Angiogenic Acceleration of Neu Induced Mammary Tumor Progression and Metastasis (original) (raw)

Skip Nav Destination

Cell and Tumor Biology| January 16 2004

Robert G. Oshima;

1Oncodevelopmental Biology Program, The Burnham Institute, La Jolla, California;

Search for other works by this author on:

Jacqueline Lesperance;

1Oncodevelopmental Biology Program, The Burnham Institute, La Jolla, California;

Search for other works by this author on:

Varinia Munoz;

1Oncodevelopmental Biology Program, The Burnham Institute, La Jolla, California;

Search for other works by this author on:

Lionel Hebbard;

1Oncodevelopmental Biology Program, The Burnham Institute, La Jolla, California;

Search for other works by this author on:

Barbara Ranscht;

1Oncodevelopmental Biology Program, The Burnham Institute, La Jolla, California;

Search for other works by this author on:

Niki Sharan;

2The Institute for Molecular Biology and Biotechnology, McMaster University, Hamilton, Ontario, Canada;

Search for other works by this author on:

William J. Muller;

3Molecular Oncology Group, Departments of Medicine and Biochemistry, McGill University, Montreal, Quebec, Canada; and

Search for other works by this author on:

Craig A. Hauser;

1Oncodevelopmental Biology Program, The Burnham Institute, La Jolla, California;

Search for other works by this author on:

Robert D. Cardiff

4Pathology Department, University of California, Davis, California

Search for other works by this author on:

Received: July 01 2003

Revision Received: October 20 2003

Accepted: October 21 2003

Online ISSN: 1538-7445

Print ISSN: 0008-5472

2004

Cancer Res (2004) 64 (1): 169–179.

Article history

Revision Received:

October 20 2003

Accepted:

October 21 2003

Split-Screen
Views Icon Views
Open the PDF for in another window
Tools Icon Tools
Search Site
Article Versions Icon Versions
- Version of Record January 16 2004

Abstract

The Neu (ErbB2, HER2) member of the epidermal growth factor receptor family is implicated in many human breast cancers. We have tested the importance of increased angiogenic signaling in the NeuYD [mouse mammary tumor virus (MMTV)-Neundl-YD5] mammary tumor model. Transgenic mice expressing vascular endothelial growth factor (VEGF)164 from the MMTV promoter were generated. These mice expressed VEGF164 RNA and protein at 20- to 40-fold higher levels throughout mammary gland development but exhibited normal mammary gland development and function. However, in combination with the NeuYD oncogene, VEGF164 expression resulted in increased vascularization of hyperplastic mammary epithelium and dramatic acceleration of tumor appearance from 111 to 51 days. Gene expression profiling also indicated that the VEGF-accelerated tumors were substantially more vascularized and less hypoxic. The preferential vascularization of early hyperplastic portions of mammary epithelia in NeuYD;MMTV-VEGF animals was associated with NeuYD RNA expression, disorganization of the tight junctions, and overlapping transgenic VEGF expression. NeuYD;MMTV-VEGF164 bigenic, tumor-bearing animals resulted in an average of 10 tumor cell colonies/lung lodged within vascular spaces. No similar lung colonies were found in control NeuYD mice with similar tumor burdens. Overall, these results demonstrate the angiogenic restriction of early hyperplastic mammary lesions. They also reinforce in vivo the importance of activated Neu in causing disorganization of mammary luminal epithelial cell junctions and provide support for an invasion-independent mechanism of metastasis.

INTRODUCTION

Activation of Neu (HER2, ErbB2), a member of the epidermal growth factor receptor family, has been implicated in the progression of a subset of human breast cancers. The evidence includes the amplification and elevated expression of ErbB2 in human breast cancers, the clinical efficacy of anti-ErbB2 antibodies for patients with elevated ErbB2 levels, and mammary tumors arising in transgenic mice as a consequence of mammary epithelial expression of oncogenic forms of Neu (1, 2). Systematic investigations of the mechanisms by which activated Neu induces tumor formation and metastasis have revealed distinct and overlapping transforming signals emanating from four of five tyrosine autophosphorylation sites (3). Use of add back mutants, in which only one of the five autophosphorylation sites is capable of signaling, revealed that recruitment of Shc (Src homology 2 domain-containing transforming protein 1) to Neu tyrosine 1227 within the context of an activating extracellular deletion was sufficient to generate mammary tumors similar to those caused by the fully competent oncogene and resembling human comedocarcinoma (4). This form of Neu was also shown capable of causing disruption of epithelial cell interaction but was limited in its ability to induce invasive behavior in vitro (5). Tumors arising in mice expressing NeuYD driven by the MMTV promoter did not efficiently metastasize to the lung.

