Evolution of Antp-class genes and differential expression of Hydra Hox/paraHox genes in anterior patterning (original) (raw)
Abstract
The conservation of developmental functions exerted by Antp-class homeoproteins in protostomes and deuterostomes suggested that homologs with related functions are present in diploblastic animals. Our phylogenetic analyses showed that Antp-class homeodomains belong either to non-Hox or to Hox/paraHox families. Among the 13 non-Hox families, 9 have diploblastic homologs, Msx, Emx, Barx, Evx, Tlx, NK-2, and Prh/Hex, Not, and Dlx, reported here. Among the Hox/paraHox, poriferan sequences were not found, and the cnidarian sequences formed at least five distinct cnox families. Two are significantly related to the paraHox Gsx (cnox-2) and the mox (cnox-5) sequences, whereas three display some relatedness to the Hox paralog groups 1 (cnox-1), 9/10 (cnox-3) and the paraHox cdx (cnox-4). Intermediate Hox/paraHox genes (PG 3 to 8 and lox) did not have clear cnidarian counterparts. In Hydra, cnox-1, cnox-2, and cnox-3 were not found chromosomally linked within a 150-kb range and displayed specific expression patterns in the adult head. During regeneration, cnox-1 was expressed as an early gene whatever the polarity, whereas cnox-2 was up-regulated later during head but not foot regeneration. Finally, cnox-3 expression was reestablished in the adult head once it was fully formed. These results suggest that the Hydra genes related to anterior Hox/paraHox genes are involved at different stages of apical differentiation. However, the positional information defining the oral/aboral axis in Hydra cannot be correlated strictly to that characterizing the anterior–posterior axis in vertebrates or arthropods.
The discovery of structural and functional homologies between regulatory genes used by Drosophila and vertebrates during their development led to the hypothesis that animals would share a common set of genes for defining the head, trunk, and posterior regions at early developmental stages (1–6). The proposed genes were homeobox genes belonging either to the Antp class, like empty-spiracle (emx), even-skipped (evx), Hox genes, or to the Prd class, like orthodenticle (Otx), goosecoid. Phylogenetic analyses performed on a vast amount of Hox homeodomain (HD) sequences, including representatives from all classes of homeobox genes from animals, protozoa, fungi, and plants, confirmed the monophyly of the Antp class as well as its position as a sister group to the Paired class (7). Within the Antp class, the Hox gene organization is distinctive and enigmatic: the genes map in clusters, and the order of individual genes within a cluster correlates with their temporospatial expression pattern along the anterior–posterior body axis during development (8). Recently, it was proposed that the common bilaterian ancestor of protostomes and deuterostomes had at least seven Hox genes (9). However, the question of the composition of the ancestral HOX cluster remains open. Analysis of Hox homeobox sequences (10) suggested that the conserved HOX cluster emerged early in the evolution of metazoans from an original cluster harboring three ancestral genes, one located at the 5′ end related to the AbdB/paralog group 9 (PG-9), a central one, precursor for the _Dfd_-like and the _Antp_-like genes (PG-4/6), and a 3′ located gene ancestral for the _pb_- and _lab_-like genes (PG-1/2). A similar organization of the evolutionary sister of the HOX cluster, the paraHOX cluster, was actually observed in amphioxus (11). However, analysis of a more complete set of HD sequences led to the hypothesis that an original and ancient split, rather, occurred between the anterior and posterior Hox genes, which later on duplicated separately (12).
