Factors influencing T-lymphopoiesis after allogeneic... : Transplantation (original) (raw)
Allogeneic hematopoietic cell transplants (HCT) recipients are immunocompromised for more than 1 year after grafting (1). Quantitative CD4 T cell deficiency plays a role in the susceptibility of transplant recipients to infections (2,3). This T cell deficiency may be due in part to low production of T cells from stem cells (T-lymphopoiesis). Posttransplant T-lymphopoiesis can be assessed by quantitating T cell receptor excision circles (TRECs) (DNA episomes produced during T cell receptor gene rearrangement) (4,5). We evaluated factors that might influence the quantity of TRECs in HCT recipients. The following factors were considered: (1) CD34 cell dose, (2) graft type (marrow vs. blood stem cells), because blood stem cell recipients receive ∼3 times more CD34 cells and ∼10 times more T cells (6), (3) patient and donor age, because young normal individuals have more cellular thymi and higher circulating TREC levels and young autologous HCT recipients show faster recovery of TRECs (4,5,7), (4) myeloablative conditioning (with vs. without irradiation), because thymic irradiation might impair the function of thymic stroma (8), and (5) acute graft-versus-host disease (aGVHD) or chronic graft-versus-host disease (cGVHD), because GVHD and/or its treatment has been associated with thymic atrophy and/or impaired T-lymphopoiesis (9).
PATIENTS AND METHODS
Because one of the goals was to determine how T-lymphopoiesis was influenced by the graft type, we studied patients randomized to receive either marrow or filgrastim-mobilized blood stem cells (10). Of 140 patients treated at the Fred Hutchinson Cancer Research Center randomly with either transplant type by January 1, 2000, 128 patients agreed to IRB-approved studies of immune reconstitution. Twenty-eight patients died or relapsed by day 80 and one patient received marrow instead of blood stem cells, leaving 99 patients eligible for the assessment of T-lymphopoiesis between day 80 and 365 after transplant. We studied cryopreserved mononuclear cells from approximately day 80 and/or 365. These were available for 48 of the 99 patients. Details of the treatment and the lymphocyte subset (by immunophenotyping) reconstitution of the 99 patients have been reported (6). The T cell reconstitution of the subset of the 48 patients was representative of the entire group, because the median CD45RAhigh CD4 T cell count of the 48 patients was similar to that of the 99 patients on both day 80 (23 vs. 21×106/L, respectively, P =0.62, Mann-Whitney-Wilcoxon test, n=48 vs. 89) and day 365 (59 vs. 63×106/L, respectively, P =0.66, n=35 vs. 54). Characteristics of the 48 patients are displayed in Table 1. Thirteen patients were studied on day 80, 12 patients on day 365, and 23 patients at both time points. Around day 80 and 365, detailed restaging was performed and confirmed that all 48 patients were in complete remission from their original hematologic malignancy. HCT donors were used as controls.
Patient characteristics (n=48)
The α/δ signal joint TREC level (number of TREC copies per 100,000 FACS-sorted CD3+CD4+ or CD3+CD8+ cells) was determined by real-time quantitative polymerase chain reaction (PCR) as described (5). Briefly, sorted cells were lysed in 100 μg/ml of proteinase K at 107 cells/ml. The 5′-nuclease (Taqman) assay was performed on 5 μl of cell lysate (total volume of the lysate of 100,000 cells was 80 μl) with the primers: cacatccctttcaaccatgct and gccagctgcagggtttagg, and probe FAM-acacctctggtttttgtaaaggtgcccact-TAMRA (MegaBases, Chicago, IL). PCR reactions contained 0.5 U of Taq polymerase, 3.5 mM of MgCl2, 0.2 mM of dNTPs, 500 nM of each primer, 150 nM of probe, and Blue-636 reference (MegaBases). The reactions were run at 95°C for 5 min, then 95°C for 15 sec and 60°C for 1 min for 40 cycles, using ABI7700 system (PE Biosystems, Norwalk, CT). Samples were analyzed in quintuplet. A standard curve was plotted, and TREC levels (the number of TREC copies per 100,000 CD4 or CD8 T cells) were calculated using the ABI7700 software. The TREC levels reflect not only the de novo generation of T cells but also the post-rearrangement expansion of thymocytes or T cells. For example, the TREC levels misleadingly drop when peripheral T cells proliferate as a result of an infection. In contrast, the absolute count of TREC-containing (TREC+) T cells (per unit blood volume) is not influenced by post-rearrangement proliferation and thus serves as a better indicator of the quantity of de novo generated T cells. Therefore, we calculated the absolute count of TREC+ CD4 (CD8) T cells (per microliter) as the TREC level (per 100,000 cells) multiplied by the absolute CD4 (CD8) T cell count (per microliter) and divided by 100,000. The absolute counts of CD4 (CD8) T cells and their subsets were determined by 3-color flow cytometry as described (6).