Vascular endothelial growth factor (VEGF) A is a critical angiogenic growth factor necessary for the development, remodeling, and control of permeability of blood vessels (6, 7). Of the three major forms of VEGF (VEGF121, VEGF164, VEGF189), VEGF164 rescues the vasculature of VEGF-deficient tumor cells most efficiently (8). In transgenic mice, VEGF164 is a potent angiogenic stimulus (9). The transition of hyperplasia to neoplasia has been correlated with the induction of angiogenesis (10). The acquisition of angiogenic activity during pancreatic tumor formation in transgenic mice involves VEGF and its mobilization by the action of matrix metalloproteinase-9 (11, 12). Transgenic expression of VEGF in pancreatic tumors accelerates the onset of tumors but does not increase metastasis (13). During skin tumor progression, inflammatory cells contribute metalloproteinase to mobilize VEGF from extracellular matrix (14). In breast cancer cells, ErbB2 signaling may increase VEGF expression (15, 16) through phosphatidylinositol 3′-kinase and AKT-dependent increased hypoxia-inducible factor-1α synthesis (17). The coactivation of epidermal growth factor receptor (EGFR, ErbB1) or ErbB3 signaling in Neu-initiated mammary tumors (18) and the demonstrated importance of phosphatidylinositol 3′-kinase in polyomavirus middle T antigen-induced tumors (19) may reflect requirements for increasing VEGF expression in mammary tumor cells.

Increased tumor vessel density is correlated with metastasis and poor outcome. Currently, tumor metastasis is thought to involve increased tumor cell motility and invasion of vascular or lymph vessel spaces, movement to a distal site, and infiltration across cellular and basement membrane barrier (20, 21). However, a noninvasive mechanism of metastasis has been suggested on the basis of analysis of a highly angiogenic and metastatic experimental tumor (22). For a highly angiogenic tumor, tumor emboli may bud off into tumor vascular spaces and lodge in the capillary beds of distal organs, where they may grow noninvasively.

Here we have tested the importance of angiogenesis on the progression of Neu initiated mammary tumors by generating transgenic mice that express both NeuYD and VEGF164 in the luminal epithelial cells of the mammary gland. Our results demonstrate a key role of angiogenesis on the very early progression of mammary hyperplastic disease, reinforce in vivo the role of Neu in causing disorganization of the polarized mammary epithelium, and show that increased vascularity of tumors leads to increased metastasis, apparently by an invasion-independent mechanism.

MATERIALS AND METHODS

Vector Construction.

The murine cDNA coding for the 164-residue form of VEGF was cloned from mouse kidney RNA by reverse transcription-PCR with the primers shown in Table 1. This amplified a 707 bp region of the VEGF mRNA (GenBank accession no. NM_009505) including 56 nucleotide(s) (nt) of the 5′ noncoding region and 77 nt of 3′ noncoding region coding. Cleavage of the peptide leader of the cloned form would generate VEGF164. After digestion with _Hin_DIII and _Eco_RI, the amplified fragment was cloned into the MMTV vector (1) and sequenced.

Transgenic Mice.

MMTV-VEGF transgenic mice were generated by a standard pronuclear DNA injection and screened by PCR of tail DNA for the presence of the MMTV vector or specifically for the MMTV-VEGF transgene (Table 1). Of 21 transgenic founders detected by PCR, 16 transmitted the transgene, and 14 were screened for transgene expression in virgin mammary gland. Two moderately expressing lines, MMTV-VEGF-25 (VEGF-25) and MMTV-VEGF-64 (VEGF-64), and one very high level expressing line, MMTV-VEGF-89 (VEGF-89), were examined in more detail.

Mammary Tumor Analysis.

VEGF-25 and VEGF-64 mice were mated to the MMTV-Neundl-YD5 (NeuYD) line that develops mammary tumors with 100% penetrance (4). The PCR primers for genotyping these animals are shown in Table 1. A subset of animals was also mated to the FVB/N-TgN (TIE2-lacZ) 182Sato (Tie2-LacZ) transgenic animals obtained from the Jackson Laboratory for visualization of endothelial cells. Histochemical staining for β-galactosidase of ear punch pieces was routinely used for the identification of these transgenic mice. All three mouse lines were in the FVB/N genetic background. Female animals with the appropriate genotypes were examined for tumors by palpation three times weekly starting at 30 days of age. After discovery, the length and width of tumors were measured with calipers minimally three times weekly until the tumors reached approximately 1 cm in diameter. Tumor volume was calculated as (length × width2)/2. Tumor growth was measured for the single largest tumor of 11 NeuYD;VEGF-25 mice and 9 NeuYD mice. Average values represent between 3 and 11 individual values for each time point. Linear regression analysis of all the data points and comparisons of the slopes were performed by Prism software (GraphPad).

Protein Analysis.

VEGF protein was measured with an ELISA assay (R&D Systems). Frozen tissues were homogenized in the provided lysis buffer, and tissues lysates were cleared by centrifugation at 15,000 × g at 4°C. If present, the fat layer was discarded, and the cleared protein lysate was used. Protein content of tissue lysates was determined with the Bio-Rad detergent-compatible protein assay.

For the analysis of Neu, ErbB2, Grb2, and Akt, tissue samples were prepared and analyzed by electrophoresis and immunoblotting as described previously (4).

Histology.

Mammary fat pads were excised, mounted on glass slides, fixed in acidic ethanol (Carnoy’s fixative or buffered formaldehyde), and stained with carmine alum overnight (23). For visualization of bacterial β-galactosidase, mammary tissues were fixed and stained as described previously (24). Apoptotic cells were identified with a commercial terminal deoxynucleotidyltransferase-mediated nick end labeling staining kit (Apotag kit; Intergen) according to the instructions of the manufacturer. For vascular perfusion of the mammary gland, animals under deep anesthesia were perfused through the left ventricle with the use of a peristaltic pump and a volume equal to 50% of the body weight of the animal. Colloidal carbon particles from Higgins India ink were sized by differential centrifugation (25). After resuspension in a starting volume of PBS, material was filtered through 4.5-μm nitrocellulose filters and used after diluting 4-fold.