Because the Cnidaria can be regarded as the sister group to the Bilateria, analysis of cnidarian genomes will likely provide insights into the structure and function of ancestral Antp-class genes. Within the last years, a large number of diploblastic Antp-related genes have been isolated (13–31). Among those, cnidarian sequences related to Hox and paraHox genes were found (15, 17–19, 22, 23, 25, 28, 29, 31), but the characterization of diploblastic Hox families, as well as their possible relatedness to triploblastic families, remains unclear in several cases (26, 32). Moreover, although the expression analyses suggested that several cnidarian Antp-class genes are involved in patterning (15, 19, 24, 27, 29), the developmental role of the cnidarian _Hox_-related genes at the time the oral/aboral axis is defined remains confused. In this paper, we have reconsidered the phylogeny of the whole Antp class of homeobox genes in light of three Hydra genes we have identified, related to distal-less (Dlx Hv) (Hv, Hydra vulgaris) not (Cnot Hv), and Prh/Hex (CnHex Hv). In addition, we have investigated the chromosomal clustering of three Hydra Hox/paraHox genes and their differential temporospatial regulation during budding and regeneration.
Methods
Culture of Animals and Regeneration Experiments.
The multiheaded mutant Chlorohydra viridissima (Cv) and the Hv (Irvine strain) species were cultured as previously described (33). For regeneration experiments, bisection was performed at midgastric position on budless Hydra after a 2-day starvation period.
Cloning of Homeobox-Containing Genes.
The cnox-2 (1,031 bp), Cnhex (593 bp), Cnot (1,031 bp), and msh (525 bp) cDNAs were isolated by screening a Hv λgt10 cDNA library with the end-labeled 50-mer oligonucleotide as described in refs. 15 and 34. The 125-bp Dlx hv cDNA fragment was obtained by reverse transcription–PCR (RT-PCR) by using degenerate primers (forward: GIMGITAYMGWACWGCWTTYWC; reverse: CKWCKRTTYTGRAACCAWATYTT) and further extended up to 381 bp by the 3′ rapid amplification of cDNA ends procedure by using the specific primer CAGAACTGGCAGAAACCCT. The cnox-1 Hv gene was obtained as a 847-bp fragment after inverted PCR performed on XmnI self-ligated genomic DNA by using the GACGACGATCACGAGTTAAATACCT (reverse) and TCTGGGACTCACTAAGGTCAAGA (forward) primers. Subsequently, the primers CCAAATAGACCAATAATTGCAAAGTCTC (forward) and GCGAAACCAAGGTGAATCATCGTCT (reverse) were used to isolate the corresponding cDNA by RT-PCR. The cnox-3 Hv gene was isolated from genomic DNA as a 392-bp PCR fragment by using primers derived from the cnox-1 Hm sequence (18), forward CTAATGAGTCARATTCARACWAARCA and reverse CATGATTAAAAATCGTT-CAATATGTTCAAGG.
Phylogenetic Sequence Analyses.
HD sequences were collected on databases by using the netblast search (GCG Wisconsin Package, Ver. 9.1) and aligned by using the pileup (GCG) and genetic data environment software, Ver. 2.2 (35). The evolutionary tree was inferred from 200 HDs sequences (60 residues) by using the neighbor-joining (NJ) method (36) applied to Dayhoff's PAM distance matrix (37). The reliability of internal branches was assessed by using 200 bootstrap replicates (38). The phylo-win program (39) was used for distance computations and NJ tree-building and bootstrapping. In complement, a subset of 67 sequences was analyzed with both the NJ method, applied as above with 1,000 bootstrap replicates, and the maximum-likelihood (ML) method by using the quartet puzzling algorithm (40) that automatically assigns estimations of support to each internal branch. Dayhoff's percent accepted mutations substitution model was used, and the chosen model of rate heterogeneity was a discrete Gamma distribution with eight categories, all necessary parameters being estimated automatically from the dataset. The quartet puzzling search was conducted by using puzzle software, Ver. 4.02, with 25,000 puzzling steps.
Pulse Field Gel Electrophoresis (PFGE) Analysis.
Hydra (Cv) were dissociated (41), and PFGE analysis was performed according to ref. 42 with a few modifications: ×0.25 PBS was used instead of PBS, and each block contained 2 × 106 cells. The gel was run for 43 h at 15°C by using the chef system at 150 V, 30"–300". After migration, the DNA was depurinized for 20 min in 0.25 M HCl, transferred onto Hybond-N membrane (Amersham) under alkaline conditions (43), and hybridized successively to the different probes, as in ref. 15.
