 (LFK) orally for 28 days. After sensitization by subcutaneous injection of ovalbumin (OVA) on Days 14 and 21 and 1% OVA inhalation on Days 25, 26 and 27, they were challenged with a 5% OVA aerosol on Day 28. Twenty-four hours later, airway resistance and accumulation of inflammatory cells in bronchoalveolar lavage fluid (BALF) and lung tissues were determined. Ιnterleukin (IL)-17-expressing CD4+ lymphocytes isolated from lung, spleen and lamina propria of the intestine were detected by flow cytometry. The expression of IL-6 and TGF-β mRNA was assessed by real-time PCR. Increases in airway hyperresponsiveness, and numbers of total leukocytes and mast cells in BALF induced by OVA challenge were significantly suppressed by oral administration of LFK. The increased percentage of IL-17-expressing CD4+ cells from lung, spleen and intestine in OVA-challenged mice was reduced following LFK treatment. We conclude that the oral administration of LFK suppresses the asthmatic response and that this is associated with attenuation of Th17 cell development.

Introduction

Allergic asthma is conventionally characterized by an increase in serum immunoglobulin E and the accumulation and activation of Th2 cells, eosinophils and mast cells. Recently, T-helper 17 (Th17) cells, a CD4+ helper T cell subset that produces interleukin-17A (IL-17A) and IL-17F, have been discovered to play important roles in allergic responses such as delayed-type hypersensitivity, contact hypersensitivity, and allergic airway inflammation (1). IL-17 promotes inflammation by inducing different proinflammatory cytokines and chemokines, recruiting neutrophils, enhancing antibody production, and activating T cells. Overexpression of IL-17A and IL-17F in the lungs leads to increased proinflammatory cytokine and chemokine expression, causing inflammation associated with neutrophil infiltration (25). IL-17 mRNA and/or protein was reported to be increased in the lungs, sputum, bronchoalveolar lavage fluids and sera from asthmatics, and the levels of IL-17 were correlated with the degree of severity of airway hypersensitivity (6).

Accumulating evidence suggests that certain probiotics may contribute to the development of immune function in the gastrointestinal tract. In particular, there is growing interest in the therapeutic potential of these organisms in allergic disorders. Clinical trials have indicated that oral administration of certain organisms can modulate immune responses in the airway (79). Live Lactobacillus reuterisignificantly attenuated the development of experimental allergic asthma in one study (9). The development of mucosal and systemic tolerance seems to rely on immunosuppressive mechanisms orchestrated by regulatory T-cell classes that attenuate both Th1 and Th2 responses (10). However, the involvement of Th17 cells and anti-allergic action of certain bacteria remains obscure.

To seek evidence for an association between the suppression of allergic airway responses induced by certain microorganisms and the presence of Th17 cells, we investigated the expression of Th17 cells in a murine allergic asthma model. A product of lysozyme and heat-treated Enterococcus faecalisFK-23, LFK was orally administered to asthmatic mice with a view to decreasing airway inflammation. We had previously shown that LFK inhibited active cutaneous anaphylaxis and allergen-induced peritoneal accumulation of eosinophils in murine models (11,12). The potential role of Th17 cells in LFK-mediated attenuation of allergic airway inflammation is described in the present study.

Materials and methods

Preparation of LFK

LFK was prepared as previously described (11,12). In brief, Enterococcus faecalis FK-23 was cultured for 24 h at 37°C, in a broth medium containing 2% glucose, 2% yeast extract and 4% KH2PO4. The cells were harvested by centrifugation, washed three times with distilled water and then treated with lysozyme (1 mg/ml) at 37°C for 2 h, heated to 105°C for 10 min, then lyophilized.

Other compounds

Methacholine chloride and ISOGEN were purchased from Wako Pure Chemical Industries (Osaka, Japan). Ovalbumin (OVA), Percoll, phorbol myristate acetate (PMA), ionmycin and DNase I were obtained from Sigma Chemical Co. (St. Louis, MO, USA). Collagenase D and dispase were from Roche Diagnostics GmbH (Mannheim, Germany).