Immunochemistry.

Antibody staining of CD31 antigen was performed on formaldehyde-fixed, paraffin embedded tumors. For increased sensitivity, normal and hyperplastic mammary tissue was fixed and extracted overnight in acetone at −20°C. The tissue was then incubated with 30% sucrose in PBS for several hours at 4°C and frozen in OCT medium for frozen sections. Air dried frozen sections were pretreated with hydrogen peroxide, blocked, washed, and visualized using the Vector Laboratories avidin-biotin complex method kit except mouse-absorbed, biotin-labeled rabbit antirat IgG secondary antibody (Vector Laboratories) was used. The primary antibody was rat monoclonal antibody to mouse CD31 (catalogue no. 557355; PharMingen). For immunofluorescence, mammary glands and tumors were snap frozen in liquid nitrogen. Ten-μm cryosections were prepared and fixed in acetone for 10 min. Sections were blocked in 10% FCS in Tris-HCl buffered saline for 30 min and incubated overnight with rat anti-E-cadherin (catalogue no. 13-1900; Zymed) and zonula occludens-1 (ZO-1) antibodies (catalogue no. R26.4C; Developmental Studies Hybridoma Bank, Iowa). Rabbit anti-mouse keratin 18 (26), rabbit antibody against mouse T-cadherin5 , rat anti-CD31 (PharMingen) antibodies, and FITC-labeled Bandeiraea simplicifolia lectin B4 (catalogue no. B-1205; Vector Laboratories) were applied the next day for an hour. Antibody binding was detected with Alexa 488 donkey antirabbit and Alexa 594 goat antirat secondary antibodies (Molecular Probes), observed on a Bio-Rad 1024 confocal microscope, and images were analyzed with Photoshop software (Adobe).

In Situ Hybridization.

Freshly excised tumors and tissues were fixed in 4% paraformaldehyde-PBS overnight, dehydrated, and embedded in paraffin. VEGF and NeuYD probes were generated from PCR-amplified cDNA fragments using primers incorporating the T7 promoter (Table 1). In vitro transcription was performed in the presence of digoxigenin UTP (Roche). In situ hybridization was performed as described previously (27) with minor modifications. Briefly, tissue sections were deparaffinated and rehydrated, washed twice in PBS, and postfixed in 4% paraformaldehyde-PBS for 15 min at room temperature. Sections were subsequently washed in PBS before treatment in 0.2 m HCl for 8 min to block endogenous alkaline phosphatases. Sections were washed again and treated with proteinase K (Dako) for 3 min at room temperature. After washing, sections were incubated twice for 15 min in PBS containing 0.1% diethylpyrocarbonate and equilibrated for 15 min in 5× SSC (0.75 m NaCl , 0.075 m Na-citrate) before prehybridization for 2 h at 65°C in hybridization solution (Dako). After denaturing, probes were added to the hybridization mix (200 ng/μl), and hybridization was carried out at 65°C for 16 h. Sections were then washed (27) and incubated for 2 h at room temperature with alkaline phosphatase-coupled antidigoxigenin antibody (Boehringer Mannheim) diluted 1:500. Color development was performed with nitroblue tetrazolium at room temperature for 24 h. Sections were counterstained in nuclear red before dehydration and mounting.

RNA Analysis.

Total RNA was isolated using Tri-reagent (Molecular Research Center, Inc; Ref. 28). RNase protection was performed with a commercial kit (RPAIII; Ambion) as recommended by the manufacturer with the angiogenesis probe set (mAngio-1; BD PharMingen) or with the SPA probe for the SV40 splice and polyadenylation region of MMTV206 transgenic vector mRNA probe (19)

For quantitative real-time PCR (Q-PCR), cDNA was prepared from 4 μg of whole RNA by reverse transcription using oligo(dT)18 primer and the SuperScript II First-Strand Synthesis System kit (Invitrogen). The PCR primers were designed using Primer 3 software (29) to amplify sequences within 1200 bp of the 3′ end of the mRNA and span introns when possible. The specific primers are shown in Table 1. Q-PCR reactions were performed using a LightCycler instrument and the LightCycler SYBR green DNA master mix (Roche, Mannheim Germany). The 10-μl Q-PCR reactions were performed essentially as recommended by the manufacturer, containing cDNA derived from 10 ng of whole RNA, a final concentration of 4 mm MgCl2, and 0.5 μm of each primer. Amplification was initiated at 95°C for 70 s, followed by 42 amplification cycles of 95°C for 0 s, 56°C for 7 s, and 72°C for 20 s. The cyclophilin A (CPH/peptidylprolyl isomerase A) housekeeping gene was used as constant internal reference for each cDNA preparation as described previously (30). Specificity of the SYBR green Q-PCR signal was monitored by melting curve analysis and by agarose gel electrophoresis analysis, confirming that each Q-PCR product was the anticipated size. Relative gene expression was analyzed using the LightCycler software (version 3.5), which calculated the relative concentration of each specific cDNA to that of CPH cDNA from the same cDNA preparation. This normalized analysis used a standard curve generated for each experiment, relating differences in Q-PCR-crossing thresholds (ΔCT) to the cDNA concentrations of CPH.

RESULTS

Tolerance of VEGF164 Expression During Normal Mammary Gland Development.