In Situ Hybridization.
In situ hybridization by using digoxigenin-labeled riboprobes was performed on whole Hydra following ref. 24, except that proteinase K digestion was replaced by radioimmunoprecipitation assay buffer permeabilization (44). The cnox-1, cnox-2, and cnox-3 probes were 260, 835, and 392 bp long, respectively.
Results
Cloning of Not, Prh/Hex, and Distal-less Hydra Homologs.
To perform an extensive analysis of Antp-class genes, we carried out cloning strategies (15) to obtain a complete set of Hydra representatives. We report here the cloning of three cnidarian Antp-class genes, homologous to the not (Cnot Hv), Prh/Hex (CnHex Hv), and distal-less (Dlx Hv) genes. The putative HD encoded by these three genes showed a high degree of similarity with their triploblastic counterparts (73%, 78%, and 82%, respectively), and these Hydra sequences helped define a consensus sequence with family-specific residues (Fig. 1). Surprisingly, the not and Prh/Hex families do not yet have protostome counterparts.
Figure 1.
Conserved residues at specific positions provide a common signature for all Antp-class HDs and thonon-Hox or the Hox/paraHox HDs (bold). In addition, a family-specific signature is given where identical or equivalent residues between diploblastic and bilaterian sequences are underlined.
Phylogenetic Analyses of Antp-Class Sequences.
See Fig. 7, to be published as supplemental data on the PNAS web site, www.pnas.org. The comparison of 230 Antp-class HD sequences revealed highly conserved residues at specific positions (L26 S/T27 Q44 K46 Q50) that are different or variable in the Prd-class HDs and provided thus a signature for the Antp class (Fig. 1). To clarify relationships between these sequences, phylogenetic analyses were applied to a dataset that included systematically Antp-class HDs from invertebrate organisms (Fig. 2). When rooted with a Prd-class sequence (Hbx4 Eg), the tree inferred from the NJ analysis showed the clear distribution of these sequences into either the non-Hox or the Hox/paraHox families. This distinction was confirmed by analysis of 67 sequences by both the NJ and ML methods. We tested successively a fixed set of Hox/paraHox sequences in the presence of different non-Hox sequences and obtained a significant monophyly of the Hox group when the long branches and the evx sequences were removed (Fig. 3 and data not shown). Given the limited number of sites, the criterion used to define a family was that grouping of HD sequences from at least two distinct species was supported by bootstrap values higher than 50%.
Figure 2.
Phylogenetic relationships between 200 Antp-class genes inferred by NJ analysis by using Dayhoff's PAM distance matrix. The tree was rooted with a Prd-class sequence. All branch lengths were drawn to scale. Numbers at nodes indicate percentages of 200 bootstrap replicates that support the branch; values under 50% are omitted, except for some significantly important nodes. Support values for each family defined on the right are marked in bold. Sequences from diploblasts are in shaded boxes.
Figure 3.
Phylogenetic tree of 57 Hox/paraHox HD sequences inferred by ML analysis where 242,075 of the 677,040 possible quartets of sequences (35.8%) were unresolved, leading to a multifurcating tree with a Log likelihood value of −3,656.89. Numbers above the branches correspond to the quartet puzzling support values; numbers under branches indicate percentages of 1,000 bootstrap replicates for NJ analysis of the same dataset. Ten sequences from non-Hox families (NK2, Msx, Not, and Emx) were used as an outgroup. Shaded boxes as in Fig. 2.
High Conservation of non-Hox Antp-Class Gene Families in Metazoans.