Animal

Male BALB/c mice (20–25 g) (Japan SLC, Hamamatsu, Japan) were used. They were housed at a constant temperature of 22±2°C with a humidity of 55±10% on an automatically controlled 12:12 h light-dark cycle, and given food and water ad libitum. Animal care and research protocols were in accordance with the principles and guidelines adopted by the Animal Care Committee of Ehime University and approved by the University Committee for Animal Research.

Administration of LFK and sensitization

Mice were given LFK (60 mg) in 0.5 ml saline every day for 28 days. Mice given only saline were used as controls (Fig. 1). Mice were sensitized by subcutaneous injection of 20 μg OVA adsorbed to 500μg aluminum hydroxide suspension in saline on Day 14. A booster injection of OVA was given on the Day 21. Sensitized mice were exposed to 1% OVA for 30 min by inhalation on Days 25, 26 and 27, followed by inhalation of 5% OVA on Day 28. Mice challenged with saline were used as controls (Fig. 1).

Measurement of airway hypersensitivity

Twenty-four hours after the final OVA challenge, bronchial reactivity to aerosolized methacholine was measured using a whole-body plethysmographic chamber (Buxco Electronics, Sharon, CT, USA) to determine changes in enhanced respiratory pause (PenH). After a 10-min stabilization period, increasing concentrations of methacholine (2–32 mg/ml) or saline were aerosolized for 1 min each, and mean PenH values were obtained over 5-min periods. PenH (= pause × PEP/PIP) describes airway resistance, using the peak expiratory pressure (PEP) and the peak inspiratory pressure (PIP). The pause was defined as (Tc-Tr)/Tc, where Tc is the time of expiration and Tr is the relaxation time. The Tr was the time of pressure decay to 30% of the total expiratory pressure signal. Constriction of the airway is shown as the increased PenH value.

Leukocyte accumulation in bronchoalveolar fluid (BALF)

Twenty-four hours after challenge with OVA or saline, BALF was collected via tracheal cannulation using 250μl phosphate-buffered saline solution (PBS, pH 7.20). Collections were repeated 3 times on each mouse. Routinely, >90% of the lavage fluid was recovered from the lungs. Cells were removed from BALF by centrifugation at 200 × g for 15 min and BALF cell pellets were pooled and resuspended in PBS for total and differential cell counts.

The morphology of BALF cell preparations was analyzed using light microscopy. Air-dried preparations were fixed and stained with hematoxylin and eosin (H&E) to determine the total cell number. The other preparations were stained with Alcian blue and nuclear fast to identify mast cells. Results are expressed as the number of cells per lung.

Histological analysis

Lung sections were stained with H&E after fixation with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.20) for 12 h at 4°C. All sample slides were examined using a Nikon C1 microscope (Nikon, Japan) and compared at the same magnification.

Analysis of Th17 cells in lungs, spleens and lamina propria of the intestine

Twenty-four hours after the final OVA challenge, tissues were removed and cells were isolated. Splenocytes were isolated from spleens using a standard dissection technique and resuspended in RPMI-1640 for staining (13). For isolation of lung cells, briefly, lungs were cut into small pieces and digested in 10 ml of medium containing 300 U/ml collagenase D and 1.5 mg/ml DNase I at 37°C for 1 h. The digested lung tissue was filtered through a 70μm cell strainer, after red blood cells had been lysed (14). For isolation of intestinal lamina propria lymphocytes, the intestines were opened longitudinally and shaken in Hanks’ balanced salt solution containing 5 mM EDTANa2 for 20 min at 37°C. Small pieces of intestine were incubated with RPMI-1640 containing 4% fetal bovine serum, 1 mg/ml collagenase D, 1 mg/ml dispase and 40μg/ml DNase I for 1 h at 37°C in a shaking water bath. Then the digest was resuspended in 40% Percoll and overlayed on 80% Percoll. After centrifugation, the lamina propria lymphocytes from the interface of the Percoll gradients were collected immediately for intracellular cytokine staining (15). Dispersed cell suspensions from lungs, spleens and lamina propria were resuspended at 1×106 cells/ml and incubated with 50 ng/ml PMA, 500 ng/ml ionomycin in RPMI-1640 at 37°C for 6 h. After extracellular staining with PE anti-mouse CD4, the cells were permeabilized with Fix/Perm solution for 20 min at 4°C. They were then stained with Alexa Fluor 488 anti-mouse IL-17A. Data were acquired on a BD FACSAria (Becton-Dickinson, Oakville, ON, Canada) and analyzed using FlowJo (Tree Star Inc., Ashland, OR, USA)