To test the importance of increased angiogenesis on the progression of Neu/ErbB2 tumors, transgenic mice were constructed which express VEGF164 in mammary luminal epithelia. A 707 bp form of the VEGF cDNA coding for the 190 residue unprocessed form of VEGF was placed under the control of the MMTV long-terminal repeat promoter (Fig. 1 A). Cleavage of the precursor is expected to generate the 164-residue form of secreted mouse VEGF that retains the proteoglycan-binding domain. Two of the 14 lines were male sterile and discontinued. Eight lines expressed the transgene in female virgin mammary gland. Three lines of mice with higher expression were expanded and examined in greater detail. One of these lines (VEGF-89) required foster care of maternally transmitted progeny. Males of the VEGF-89 line and the two other discarded male sterile lines had testes abnormalities (data not shown) as described by other investigators (31).

The expression of transgene-encoded RNA in different organs of the VEGF-25 line is shown in Fig. 1,B. Expression was high in virgin mammary gland and low but detectable in salivary gland and lung. VEGF mRNA was elevated in the virgin, pregnant, lactating, and involuting mammary tissue of VEGF-25 mice (Fig. 1,C, Lanes 6–10). VEGF protein expression paralleled RNA expression in transgenic mammary tissue (Fig. 1,D). In nontransgenic mammary fat pads, VEGF production by nonepithelial components was confirmed in mammary fat pads cleared of epithelium (Fig. 1,D) and fat pad without lymph node (Fig. 1 D). Elevated levels of VEGF were found in milk. VEGF protein levels in virgin VEGF-25 transgenic mammary tissue were 28-fold higher than control animals and remained 6- to 12-fold higher than controls at different stages of gland development. VEGF levels were normalized to total protein and were not corrected for the large amounts of secretory proteins generated during pregnancy and lactation. VEGF was very high in the milk of VEGF-25 animals but was not elevated in serum or tissue lysates of organs other than mammary gland (data not shown). VEGF levels in the VEGF-89 line were 2.8-fold higher than VEGF-25 values and 80 times the value for nontransgenic animals. These results are consistent with the reliable mammary epithelial tissue specificity of the MMTV vector and show that the VEGF164 transgene is expressed in all major stages of mammary gland biology. Transgenic VEGF164 appears to remain largely localized in mammary tissue and milk.

Normal Mammary Gland Development in VEGF-25 Mice.

Although VEGF164 was overexpressed in the mammary tissues of VEGF-25 mice (and the VEGF-64 line, data not shown), mammary gland development was not distinguishable from control animals during virgin development, pregnancy, lactation, and involution (Fig. 2, A and B; additional data not shown). Furthermore, the interaction between mammary fat pad capillaries and mammary epithelial tubules was not dramatically altered in VEGF-25 female mice (Fig. 2, _C_– F). However, mothers of the VEGF-89, highly expressing line, were generally unable to support litters because of a lactation defect. This line required propagation of pups by foster mothers because males were sterile. Male sterility was associated with testis and epididymidis abnormalities as described previously (31; data not shown). VEGF-89 lactating mothers revealed a dramatic deficiency of differentiated alveoli (Fig. 2, G and H). The deficient growth of VEGF-89 pups was confirmed to be attributable to lactation based upon normal growth of VEGF-89 pups (transgenic and nontransgenic progeny) that had foster mothers and the deficient growth of wild-type (wt) pups that had VEGF-89 mothers (Fig. 1 E). Thus, high expression of VEGF164 can cause female mammary gland and male testis abnormalities. However, more modest levels of the VEGF164 expression are surprisingly well tolerated by both males and females in the VEGF-25 and VEGF-64 lines.

VEGF164 Acceleration of Tumor Appearance and Growth.

To test the effects of mammary epithelial expression of VEGF on mammary tumor development, the VEGF-25 transgene was combined with the NeuYD transgenic mouse mammary tumor model (4). Tumors were detected in NeuYD;VEGF-25 animals after an average of 51 days compared with an average of 111 days for NeuYD mice. (Logrank test, P < 0.001; Fig. 3,A). This extreme acceleration of tumor appearance was also associated with significantly faster growth of the tumors after appearance (Fig. 3, B and C). For purposes of clarity, average data for each time point are shown. However, linear regression analysis of all data points of the two types of tumors indicates that the difference in slopes between the two data sets is significant. (P = 0.001). To investigate the dramatic differences in tumor appearance associated with VEGF164 expression, the early stages of tumor development were examined.

Increased Vascular Association with Hyperplastic Mammary Epithelium.

In NeuYD animals during mammary epithelium invasion of the fat pad, hyperplastic epithelia in some but not all epithelial branches were evident in both NeuYD and NeuYD;VEGF-25 mice (Fig. 4, A and B). VEGF expression did not change these first signs of altered mammary epithelial growth control. However, the appearance of the hyperplastic epithelium was accompanied by preferential association of the vasculature with the hyperplastic epithelium in NeuYD;VEGF-25 animals (Fig. 4, C and F). The hyperplastic epithelium attracts blood vessels in both NeuYD and NeuYD;VEGF-25 animals, but the bigenic animals have much more extensive and closer association (Fig. 4 F).