The 13 non-Hox families share few specific residues (S27, E30, T43) in addition to the Antp-class ones and do not appear as a monophyletic group in the phylogenetic tree (Fig. 2). All of them, except Bar-H1 and Tlx/Hox11, were highly supported in our analysis. In addition, within most families a clear congruence between gene and species trees was observed. Of these non-Hox families, three displayed a poriferan cognate member (Msx, Tlx/Hox11, and NK2), and eight a cnidarian one (Not, Emx, Barx, Dlx, Msx, Evx, Prh/Hex, and NK2). Thus only four families have no diploblastic counterpart yet (Bsh, En, Gbx, and Lbx). In contrast to the other non-Hox families, the Evx HDs actually display five of the Hox-specific residues (Fig. 1). Thus, the position of the Evx family remains ambiguous.
Definition and Conservation of Cnidarian Hox/paraHox Families.
The alignment of Hox HD sequences detected 10 Hox-specific residues, also present in most paraHox sequences (Fig. 1). Within the Hox/paraHox group, no poriferan sequence could be found. In addition, the upper part of the tree that contains sequences representative of PG-3 to PG-8 as well as the lox and Ftz sequences included no cnidarian sequences (Fig. 2). In fact, the 23 cnidarian HD sequences formed at least 5 distinct families distributed in the vicinity of anterior (PG-1/2, Gsx) and posterior (PG-9/10, cdx) Hox/paraHox sequences from bilaterian species. The cnox-1 sequences isolated from anthozoan (17, 31) and hydrozoan (15, 18, 22, 23) species appeared as a monophyletic family in both NJ and ML trees (Figs. 2 and 3). This family, whose several members display the PG1-specific F8, N/Q10, R/K11, Q56 residues, is related to the PG-1 HDs only in the NJ tree and with a low bootstrap value (Fig. 2). The cnox-2 HDs, present in anthozoan (D. Miller, personal communication), scyphozoan (28), hydrozoan (15, 18, 19, 23, 29), and placozoan (26) species, share 8 specific residues with the Gsx HDs. Moreover, in both the NJ and ML analyses, cnox-2 branches together clearly with the paraHox Gsx sequences. Similarly, the cnox-5 gene, isolated so far only from Hydra (18), appeared as the diploblastic Mox counterpart. In contrast, the cnox-3 sequences, which were isolated from scyphozoan (28) and hydrozoan (18, 23) species and as multiple copies in two species (23, 28), are more heterogeneous than other cnox families. In all analyses, they form three groups that may come together depending on the type of analyses and selection of sequences (Figs. 2 and 3 and data not shown). In the 67-sequence NJ tree, the cnox-3 HDs that share the K4, R/K10, and E/D29 with the PG-9/10 sequences, cluster together with those (data not shown). Finally, the cnox-4 sequence was characterized only once from hydrozoan (23) and found related to the planarian Pnox-6 HD (45). Cnox-4 harbors 5 Cdx-specific residues (Fig. 1), suggesting that, in agreement with its position in the NJ tree, cnox-4 might share some common ancestor with the cdx family. If one considers cnox-1 and cnox-3 as representatives of proto-Hox genes, their chromosomal linkage would be expected. For this reason, we hybridized Cv genomic DNA submitted to PFGE with the cnox-1 Cv, cnox-2 Cv, and cnox-3 Hv sequences but could detect no chromosomal linkage between these three genes in the range of 150 kb (Fig. 4).
Figure 4.
PFGE analysis of Cv genomic DNA predigested with _Cla_I (2), NruI (3), MluI (4), NarI (5), _Pvu_I (6), _Sma_I (7), or undigested (1) and hybridized to cnox-1 Cv, cnox-2 Cv, cnox-3 Hv, and Bar-H1 Cv [initially named _cnox-3 Cv_ (15)] probes.
Differential Expression of _Hydra Hox/paraHox_-Related Genes During Head Regeneration.