Quantitative real-time PCR

Total-RNA was extracted with ISOGEN from lungs, spleens and intestines of mice 24 h after the final challenge. The expression of TGF-β, IL-6 and β-actin mRNA was assessed according to the manufacturer’s instruction using the One Step SYBR PrimeScript Plus RT-PCR kit (Takara Bio, Inc., Shiga, Japan). The fluorescence emission of the probe was monitored and analyzed using an Applied Biosystems 7500 Fast Real-Time PCR system (Applied Biosystems). Specific oligonucleotide primers were designed according to published sequences as shown in Table I. The expression levels of IL-6 and TGF-β were corrected by reference to β-actin, and the relative amount of each mRNA in each sample was calculated by the comparative ΔCt method.

Table ISequences of PCR primers.

Table I

Sequences of PCR primers.

Target Forward sequence (5′→3′) Reverse sequence (5′→3′)
TGF-β GACTCTCCACCTGCAAGACCA GGGACTGGCCGAGCCTTAGTT
IL-6 TTCCATCCAGTTGCCTTCTTG TTGGGAGTGGTATCCTCTGTGA
β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT
Statistical analyses

All experiments were designed as completely randomized multifactorials with 3–15 mice/group. Results are expressed as the mean ± SEM. The significance of the differences among all groups were analyzed using repeated measures analysis of variances (ANOVA) followed by the Scheffe’s F-test. Significant differences between treatments were assessed using Student’s t-test. P-values <0.05 were taken to indicate significant differences.

Results

Suppression of allergic airway inflammation by oral administration of LFK

We determined the effect of LFK on airway hyperresponsiveness, one of the most important characteristics of the allergic airway response. Suppression of airway hyperresponsiveness, reduced accumulation of leukocytes in BALF and less lung inflammation were seen following oral administration of LFK. Thus, the final OVA challenge to OVA-sensitized mice resulted in an enhanced response to methacholine as determined by an enhanced pause index, but this was significantly attenuated by oral administration of LFK for 28 days (Fig. 2A). Administration of LFK alone did not have any effects on airway resistance in non-sensitized mice.

Figure 2Suppression of allergic airway inflammation by administration of LFK. (A) Changes in airway hypersensitivity were quantified using the enhanced pause index, which was measured using a whole-body plethysmograph. For each experiment, increasing concentrations of methacholine (2–32 mg/ml) or saline were aerosolized for 1 min each, and mean PenH values were obtained over 5-min periods. The results are expressed as the mean ± SEM. *P<0.05, ANOVA followed by Scheffe’s test for differences in saline-treated/OVA-challenged mice (x-marks), LFK-treated/OVA-challenged mice (triangles), LFK-treated/saline-challenged mice (diamonds) and saline-treated/saline-challenged mice (squares). (B) Total number of cells in bronchoalveolar lavage fluid (BALF) taken from mice 24 h after challenge by inhalation of 5% OVA. The BALF cells were analyzed by H&E staining. Mice challenged with saline were used as controls. *P<0.05, Student’s t-test, compared with each group. (C) The number of mast cells in BALF. Mast cells were detected by Alcian blue/nuclear fast staining. *P<0.05, Student’s t-test, compared with each group. (D) Histological analysis of the lung. The lung sections were stained by H&E. All sample slides were examined using a Nikon C1 microscope (Nikon, Japan) and compared at the same magnification (n=5–15 mice/group).

Oral treatment with LFK also attenuated inflammatory cell influx into the airway. The total number of cells in BALF increased by 1.74-fold (P<0.05) 24 h after the final antigen challenge in OVA-sensitized (saline-treated/OVA-challenged) mice compared with the saline-treated/saline-challenged controls (Fig. 2B). LFK-treated/OVA-challenged mice showed a significant reduction in total cells recovered in BALF to 71.8% (P<0.05) compared to saline-treated/OVA-challenged mice.