The preferential association of new vessels with hyperplastic epithelium was confirmed in sectioned material stained for the endothelial marker CD31 (Fig. 5, A and B). Endothelial cells were found interdigitating and surrounding hyperplastic and neoplastic epithelial cells (Fig. 5,B). The increased vascularity of the early lesions persisted in solid tumors and generated a distinctive, highly vascularized morphology. (Fig. 5, C and D). Large diameter vascular cysts were common in NeuYD tumors (Fig. 5,C, black arrows). Additional areas of degeneration (Fig. 5,C, red arrow) were present in NeuYD tumors but were not observed in NeuYD;VEGF-25 tumors. Tumors accelerated by VEGF-25 had characteristic small fingers or nests of tumor cells surrounded by blood vessels. (Fig. 5 D). All of the NeuYD;VEGF-25 tumors appeared to have well defined boundaries defined by endothelial cells.

Mosaic Expression of Transgenic NeuYD and VEGF.

The reason for the mosaic patterns of hyperplastic growth in developing NeuYD mammary epithelial trees was investigated by in situ hybridization. Elevated Neu RNA was detected in hyperplastic cellular masses but generally not in the epithelium with normally organized epithelial structures (Fig. 6, A, arrow and C). The degree of cellular hybridization increased with decreasing epithelial organization and increasing neoplastic morphology, culminating in frank tumors that appeared nearly uniform in the cellular pattern of hybridization (data not shown). The VEGF transgene RNA was also detected in a nonuniform epithelial pattern although single-expressing cells in normal epithelial structures were common (Fig. 6,B, arrows). Endogenous VEGF RNA levels were generally at or below the threshold of detection of this method except in NeuYD tumors. Detection of transgenic Neu and VEGF164 RNAs on sequential portions of the same bigenic mammary tissue revealed that the two transgenes had overlapping patterns of expression. Neither transgene appeared to be uniformly expressed in the early epithelial tubules. Small dysplastic nests of cells were positive for both Neu and VEGF. However, the hybridization pattern for both probes appeared nearly uniform in frank tumors (Fig. 6,E; additional data not shown). Apoptotic areas of NeuYD tumors were identified by labeling of DNA breaks by the terminal deoxynucleotidyltransferase-mediated nick end labeling method (Fig. 6,F). Only a few scattered single apoptotic cells were observed in NeuYD;VEGF-25 tumor sections (data not shown). In situ hybridization revealed increased endogenous VEGF RNA surrounding apoptotic areas presumably caused by hypoxia, whereas transgenic VEGF was uniformly expressed in NeuYD;VEGF-25 tumors (Fig. 6 E).

These results indicate that the expression of the MMTV-driven NeuYD and VEGF transgenes are not uniformly expressed coincidentally with the hormonally driven mammary epithelial tree morphogenesis but rather are expressed in a mosaic pattern within mammary epithelial cells. Both transgenes appear more highly expressed in hyperplastic tissues and neoplasia. Differential NeuYD expression appears to be the cause of the nonuniform hyperplastic epithelial pattern.

Disruption of Tight Junction Organization in Hyperplasia and Neoplasia.

The dramatic differences in vessel organization between control NeuYD mammary tissue and NeuYD;VEGF-25 bigenic mammary epithelia, and the transgenic VEGF expression in milk and the absence of increased VEGF serum levels, suggested that transgenic VEGF164 may not be available to normal fat pad capillaries because of the organization of polarized epithelial junctions and the vectorial secretion of mammary luminal epithelial cells into the lumen. The influence of NeuYD-induced hyperplasia and neoplastic growth on epithelial junctional complexes was examined by immunohistochemical detection of the ZO-1 tight junction protein, E-cadherin, and cytoplasmic mouse keratin 18 (EndoB) to identify epithelial cells. Epithelial ducts of both NeuYD and NeuYD;VEGF-25 mammary tissues had the expected polarized organization of ZO-1 near the apical surface in appropriate cutting planes (Fig. 7,A). The ZO-1 distribution of organized ducts was not distinguishable from control, normal virgin ductal structure (data not shown). In addition, blood vessels stained with ZO-1 antibody were distinguished from epithelium by their lack of mouse keratin 18 reaction (Fig. 7,B). Hyperplastic tissues commonly had disorganized ZO-1 even in close proximity with relatively normal-appearing ductal structures (Fig. 7, A and B). Because the dysplastic growth pattern of the epithelium is associated with NeuYD expression, the disruption of the tight junction organization appears to be an early consequence of NeuYD expression. ZO-1 was persistently expressed in tumors arising from the hyperplastic growths but was not found in an organized pattern (Fig. 7,C). In NeuYD;VEGF-25 tumors, ZO-1 was more organized around single or groups of tumor cells (Fig. 7,D). However, this organization colocalized with the increased density of blood vessels as revealed by the Bandeiraea simplicifolia lectin and CD31 reaction (Fig. 7, H and K). The ZO-1 not associated with blood vessels in NeuYD;VEGF-25 tumors appeared as a punctate pattern similar to NeuYD tumors (Fig. 7 H). These results show that hyperplastic growth of the NeuYD;VEGF-25 epithelium is associated with disruption of the organization of tight junctions.

E-cadherin was found in the expected basolateral pattern of normal ductal structures of both NeuYD and NeuYD;VEGF-25 tissues (Fig. 7, E and F; additional data not shown). E-cadherin continued to be expressed at intercellular surfaces of hyperplastic and neoplastic epithelial cells (Fig. 7, E–G). The E-cadherin pattern was similar in both NeuYD and NeuYD;VEGF-25 tumors (Fig. 7,G; data not shown). T-cadherin, a glycosylphosphatidyl inositol-linked cadherin found previously on mouse tumor blood vessels, was colocalized with CD31 in the normal mammary fat pad (data not shown) and in the vessels of NeuYD and NeuYD;VEGF-25 hyperplastic epithelium and in tumors (Fig. 7, I–L).