We have examined the expression patterns of three _Hydra Hox/paraHox_-related genes, cnox-1, cnox-2, and cnox-3, by whole-mount in situ hybridization (Fig. 5). In adult polyps, all three genes were restricted to the ectodermal layer; cnox-1 was expressed at low levels in the body column, slightly higher in the hypostome, and at high levels in the future head region of developing buds from stage 2. Cnox-2 transcripts were found along the body column and in a specific subset of head epithelial cells. Cnox-2 was turned on in evaginating buds from stage 3. Finally, cnox-3 was detected exclusively in few cells of the head region. None of them were expressed in the basal region of the animal. During regeneration, cnox-1 expression was turned on early, 2 h after bisection, regardless of the polarity in ectodermal cells of the regenerating tip. Subsequently, its expression became head specific. In contrast, cnox-2 was turned on at a later stage, 24 h after cutting but specifically in the head-regenerating stump. This early–late cnox-2 expression that became detectable several hours before tentacle rudiments emerged persisted in the developing head for 24 h before the adult pattern was reestablished (Fig. 5). The cnox-2 expression detected in the adult body column persisted during regeneration but at a reduced level. Finally, cnox-3 displayed no modulation during either head or foot regeneration.
Figure 5.
Expression pattern of the Hv Hox/paraHox genes, cnox-1 (Top), cnox-2 (Middle), and cnox-3 (Bottom) in adult (Left) and regenerating Hydra. Time points after cutting are given; arrowheads and arrows indicate foot- and head-regenerating stumps, respectively. st, budding stage.
Discussion
Early Evolution of Antp-Class HDs.
The phylogenetic analysis performed on a representative set of Antp-class HDs sequences showed the conservation of seven distinct non-Hox and three Hox/paraHox families from diploblasts to bilaterians. These families can be identified through their residue-specific signature. According to their position within the helix structure, most of these residues are not participating in the DNA-binding function and are thus supposed to be involved in protein–protein interactions, specific for a given family (46). Non-Hox genes are likely the most ancestral ones, some of them being identified in both Porifera and Cnidaria, whereas Hox/paraHox genes would be more recent, so far isolated only from Placozoa and Cnidarians among diploblasts. According to the ambiguous position of the Evx HD sequence and its chromosomal linkage to the Hox gene(s) in coral (17) and mammals (47), one might propose that Hox genes derived from an Evx-like ancestor gene that duplicated before the cnidarians diverged. Moreover, both Hox and paraHox genes were identified in cnidarians, thus the duplication of an ancestral minimal cluster of two or three proto-Hox genes predating the Cnidaria divergence is a plausible scenario (Fig. 6). The absence of chromosomal linkage between cnox-1 and cnox-3 in Hydra could be explained by the rather phylogenetically derived position of Hydra within the Cnidaria phylum and the loss of clustering along evolution. If true, this means that clustering is not required for the developmental function of the _Hydra Hox_-related genes. Interestingly, as previously mentioned (48), none of the Hox/paraHox central genes, PG-3 to PG-8 and lox, were found in cnidarians, which thus probably emerged independently after the divergence of the Cnidaria phylum or alternatively disappeared during the evolution of this phylum. We cannot rule out the possibility that some of the cnox-3 sequences represent intermediate proto-Hox genes.
Figure 6.
Scheme describing a plausible scenario of the evolution of Antp-class genes from diploblastic to bilaterian animals.
Apical Differentiation and Hox/paraHox Gene Expression.
In Hydra, cnox-1 expression was observed in the regenerating stump at the time head organizer was establishing (49). However, in the marine hydrozoan Podocorynae carnae, cnox1 was not found expressed during developmental stages but mostly in striated muscular cells at the medusae stage (22). This suggests that the role of cnox-1 in specifying positional information is not ubiquitously conserved in cnidarians. Cnox-2, whose expression in adult polyps was similar to that found in Hydractinia (29), behaves as an early–late gene during head regeneration. In addition, we could detect no cnox-2 expression during foot regeneration. This temporal regulation of cnox-1 and cnox-2 expressions during head regeneration is in agreement with our previous reverse transcription–PCR analysis of cnox-1 and cnox-2 expression during Cv regeneration (15) but contradicts that found by Shenk et al. (19, 50). By using immunocytochemistry, these authors found Cnox-2 expression suppressed during head regeneration but enhanced during basal regeneration, and, in adult polyps, at low levels in the apex contrasting with high levels in the body column and the basal disk. Because in Hydra cells migrate obligatorily from the body column toward the extremities, this cnox-2 antibody likely did not detect cnox-2-expressing cells located in the head region or during head regeneration.