The OVA challenge also caused a marked increase in the proportion of mast cells present (Fig. 2C), one of the most important functional cell populations in the allergic airway response. In the LFK-treated/OVA-challenged group, the number of mast cells was significantly decreased to 50.9% of the saline-treated/OVA-challenged mice. This result is in line with the marked decrease in total numbers following administration of LFK.

The anti-allergic effect of LFK on airway inflammation was also observed in histological analysis. The administration of LFK to OVA-challenged mice resulted in decreased perivascular and peribronchiolar infiltration by inflammatory cells (Fig. 2D). Thus, suppression of airway inflammation as a result of oral administration of LFK was clearly demonstrated in this model.

Effect of LFK on the presence of Th17 cells in lung

To investigate the effect of oral administration of LFK on the development of Th17 cells, we assessed IL-17 expression in isolated lymphocytes from the lung after oral treatment with LFK for 28 days. In the LFK-treated/saline-challenged mice, the percentage of IL-17-expressing CD4+ cells in the lung was reduced to 43.5% (P<0.05) compared to saline-treated/saline-challenged mice. OVA sensitization and challenge dramatically increased IL-17-expressing CD4+cells in the lung, showing a 2.4-fold increase compared with the saline-sensitized and challenged mice. However, this robust development of Th17 cells was attenuated by LFK administration, which resulted in a significant decrease of the percentage of IL-17-expressing CD4+ cells in LFK-treated/OVA-challenged mice, to 23.8% (P<0.05) compared to saline-treated/OVA-challenged mice (Fig. 3A and B).

Oral treatment with LFK also markedly reduced TGF-β expression to 8.7% (P<0.05) and IL-6 to 1.3% (P<0.05) of that seen in saline-treated/OVA-challenged mice (Fig. 3C and D). Thus, LFK had marked effects on several related cytokines and reduced the development of Th17 cells in allergic airway inflammation.

Effect of LFK on the presence of Th17 cells in splenocytes

The changes in the percentage of IL-17-expressing CD4+ cells in splenocytes showed a similar tendency as in isolated lung cells. Oral administration of LFK reduced the percentage of IL-17-expressing CD4+ cells to 26.2% (P<0.05) compared with saline-treated/OVA-challenged mice (Fig. 4A and B). Again, the expression of IL-6 was also decreased to 33.3% (P<0.05), and the reduction of TGF-β did not achieve significance.

Effect of LFK on the presence of Th17 cells in the intestine

To test whether LFK suppresses Th17 cells in a crucial location, IL-17-expression of CD4+ T cells in the intestinal lamina propria was investigated. IL-17-expressing CD4+ cells in the intestine was increased 1.97-fold (P<0.05) in saline-treated/OVA-sensitized mice compared with the saline-treated/saline-challenged control. LFK reduced the percentage of IL-17-expressing CD4+ cells to 44.8% (P<0.05) compared with saline-treated/OVA-challenged mice (Fig. 5A and B). No significant change was detected in IL-6 expression in these mice. The expression of TGF-β showed a tendency to increase in LFK-treated mice, but this was not significant.

Discussion

In the present study, we clearly showed that oral administration of LFK attenuated allergic airway inflammation along with significantly suppressing Th17 cell development in mice. That may help us to understand the anti-inflammatory effects of probiotics in the prevention of allergic airway inflammation. Studies using other specific strains of probiotic organisms such asLactobacillus reuteri reported the importance of live but not heat-killed bacteria in maintaining Th2 functional tolerance (9). The reasons for choosing the lysed heat-killed probiotics for this study were the following: first, in the form of lysed heat-killed Enterococcus faecalis FK-23, the effects of LFK had been analyzed in several immunological disorders, such as active cutaneous anaphylaxis and allergen-induced peritoneal eosinophil accumulation. It is suggested that heat-killed probiotics also have potential therapeutic effects as live bacterias. Second, the specific strains of probiotics have anti-inflammatory activities but the relationships between the probiotics and IL-17 suppression have not been discussed. Third, use of lysed heat-killed probiotics rather than live bacteria assisted in maintaining consistency between experiments in mice. Here we show unequivocally that oral administration of LFK to mice attenuated lung inflammation and airway hyperresponsiveness. These findings are in line with the study of Hunt et al (16), who demonstrated that the intragastric administration of heat-killed Mycobacterium vaccae significantly reduced pulmonary inflammation after antigen challenge in OVA-sensitized mice.