Accelerated Tumor Formation Does Not Reflect Increased Neu Signaling.

Because the early appearance of dysplastic mammary lesions in NeuYD mice is correlated with expression of the oncogene, the accelerated growth of NeuYD;VEGF tumors might reflect an indirect effect of increased NeuYD expression or signaling. However, immunoblot analysis of the levels of Neu, ErbB3, Akt, activated Akt, and Grb2 proteins in NeuYD tumors was not distinguishable from NeuYD;VEGF-25 tumors (data not shown). Thus, neither major alterations in expression of NeuYD and ErbB3 nor downstream signaling to Akt account for the more rapid growth of NeuYD;VEGF-25 tumors.

Decreased Hypoxia-Responsive Gene Expression in Well-Vascularized Tumors.

To evaluate whether the increased vascularity of NeuYD;VEGF-25 tumors impacted tumor physiology, the mRNAs for a number of endothelial cell and metabolic cell markers in NeuYD and NeuYD;VEGF-25 tumors were measured by Q-PCR (Fig. 8). The mRNAs for the endothelial cell markers vascular endothelial-cadherin (VE-cad), fetal liver kinase-1 (FIK-1), and CD31 were elevated approximately 5-fold in NeuYD;VEGF-25 tumors. T-cadherin mRNA expression was also increased, consistent with the histology and immunostaining results (Figs. 5 and 7). Expression of several hypoxia-responsive genes was also analyzed. Endogenous VEGF mRNA expression (distinguished from transgenic VEGF164 by its unique 3′ noncoding region) was decreased 4-fold in NeuYD;VEGF-25 tumors. Expressions of glycolytic pathway components glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase-1 were also significantly reduced in these tumors, whereas glucose transporter 1 and hypoxia-inducible factor-1α expression were unchanged (Fig. 8). Increased hypoxia and glycolysis are characteristics of tumors, and reduced expression of several hypoxia-responsive genes in NeuYD;VEGF-25 likely reflects their increased perfusion.

Increased Vascularity Results in Tumor Cell Colonization of the Lung.

Lung tissues of tumor-bearing NeuYD and NeuYD;VEGF-25 mice were examined for evidence of metastasis. No metastatic lesions were found in the lungs of NeuYD animals (Table 2). However, the lungs of NeuYD;VEGF-25 animals contained an average of 9.6 easily recognizable nests of tumor cells bounded by cellular borders and commonly located within vascular spaces (Table 2; Fig. 9, C and D). The tumor cells of some of these emboli were identified by the expression of Neu RNA (Fig. 9, A and B). The tumor cells of these emboli continued to grow to small tumors (Fig. 9,D), but none had clearly invaded surrounding tissues. Additional metastases in liver were not found in several of the VEGF;NeuYD animals, but a systematic examination of additional organs was not performed. The lung emboli were distinctive because some colonies were surrounded by CD31-positive endothelial cells within CD31-positive vascular spaces (Fig. 9, E and F). Increased vascularization caused by transgenic VEGF164 expression in tumor cells results in increased colonization of the lungs despite the decreased elapsed time between detection and sacrifice (13 ± 4.6 days for NeuYD;VEGF-25 and 21 ± 3.5 days for NeuYD). However, many tumor cell colonies were confined within a vascular boundary and failed to invade surrounding lung tissues at the time of animal sacrifice.

DISCUSSION

The expression of VEGF164 led to increased vascularity and dramatically accelerated growth of mammary tumors. These findings confirm the importance of angiogenic signaling in mammary tumor development. However, moderate VEGF164 expression in normal mammary luminal epithelial cells did not dramatically alter normal mammary development or the association of vessels with developing epithelial tubules. This moderation of the effect of transgenic VEGF164 is likely because of the polarized vectorial secretion by luminal epithelial cells. The elevated expression of VEGF in the milk of lactating VEGF164 transgenic mice and the absence of elevated VEGF in serum is supportive of this conclusion. The absence of elevated VEGF in the serum of tumor-bearing NeuYD;VEGF-25 transgenic mice may reflect the local deposition of VEGF164, which retains a heparin-binding domain and is commonly cell associated. VEGF immunostaining of NeuYD;VEGF-25 animals supports this view (data not shown).

The disruption of tight junction organization of luminal epithelial cells by oncogenic Neu correlates well with the increased vascularization of early hyperplasia. This early effect of activating Neu confirms in vivo the disruption of epithelial cell polarity observed in cultured epithelial cells (5) and mammary cell spheroid culture (32). Disruption of epithelial polarity may be a key transforming event (33, 34). Tight junction protein expression and organization has been implicated previously in human breast cancer progression (35, 36) and may be regulated at least in part by protein phosphatase 2A (37), which interacts with Src, which in turn is activated by Neu. However, evidence for this possible pathway in mammary epithelial cells in vivo requires experimental confirmation.

The E-cadherin tumor suppressor protein continued to be expressed at tumor cell surfaces of NeuYD tumors. The persistent expression of E-cadherin may contribute to the compact growth behavior of NeuYD tumor cells. The increased metastasis of NeuYD;VEGF-25 tumor cells occurs despite persistent E-cadherin expression. However, it is not known whether the expression of E-cadherin also reflects continued signaling because E-cadherin signaling is also dependent on cytoplasmic catenin proteins.