The spatial regulation of cnox-1 and cnox-2 in the adult head together with their temporal regulation during head regeneration suggest a developmental function in differentiation and maintenance of the apical pole in Hydra. In bilaterians, PG-1 and Gsx genes are involved in the differentiation of anterior embryonic regions (8, 11). Thus this anterior function might have been retained from diploblasts to triploblastics. Similarly, the role of the emx Antp-class gene (27) and the prdl-a paired-class gene (33) during head patterning might be evolutionarily conserved. In contrast, the cnox-3 gene, which displays some relatedness with the posterior Hox genes, was not found involved either in basal or in apical differentiation. These results suggest that head formation but not axis differentiation can be traced back in the cnidarians (51), which is partially in agreement with the zootype hypothesis (6). Antp-class as well as Prd-class genes were not found outside the metazoan animals, and their emergence with new developmental functions in diploblasts could have favored the evolution of highly adapted and more complex structures.
Supplementary Material
Supplemental Figure
Acknowledgments
We are grateful to Michèle Millet and Cedric Ascensio for technical help, Mikael Akam and David Miller for communicating sequences before publication, Bjorn Neumann for advice and help concerning PFGE experiments, Chica Schaller for her support, and Peter Holland for helpful comments on the manuscript. This work was supported by the National Swiss Foundation and the Canton de Genève.
Abbreviations
Cv, Chlorohydra viridissima
Hv, Hydra vulgaris
HD
homeodomain
ML
maximum likelihood
NJ
neighbor joining
PFGE
pulse field gel electrophoresis
Footnotes
This paper was submitted directly (Track II) to the PNAS office.
The sequences reported in this paper have been deposited in the GenBank database (accession nos. cnox-1 Hv, AJ252181; cnox-2 Hv, AJ277388; cnox-3 Hv, AJ252182; dlx Hv, AJ252183; cnot Hv, AJ252184; cnHex Hv, AJ252185; msh Hv, AJ271008).
References
- 1.Lewis E B. Nature (London) 1978;276:565–570. doi: 10.1038/276565a0. [DOI] [PubMed] [Google Scholar]
- 2.Gehring W J. Cell. 1985;40:3–5. doi: 10.1016/0092-8674(85)90300-9. [DOI] [PubMed] [Google Scholar]
- 3.Duboule D, Dolle P. EMBO J. 1989;8:1497–1505. doi: 10.1002/j.1460-2075.1989.tb03534.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Graham A, Papalopulu N, Krumlauf R. Cell. 1989;57:367–378. doi: 10.1016/0092-8674(89)90912-4. [DOI] [PubMed] [Google Scholar]
- 5.Simeone A, Acampora D, Gulisano M, Stornaiuolo A, Boncinelli E. Nature (London) 1992;358:687–690. doi: 10.1038/358687a0. [DOI] [PubMed] [Google Scholar]
- 6.Slack J M, Holland P W, Graham C F. Nature (London) 1993;362:490–492. doi: 10.1038/361490a0. [DOI] [PubMed] [Google Scholar]
- 7.Galliot B, de Vargas C, Miller D. Dev Genes Evol. 1999;209:186–197. doi: 10.1007/s004270050243. [DOI] [PubMed] [Google Scholar]
- 8.McGinnis W, Krumlauf R. Cell. 1992;68:283–302. doi: 10.1016/0092-8674(92)90471-n. [DOI] [PubMed] [Google Scholar]