We next asked why the pathological features of airway inflammation are inhibited by LFK. Despite clear evidence for strong immunomodulatory properties of LFK, the mechanisms underlying these effects are poorly understood. Here we demonstrated one of the most important effects of probiotics on allergic airway inflammation in mice. That is that oral administration of LFK could suppress Th17 cell development in the intestinal lamina propria, spleen and lung of the asthmatic mice. The importance of IL-17-producing T (Th17) cells rather than Th1 cells or Th2 cells for the development of allergic diseases has been demonstrated in IL-17-deficent mice (17). The clinical observations also showed that the concentration of IL-17 was significantly increased in BALF, sputum and blood from patients with asthma (18,19). Exploration of the mechanisms by which Th17 cells differentiate from naïve T cells have shown that IL-6, in synergy with TGF-β have a critical role in inducing the differentiation of Th17 cells.

Our data have demonstrated that oral administration of LFK significantly decreased mRNA expression of TGF-β as well as IL-6 in lungs (Fig. 3C and D), which may explain the inhibitory effects of oral LFK treatment on Th17 cell development in the local site. In spleens, LFK treatment decreased mRNA expression of IL-6 (Fig. 4D) while suppressing Th17 cell development (Fig. 4A and B). Indeed, IL-6 has key functions in programming naïve CD4+T cells to become Th17 cells. IL-6 induced expression of IL-21 that amplified an autocrine loop to induce more IL-21 and IL-23 receptor in naïve and CD4+ cells. Furthermore, IL-6 through the STAT3-RORγt pathway in concert with TGF-β are involved in differentiation of Th17 cells (20). Ghoreschi et al (21) showed that Th17 differentiation can occur in the absence of TGF-β signaling in mice. Neither IL-6 nor IL-23 alone efficiently generated pathogenic Th17 cells. On the other hand, IL-6-deficient mice have been shown to have a deficit in Th17 development (22).

In contrast, although the TGF-β and IL-6 mRNA expression levels in intestinal lamina propria were not significantly different between the asthmatic mice and LFK-treated asthmatic mice, both TGF-β and IL-6 showed a tendency to increase in LFK-treated models of asthma. IL-6 is one of the main cytokines produced by intestinal lamina propria cells after infection. For example, overproduction of IL-6 has been found in many types of colitis. Further analyses are needed to clarify whether the expression of IL-6 in intestinal lamina propria cells could be suppressed by LFK. TGF-β, has a dual function in directing the differentiation of Treg cells and proinflammatory Th17 cells. Whether increased production of TGF-β by intestinal lamina propria cells contributed to a shift in the Treg/Th17 balance toward Treg resulting in suppression of Th17 cell development (Fig. 5A and B) needs to be further clarified. It has been reported that Foxp3 can directly bind to RORγt to then inhibit RORγt-dependent transcriptional activation of its key target genes such as IL-17 (23).

Examination of cytokines in the present study was performed in vivo. To mimic the in vivo interaction between probiotics and target cells using an in vitroexperiment would be beneficial to investigate the precise mechanism. In fact, in vitro experiments have been extensively performed. Tanabe et al (24) and Jan et al (25) analyzed cytokine production after splenocytes were cultured with Bifidobacterium infantis andLactobacillus gasseri and demonstrated that these selected probiotics are able to suppress IL-17 production (24,25). Foligne and colleagues demonstrated that mouse bone marrow-derived dendritic cells (DCs) stimulatedin vitro with selected Lactobacillus strains, could attenuate colitis via a Tregs-dependent mechanism (26). In vivo studies using DCs have shown that the functional changes in DCs following interaction with probiotics are critical for immune regulation. These selected probiotics can stimulate DC regulatory functions by targeting a specific pattern-recognition receptor (PRR) family, such as Toll-like receptors (TLRs), through DCs expression of various cytokines, such as IL-10, TGF-β and indoleamine 2,3-dioxygease (IDO), which drive the generation of CD4+25+Foxp3+ Tregs (2729). As described above, Foxp3 can inhibit Th17 cells differentiation by antagonizing RORγt, while, these probiotic-induced Tregs can also inhibit the differentiation of Th1 and Th2 cells (30), which may explain how some probiotic strains could suppress the Th2 response in asthma model (31).