Associations between the absolute counts of TREC+ CD4 (CD8) T cells and CD34 cell dose, patient age, or donor age were tested by Spearman rank correlation. Differences in TREC+ CD4 (CD8) T cell counts between blood stem cells versus marrow recipients, patients conditioned with versus without irradiation, patients with versus without aGVHD (grade>1) at any time during the first 80 days posttransplant, and patients with versus without cGVHD (clinical extensive) at any time between day 80 and 365 were tested using Mann-Whitney-Wilcoxon rank-sum test. Effects of aGVHD or cGVHD could not be dissected from effects of immunosuppressive drugs, because there were few patients on immunosuppressive drugs without GVHD and few patients off immunosuppressive drugs with GVHD.
RESULTS AND DISCUSSION
On day 80, median counts of TREC+ CD4 as well as TREC+ CD8 T cells were 0 (25–75th percentile, 0–3.6×106/L for CD4 cells and 0–0.9×106/L for CD8 cells). By day 365, the median counts increased to 14.7×106/L TREC+ CD4 T cells (25–75th percentile, 4.2–30.2×106/L) and 10.4×106/L TREC+ CD8 T cells (25–75th percentile, 0–27.2×106/L). Thus, substantial T cell generation from stem cells occurred in our adult patients between days 80 and 365. Nevertheless, day 365 TREC counts were still lower than donor counts (Fig. 1).
Counts of TREC+ CD4 T cells and TREC+ CD8 T cells in the transplant recipients on days 80 (n=36) and 365 (n=35) and in their donors (n=21). The circles denote medians and the error bars denote the 25–75th percentiles.
To evaluate whether the substantial T cell generation between days 80 and 365 occurred primarily before or after day 180, we retrospectively studied blood from 10 patients, whose day 180 samples were available in addition to both days 80 and 365 samples. As shown in Figure 2, T-lymphopoiesis appeared to be particularly robust between days 80 and 180.
Serial (days 80, 180, and 365) counts of TREC+ CD4 and TREC+ CD8 T cells in 10 patients whose day 180 blood samples were available in addition to both days 80 and 365 samples. For the CD8 cells, the line connecting 0-0-0 TREC+ cells pertains to two patients.
Day 80 counts of TREC+ CD4 as well as TREC+ CD8 T cells showed no association with patient or donor age, CD34 cell dose, conditioning (with vs. without irradiation), disease type (poor risk vs. good risk;Table 1), or aGVHD. The day 80 counts appeared slightly lower in marrow compared to blood stem cell recipients (median 0 vs. 0.7×106/L for CD4 cells, P =0.05, 0 vs. 0.3×106/L for CD8 cells, P =0.06), possibly due to the lower number of naive T cells infused with the graft (6).
Day 365 counts of TREC+ CD4 T cells showed an inverse correlation with patient age (Fig. 3). This is consistent with previously reported associations between the age of patients recovering from allogeneic HCT and their CD45RAhigh (presumed naïve) CD4 T cell counts (11,12) and with the fact that in the current patients on day 365 there was a significant correlation between the counts of TREC+ CD4 T cells and CD45RAhigh CD4 T cells (Fig. 4). Day 365 TREC+ CD4 T cell counts appeared associated also with donor age (r =−0.33, P =0.05) and cGVHD (median 10 vs. 26×106/L with vs. without cGVHD, P =0.07). Multiple regression analysis of ranked data was performed to discern the effect of patient age from that of donor age or cGVHD. After adjusting for patient age the association between day 365 TREC+ CD4 T cell counts and donor age became insignificant (P =0.35), whereas after adjusting for donor age the association between the counts and patient age remained marginally significant (P =0.08). Similarly, after adjusting for patient age the association between day 365 TREC+ CD4 T cell counts and cGVHD became insignificant (P =0.24), whereas after adjusting for cGVHD the association between the counts and patient age remained significant (P =0.04). Thus, patient age had, whereas donor age and chronic GVHD did not, a major influence on CD4 T-lymphopoiesis. This is in agreement with our previous study describing the inverse correlation between day 365 CD45RAhigh CD4 T cell counts and patient age but no significant association between the counts and donor age or cGVHD (11). Both studies were focused on adult patients. In a recent paper focused on pediatric patients, Weinberg et al. (13) concluded that CD4 T-lymphopoiesis was influenced primarily by cGVHD, whereas patient age played a minor, if any, role. Weinberg et al. (13) also noted that in patients without active cGVHD there was a highly significant inverse correlation between CD4 TREC levels and patient age in >16-year-old patients (r =−0.89) but no such correlation in <16-year-old patients. Thus, it is possible that CD4 T-lymphopoiesis is affected primarily by patient age in adults and by cGVHD in children. The insufficient T-lymphopoiesis in adult patients appears to extend beyond 20 years posttransplant (14). We found no significant association between day 365 TREC+ CD4 T cell counts and CD34 cell dose, marrow versus blood stem cell graft, conditioning (with vs. without irradiation), disease type (poor risk vs. good risk), or a history of aGVHD.
TREC+ CD4 T cell counts at 1-year posttransplant correlated with patient age.
Association between the counts of TREC+ T cells and phenotypically naïve T cells at 1-year posttransplant.