- 9.de Rosa R, Grenier J K, Andreeva T, Cook C E, Adoutte A, Akam M, Carroll S B, Balavoine G. Nature (London) 1999;399:772–776. doi: 10.1038/21631. [DOI] [PubMed] [Google Scholar]
- 10.Schubert F R, Nieselt-Struwe K, Gruss P. Proc Natl Acad Sci USA. 1993;90:143–147. doi: 10.1073/pnas.90.1.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Brooke N M, Garcia-Fernandez J, Holland P W. Nature (London) 1998;392:920–922. doi: 10.1038/31933. [DOI] [PubMed] [Google Scholar]
- 12.Zhang J, Nei M. Genetics. 1996;142:295–303. doi: 10.1093/genetics/142.1.295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Murtha M T, Leckman J F, Ruddle F H. Proc Natl Acad Sci USA. 1991;88:10711–10715. doi: 10.1073/pnas.88.23.10711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Schierwater B, Murtha M, Dick M, Ruddle F H, Buss L W. J Exp Zool. 1991;260:413–416. doi: 10.1002/jez.1402600316. [DOI] [PubMed] [Google Scholar]
- 15.Schummer M, Scheurlen I, Schaller C, Galliot B. EMBO J. 1992;11:1815–1823. doi: 10.1002/j.1460-2075.1992.tb05233.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Miles A, Miller D J. Proc R Soc London. 1992;248:159–161. doi: 10.1098/rspb.1992.0057. [DOI] [PubMed] [Google Scholar]
- 17.Miller D J, Miles A. Nature (London) 1993;365:215–216. doi: 10.1038/365215b0. [DOI] [PubMed] [Google Scholar]
- 18.Naito M, Ishiguro H, Fujisawa T, Kurosawa Y. FEBS Lett. 1993;333:271–274. doi: 10.1016/0014-5793(93)80668-k. [DOI] [PubMed] [Google Scholar]
- 19.Shenk M A, Bode H R, Steele R E. Development (Cambridge, UK) 1993;117:657–667. doi: 10.1242/dev.117.2.657. [DOI] [PubMed] [Google Scholar]
- 20.Seimiya M, Ishiguro H, Miura K, Watanabe Y, Kurosawa Y. Eur J Biochem. 1994;221:219–225. doi: 10.1111/j.1432-1033.1994.tb18732.x. [DOI] [PubMed] [Google Scholar]
- 21.Degnan B M, Degnan S M, Giusti A, Morse D E. Gene. 1995;155:175–177. doi: 10.1016/0378-1119(94)00908-b. [DOI] [PubMed] [Google Scholar]
- 22.Aerne B L, Baader C D, Schmid V. Dev Biol. 1995;169:547–556. doi: 10.1006/dbio.1995.1168. [DOI] [PubMed] [Google Scholar]
- 23.Kuhn K, Streit B, Schierwater B. Mol Phylogenet Evol. 1996;6:30–38. doi: 10.1006/mpev.1996.0055. [DOI] [PubMed] [Google Scholar]
- 24.Grens A, Gee L, Fisher D A, Bode H R. Dev Biol. 1996;180:473–488. doi: 10.1006/dbio.1996.0321. [DOI] [PubMed] [Google Scholar]
- 25.Finnerty J R, Martindale M Q. Biol Bull. 1997;193:62–76. doi: 10.2307/1542736. [DOI] [PubMed] [Google Scholar]
- 26.Schierwater B, Kuhn K. Mol Phylogenet Evol. 1998;9:375–381. doi: 10.1006/mpev.1998.0489. [DOI] [PubMed] [Google Scholar]
- 27.Mokady O, Dick M H, Lackschewitz D, Schierwater B, Buss L W. Proc Natl Acad Sci USA. 1998;95:3673–3678. doi: 10.1073/pnas.95.7.3673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kuhn K, Streit B, Schierwater B. J Exp Zool. 1999;285:63–75. doi: 10.1002/(sici)1097-010x(19990415)285:1<63::aid-jez8>3.0.co;2-x. [DOI] [PubMed] [Google Scholar]