Although we showed evidence for the attenuation of Th17 cells and related cytokines produced by lung cells and splenocytes following oral administration of LFK, this does not prove the precise mechanism and the LFK component(s) which responded with target cells. Further studies are required to elucidate the nature of the probiotic-host cell interactions, how these interactions induce immunomodulation and to identify the specific component(s) of probiotic and host responsible for these interactions. In addition, the mechanism by which the immunomodulatory effects of oral probiotics treatment influence sites distant to the intestine, such as respiratory tract need to be examined. To address this issue, a gut-lung axis of probiotic action was proposed by Forsythe (32). A literature review shows that the anti-allergic effects of probiotics are strain-dependent and mediated by different effects (33). For example, in contrast to the suppression of IL-17/Th17 by selected probiotics it has been reported that a specific component of the macrobiota, Candidatus arthromitus, a subset of the Firmicute-Clostridiae group commonly termed segmented filamentous bacteria (SFB), promotes Th17 cell induction in the intestine (15).

In conclusion, our results have shown that oral administration of LFK resulted in significant attention of allergic airway response in OVA-sensitized mice. Our data also indicated that oral administration of LFK could suppress the in vivodevelopment of Th17, which may be caused by LFK-mediated restoration of the Treg/Th17 balance though the TGF-β and IL-6 cytokine-dependent signaling pathways. Increased knowledge of the regulatory activities of probiotics will stimulate the development of alternative approaches for the treatment of immune disorders via the modulation of T cell-balance.