TREC+ CD8 T cell counts on day 365 did not show a significant association with patient age, donor age, CD34 cell dose, marrow versus blood stem cell graft, conditioning, disease type, or a history of aGVHD (P >0.25 in univariate analyses). In agreement with Weinberg et al. (13), there was a trend toward lower TREC+ CD8 T cell counts in patients with cGVHD (Fig. 5). Of interest, there was a significant correlation between the counts of CD11alow (presumed naïve) CD8 T cells and TREC+ CD8 T cells on day 365 (Fig. 3).
TREC+ CD8 T cell counts in patients with (n=23) versus without (n=12) clinical extensive cGVHD.
We also evaluated the relevance of the TREC+ T cell counts to the size of the posttransplant T cell pool. There were no significant correlations between day 80 TREC+ CD4 or CD8 T cell counts and day 80 total CD4 or CD8 T cell counts, perhaps because too few T cells had been produced from stem cells by day 80 to impact the size of the T cell pool. However, there was a strong correlation between day 365 TREC+ CD4 T cell counts and day 365 total CD4 T cell counts (Fig. 6). In contrast, there was minimal, if any, correlation between day 365 TREC+ CD8 T cell counts and day 365 total CD8 T cell counts (Fig. 6).
(A) Association between day 365 TREC+ CD4 T cell counts and day 365 total CD4 T cell counts. (B) Trend toward association between day 365 TREC+ CD8 T cell counts and day 365 total CD8 T cell counts.
In summary, reconstitution of the CD4 T cell pool between days 80 and 365 strongly depends on CD4 T-lymphopoiesis, which depends primarily on patient age. Reconstitution of the CD8 T cell pool seems to depend on CD8 T-lymphopoiesis to a lesser degree, and CD8 T-lymphopoiesis may be influenced primarily by cGVHD and/or its treatment.
Acknowledgments.
The authors thank Patrick Sudour, Terry Stevens-Ayers, Kristen White, Erica Ryberg, Amber Wyman, and Hana Gage for excellent technical assistance. They appreciate the help of Terri Cunningham, R.N., Michael Boeckh, M.D., Meei-Li Huang, Ph.D., and Lawrence Corey, M.D. The authors also thank the patients who agreed to participate in the study and appreciate the hard work of the staff of the FHCRC Long-Term Follow-Up Department who diligently gathered clinical information.
REFERENCES
1. Storek J, Witherspoon RP. Immunologic reconstitution after hematopoietic stem cell transplantation. In: Atkinson K, ed. Clinical bone marrow and blood stem cell transplantation. Cambridge: Cambridge University Press, 2000: 111.
2. Small TN, Avigan D, Dupont B, et al. Immune reconstitution following T-cell depleted bone marrow transplantation: effect of age and posttransplant graft rejection prophylaxis. Biol Blood Marrow Transplant 1997; 3: 65.
3. Storek J, Gooley T, Witherspoon RP, Sullivan KM, Storb R. Infectious morbidity in long-term survivors of allogeneic marrow transplantation is associated with low CD4 T cell counts. Am J Hematol 1997; 54: 131.
4. Douek DC, McFarland RD, Keiser PH, et al. Changes in thymic function with age and during the treatment of HIV infection. Nature 1998; 396: 690.
5. Douek DC, Vescio RA, Betts MR, et al. Assessment of thymic output in adults after haematopoietic stem-cell transplantation and prediction of T-cell reconstitution. Lancet 2000; 355: 1875.
6. Storek J, Dawson MA, Storer B, et al. Immune reconstitution after allogeneic marrow transplantation compared with blood stem cell transplantation. Blood 2001; 97: 3380.
7. George AJ, Ritter MA. Thymic involution with ageing: obsolescence or good housekeeping? Immunol Today 1996; 17: 267.
8. Chung B, Barbara-Burnham L, Barsky L, Weinberg K. Radiosensitivity of thymic interleukin-7 production and thymopoiesis after bone marrow transplantation. Blood 2001 98 (5): 1601–1606.
9. Hakim FT, Mackall CL. The immune system: effector and target of GVHD. In: Ferrara JLM, Deeg HJ, Burakoff SJ, eds. Graft-vs.-host disease. New York: Marcel Dekker, 1997: 257.
10. Bensinger WI, Martin P, Storer B, et al. Transplantation of bone marrow as compared with peripheral blood cells from HLA-identical relatives in patients with hematologic malignancies. N Engl J Med 2001; 344: 175.
11. Storek J, Witherspoon RP, Storb R. T cell reconstitution after bone marrow transplantation into adult patients does not resemble T cell development in early life. Bone Marrow Transplant 1995; 16: 413.
12. Weinberg K, Annett G, Kashyap A, Lenarsky C, Forman SJ, Parkman R. The effect of thymic function on immunocompetence following bone marrow transplantation. Biol Blood Marrow Transplant 1995; 1: 18.
13. Weinberg K, Blazar BR, Wagner JE, et al. Factors affecting thymic function after allogeneic hematopoietic stem cell transplantation. Blood 2001; 97: 1458.
14. Storek J, Joseph A, Espino G, et al. Immunity of patients surviving 20 to 30 years after allogeneic or syngeneic bone marrow transplantation. Blood 2001; 98 (13): 3505–3512.
© 2002 Lippincott Williams & Wilkins, Inc.