In situ hybridization revealed that both the NeuYD oncogene and the VEGF164 transgene are expressed in a mosaic pattern at the hyperplastic stage of tumor development. The differential expression of the NeuYD transgene in some mammary epithelial cells is the likely cause for the differential hyperplastic growth of some branches of the epithelial tree observed in young NeuYD females. However, the cellular expression patterns of the NeuYD and VEGF overlap in hyperplastic regions of the mammary epithelium. These results indicate that although the mammary epithelial specificity of the MMTV promoter is retained, the penetrance of cellular expression may depend on the particular integration site of the transgene. The disruption of the epithelial junctional organization by NeuYD likely permits transgenic VEGF to stimulate neighboring endothelial cells in the fat pad, resulting in close juxtaposition of vessels with the dysplastic epithelium. This greatly accelerates the development of tumors. The relatively uniform expression of both VEGF and NeuYD RNA in tumors may reflect either a selection for cells expressing both transgenes or a preferential activation of the MMTV-driven transgenes. We favor the former because we have found no evidence of stimulation of the MMTV promoter by activated Neu or the polyomavirus middle T antigen oncogenes (data not shown). However, the details of epigenetic restriction of integrated MMTV promoter transgenes remain to be elucidated.

The increased vascularization of NeuYD tumors by transgenic VEGF was confirmed with CD31 and T-cadherin staining as well as RNA analysis. T-cadherin was first implicated in neuronal guidance (38) but was also identified as a differentially expressed gene associated with tumor vasculature (39). More recent data implicate T-cadherin in pathological angiogenesis.6 The up-regulation of T-cadherin in the tumors parallels the vascular endothelial-cadherin, CD31, and fetal liver kinase-1 endothelial marker genes and raises the possibility that T-cadherin may be functionally important in tumor angiogenesis.

The increased tumor vasculature of NeuYD;VEGF-25 tumors has at least three major consequences. First, NeuYD tumor formation is greatly accelerated. NeuYD;VEGF-25 transgenic tumors grow with a distinctive morphology of nests of tumor cells essentially surrounded by endothelial cells. The distinctive morphology of VEGF-accelerated tumors resembles that of mammary tumor cell lines selected for increased metastasis (22). This tumor morphology is derived from an early hyperplastic state in which vessels interdigitate small groups of tumor cells. The tumor expands in association with the vasculature. The increased association of endothelial cells with the tumor cells and the generally increased vascularity likely provide the environment necessary for budding of tumor cell emboli into the vasculature spaces.

The second distinctive characteristic of NeuYD;VEGF-25 tumors is the RNA expression profile, which reflects an increased perfusion of the tumors. Increased vascular endothelial-cadherin, T-cadherin, and CD31 RNAs reflect the increased vessel density. Phosphoglycerate kinase, glyceraldehydes 3-phosphate dehydrogenase, and endogenous VEGF RNAs are known to be regulated at least in part by hypoxia through the hypoxia-inducible factor-1α transcription factor. Induction of endogenous VEGF RNA in control NeuYD tumors was found in close proximity with regions undergoing apoptosis, presumably because of hypoxia and/or nutrient restriction. The relative decreases in phosphoglycerate kinase, glyceraldehydes 3-phosphate dehydrogenase, and endogenous VEGF RNA expression likely reflect increased oxygen and/or nutrient availability in NeuYD;VEGF-25 tumors. However, the glucose transporter 1 mRNA appeared to be expressed similarly in NeuYD and NeuYD;VEGF-25 tumors although glucose transporter 1 RNA is regulated in part by hypoxia-inducible factor-1α (40). This may reflect a combination of increased perfusion and a dominant effect of oncogene transcriptional activation (41, 42). The hypoxic response of phosphoglycerate kinase, glyceraldehydes 3-phosphate dehydrogenase, and endogenous VEGF may be less sensitive to oncogenic stimulation.

Although the increased progression, growth rate, and gene expression pattern of NeuYD;VEGF-25 tumors is consistent with an angiogenic stimulation of these tumors, VEGF164 may have additional effects on nonendothelial cells. For example, high-level VEGF expression from the MMTV promoter results in male sterility associated with VEGFR receptor (VEGFR) 1 expression in certain spermatogenic cells and VEGFR1 and VEGFR2 in Leydig cells of the testis (31). Males of the VEGF-89 line had the same phenotype (data not shown). Furthermore, VEGF165 binds to neuropilin-1 that cooperates with VEGFR2 (43) and can directly effect the survival of some human breast cancer cell lines (44). It is possible that VEGF164 could promote NeuYD tumor growth directly. However, immunohistochemical staining for VEGFR2 was found in endothelial cells not tumor cells (data not shown), and we have not found a stimulatory effect of VEGF on the growth of NeuYD tumor cells in cell culture (data not shown). These observations and the decreased expression of hypoxic-responsive genes support increased vessel density as the primary mechanisms of NeuYD tumor acceleration.