References

1. Y IwakuraS NakaeS SaijoH IshigameThe roles of IL-17A in inflammatory immune responses and host defense against pathogensImmunol Rev2265779200810.1111/j.1600-065X.2008.00699.x19161416
2. SD HurstT MuchamuelDM GormanNew IL-17 family members promote Th1 or Th2 responses in the lung: in vivo function of the novel cytokine IL-25J Immunol169443453200210.4049/jimmunol.169.1.44312077275
3. N OdaPB CanelosDM EssayanBA PlunkettAC MyersSK HuangInterleukin-17F induces pulmonary neutrophilia and amplifies antigen-induced allergic responseAm J Respir Crit Care Med1711218200510.1164/rccm.200406-778OC15477493
4. H ParkZ LiXO YangA distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17Nat Immunol611331141200510.1038/ni126116200068
5. XO YangSH ChangH ParkRegulation of inflammatory responses by IL-17FJ Exp Med20510631075200810.1084/jem.2007197818411338
6. K ObokiT OhnoH SaitoS NakaeTh17 and allergyAllergol Int57121134200810.2332/allergolint.R-07-16018427165
7. N BlumerS SelS VirnaPerinatal maternal application of Lactobacillus rhamnosus GG suppresses allergic airway inflammation in mouse offspringClin Exp Allergy37348357200717359385
8. W FeleszkoJ JaworskaRD RhaProbiotic-induced suppression of allergic sensitization and airway inflammation is associated with an increase of T regulatory-dependent mechanisms in a murine model of asthmaClin Exp Allergy37498505200710.1111/j.1365-2222.2006.02629.x
9. P ForsytheMD InmanJ BienenstockOral treatment with live Lactobacillus reuteri inhibits the allergic airway response in miceAm J Respir Crit Care Med1755615692007
10. K KarimiMD InmanJ BienenstockP Forsythe_Lactobacillus reuteri_-induced regulatory T cells protect against an allergic airway response in miceAm J Respir Crit Care Med179186193200910.1164/rccm.200806-951OC
11. T ShimadaL ChengM IdeS FukudaT EnomotoT ShirakawaEffect of lysed Enterococcus faecalis FK-23 (LFK) on allergen-induced peritoneal accumulation of eosinophils in miceClin Exp Allergy336846872003
12. T ShimadaL ChengA YamasakiEffects of lysed_Enterococcus faecalis_ FK-23 on allergen-induced serum antibody responses and active cutaneous anaphylaxis in miceClin Exp Allergy34178417882004
13. MH CatoIW YauRC RickertMagnetic-based purification of untouched mouse germinal center B cells for ex vivo manipulation and biochemical analysisNat Protoc6953960201110.1038/nprot.2011.34421720310
14. KA SauerP ScholtesR KarwotS FinottoIsolation of CD4+ cells from murine lungs: a method to analyze ongoing immune responses in the lungNat Protoc128702875200617406546
15. K AtarashiT TanoueK HondaInduction of lamina propria Th17 cells by intestinal commensal bacteriaVaccine2880368038201010.1016/j.vaccine.2010.09.02620849872
16. JR HuntR MartinelliVC AdamsGA RookLR BrunetIntragastric administration of _Mycobacterium vaccae_inhibits severe pulmonary allergic inflammation in a mouse modelClin Exp Allergy35685690200515898994
17. S NakaeY KomiyamaA NambuAntigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responsesImmunity17375387200210.1016/S1074-7613(02)00391-612354389
18. S MoletQ HamidF DavoineIL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokinesJ Allergy Clin Immunol108430438200110.1067/mai.2001.11792911544464
19. A BarczykW PierzchalaE SozanskaInterleukin-17 in sputum correlates with airway hyperresponsiveness to methacholineRespir Med97726733200310.1053/rmed.2003.150712814161
20. L ZhouIvanov IIR SpolskiIL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathwaysNat Immunol8967974200710.1038/ni148817581537
21. K GhoreschiA LaurenceXP YangGeneration of pathogenic T(H)17 cells in the absence of TGF-beta signallingNature467967971201010.1038/nature0944720962846
22. E BettelliY CarrierW GaoReciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cellsNature441235238200610.1038/nature04753
23. L ZhouJE LopesMM ChongTGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat functionNature453236240200810.1038/nature0687818368049
24. S TanabeY KinutaY Saito_Bifidobacterium infantis_ suppresses proinflammatory interleukin-17 production in murine splenocytes and dextran sodium sulfate-induced intestinal inflammationInt J Mol Med221811852008
25. RL JanKC YehMH Hsieh_Lactobacillus gasseri_ suppresses Th17 pro-inflammatory response and attenuates allergen-induced airway inflammation in a mouse model of allergic asthmaBr J NutrOct142011(Epub ahead of print).
26. B FoligneG ZoumpopoulouJ DewulfA key role of dendritic cells in probiotic functionalityPLoS One2e313200710.1371/journal.pone.000031317375199
27. HK KwonCG LeeJS SoGeneration of regulatory dendritic cells and CD4+Foxp3+ T cells by probiotics administration suppresses immune disordersProc Natl Acad Sci USA10721592164201020080669
28. P PuccettiU GrohmannIDO and regulatory T cells: a role for reverse signalling and non-canonical NF-kappaB activationNat Rev Immunol7817823200710.1038/nri216317767193
29. AL HartK LammersP BrigidiModulation of human dendritic cell phenotype and function by probiotic bacteriaGut5316021609200410.1136/gut.2003.03732515479680
30. Y BelkaidThe role of CD4(+)CD25(+) regulatory T cells in Leishmania infectionExpert Opin Biol Ther38758852003
31. E SchiaviB BarlettaC ButteroniS CorintiM BoirivantG Di FeliceOral therapeutic administration of a probiotic mixture suppresses established Th2 responses and systemic anaphylaxis in a murine model of food allergyAllergy66499508201110.1111/j.1398-9995.2010.02501.x21058959
32. P ForsytheProbiotics and lung diseasesChest139901908201110.1378/chest.10-186121467057
33. S MichailThe role of probiotics in allergic diseasesAllergy Asthma Clin Immunol55200910.1186/1710-1492-5-5