- 29.Cartwright P, Bowsher J, Buss L W. Proc Natl Acad Sci USA. 1999;96:2183–2186. doi: 10.1073/pnas.96.5.2183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Richelle-Maurer E, Van de Vyver G. Mech Aging Dev. 1999;109:203–219. doi: 10.1016/s0047-6374(99)00037-8. [DOI] [PubMed] [Google Scholar]
- 31.Finnerty J, Martindale M. Evol Dev. 1999;1:16–23. doi: 10.1046/j.1525-142x.1999.99010.x. [DOI] [PubMed] [Google Scholar]
- 32.Bürglin T R. In: Guide to the Homeobox Genes. Duboule D, editor. New York: Oxford Univ. Press; 1994. pp. 27–71. [Google Scholar]
- 33.Gauchat D, Kreger S, Holstein T, Galliot B. Development (Cambridge, UK) 1998;125:1637–1645. doi: 10.1242/dev.125.9.1637. [DOI] [PubMed] [Google Scholar]
- 34.Galliot B, Schummer M. Trends Genet. 1993;9:3–4. doi: 10.1016/0168-9525(93)90051-I. [DOI] [PubMed] [Google Scholar]
- 35.Larsen N, Olsen G J, Maidak B L, McCaughey M J, Overbeek R, Macke T J, Marsh T L, Woese C R. Nucleic Acids Res. 1993;21:3021–3023. doi: 10.1093/nar/21.13.3021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Saitou N, Nei M. Mol Biol Evol. 1987;4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
- 37.Dayhoff M O, Schwartz R M, Orcutt B C. In: Atlas of Protein Sequence and Structure. Dayhoff M O, editor. 5, Suppl. 3. Silver Spring, MD: National Biomedical Research Foundation; 1978. pp. 345–352. [Google Scholar]
- 38.Felsenstein J. Annu Rev Genet. 1988;22:521–565. doi: 10.1146/annurev.ge.22.120188.002513. [DOI] [PubMed] [Google Scholar]
- 39.Galtier N, Gouy M, Gautier C. Comput Appl Biosci. 1996;12:543–548. doi: 10.1093/bioinformatics/12.6.543. [DOI] [PubMed] [Google Scholar]
- 40.Strimmer K, von Haeseler A. Mol Biol Evol. 1996;13:964–969. [Google Scholar]
- 41.Greber M J, David C N, Holstein T W. Roux's Arch Dev Biol. 1992;201:296–300. doi: 10.1007/BF00592110. [DOI] [PubMed] [Google Scholar]
- 42.Neumann B, Pospiech A, Schairer H U. J Bacteriol. 1992;174:6307–6310. doi: 10.1128/jb.174.19.6307-6310.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
- 44.Rosen B, Beddington R S. Trends Genet. 1993;9:162–167. doi: 10.1016/0168-9525(93)90162-b. [DOI] [PubMed] [Google Scholar]
- 45.Balavoine G, Telford M J. Proc Natl Acad Sci USA. 1995;92:7227–7231. doi: 10.1073/pnas.92.16.7227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Sharkey M, Graba Y, Scott M P. Trends Genet. 1997;13:145–151. doi: 10.1016/s0168-9525(97)01096-2. [DOI] [PubMed] [Google Scholar]
- 47.Dolle P, Fraulob V, Duboule D. Development (Cambridge, U.K.) 1994. Suppl., 143–153. [PubMed] [Google Scholar]
- 48.Martinez D E, Bridge D, Masuda-Nakagawa L M, Cartwright P. Nature (London) 1998;393:748–749. doi: 10.1038/31616. [DOI] [PubMed] [Google Scholar]
- 49.MacWilliams H K. Dev Biol. 1983;96:239–257. doi: 10.1016/0012-1606(83)90325-1. [DOI] [PubMed] [Google Scholar]
- 50.Shenk M A, Gee L, Steele R E, Bode H R. Dev Biol. 1993;160:108–118. doi: 10.1006/dbio.1993.1290. [DOI] [PubMed] [Google Scholar]
- 51.Galliot B, Miller D J. Trends Genet. 2000;16:1–5. doi: 10.1016/s0168-9525(99)01888-0. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental Figure