The third consequence of increased vascularization of NeuYD;VEGF-25 tumors is the increase in metastasis of tumor cell emboli to the lung. This process closely resembles the invasion-independent metastasis described previously for highly vascularized and metastatic tumors (22). Under a heavy tumor burden at 30–60 days after tumor detection, NeuYD tumors do not metastasize efficiently to the lung (4). In this study when mice were sacrificed earlier, lung metastases were not detected in NeuYD animals. However, many small emboli of tumor cells were found in VEGF;NeuYD-25 lungs. Mitotic figures and some larger colonies indicate tumor cells continue to grow expansively. However, it remains to be determined whether such tumors will be invasive because their continued expression of VEGF164 would be expected to continue to attract endothelial cells. Although increased vascularity clearly facilitates metastasis in NeuYD animals, forced VEGF expression did not cause pancreatic tumors to metastasize (13). However, the vessel density of pancreatic tumors with supplementary transgenic VEGF was not increased, perhaps because of the retention of epithelial polarity in SV40 T antigen-transformed cells or lower levels of VEGF expression. Without increased vascularity, increased metastasis might not be expected.

Increased vascularization of NeuYD-initiated tumors is sufficient for accelerated colonization of distal organs. This metastatic process appears to differ from the current paradigm of invasion of the vasculature by tumor cells and extravasation at distal sites. The invasion-independent model (22) is consistent with the persistent expression of the E-cadherin adhesive protein in NeuYD;VEGF-25 tumors. Invasion-independent metastasis may represent an important contribution to the well-documented correlation between vascular density and metastasis.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Grant support: Supported by grants from the California Breast Cancer Research Program (BCRP 6JB-0073 to R. G. O.), in part by grants from Department of Defense Breast Cancer Research Program (DAMD-17-00-0175 to R. G. O.), the National Cancer Institute (CA 74597 to R. G. O and C. A. H.), the Canadian Breast Cancer Initiative (to W. J. M.), the National Institute of Child Health and Human Development (HD 25938 to B. R.), and a grant from Cancer Center Support (CA 30199).

Requests for reprints: Robert G. Oshima, The Burnham Institute, 10901 North Torrey Pines Road, La Jolla, California 92037. Phone: (858) 646-3147; Fax: (858) 713-6268; E-mail: rgoshima@burnham.org

M. Garlatti, B. Marturano, M. W. Porter, and B. Ranscht. Expression of T-cadherin in subdomains of the neuroepithelium and initial axon tracts of the embryo, manuscript in preparation.

L. W. Hebbard, M. Garlatti, L. J. T. Young, R. D. Cardiff, R. G. Oshima, and B. Ranscht. T-cadherin supports mouse mammary tumor growth through an angiogenic mechanism, manuscript in preparation.

Fig. 1.

Elevated vascular endothelial growth factor (VEGF) expression in VEGF164 transgenic mice. A, schematic map of mouse mammary tumor virus (MMTV)-VEGF transgene and RNase protection probes and protected fragments. The location of the MMTV long terminal repeat promoter (LTR), VEGF cDNA and SV40-derived processing regions are indicated by the black, white, and hatched portions of the horizontal bar. The gray area indicates the residual 5′ noncoding region of the Ras cDNA (1). The second small white region indicates an SV40 intron. The site of polyadenylation of the SV40 major transcripts is indicated by pA. The mRNAs, RNase protection probes, and protected fragments are indicated below the map with sizes indicated in nucleotides (nt). Double stranded complexes of the 847 nt SPA probe with the two mRNAs (one spliced, one not) are both cleaved by RNase in an A/U rich region (vertical arrow) generating two 5′ fragments. The internal 174 nt VEGF probe is trimmed of vector sequences to 148 nts by RNase. B, RNase protection analysis of transgenic RNAs from different organs of a VEGF-25 virgin female mouse. The three protected probe fragments are indicated at the left. Organ abbreviations are as follows: brn, brain; hrt, heart; liv, liver; lng, lung; spl, spleen; sg, salivary gland; kid, kidney; mg, mammary gland; M, size markers. The signals for the L32 ribosomal protein RNA, analyzed simultaneously, are shown in the bottom portion of the gel. C, RNase protection analysis of VEGF, L32, and glyceraldehydes 3-phosphate dehydrogenase (GAPDH) RNAs. RNAs from mammary tissue dissected from the following: V, virgin; P, 15 days pregnant; L, 16 days lactating; In, 14 days involution; 25 and T1, tumor from NeuYD;VEGF-25 (mouse mammary tumor virus-Neundl-YD5 mouse strain) bigenic animal; wild-type (wt); and T2, NeuYD tumor without transgenic VEGF. Note that the transgenic VEGF mRNA generates the same signal as endogenous VEGF with this probe. Identities of the protected fragments are indicated at the left. D, VEGF protein expression in tissue homogenates of mammary glands and tumors. Open bars indicate wt animals, and filled bars indicate tissues from VEGF-25 animals. Gray bars indicate values for VEGF-89 animals. Abbreviations are as follows: FP, cleared fat pad; FP-LN, fat pad without lymph node; E, pregnant with indicated days; Lac, lactating with indicated days after litter birth; In, involution with the indicated number of days after weaning. VEGF was measured by ELISA assay. E, rescue of VEGF-89 pups by foster mother feeding. Six newborn pups from the VEGF-89 line were fed by a wt ICR strain foster mother (VEGF-89/wt mom, ▴) and six wt ICR strain pups were fed by the VEGF-89 mother (wt/VEGF-89, •). The growth of a typical litter of six FVB/N pups is also shown (w/w, ▪). Individual pups were weighed each day. Each point represents the average and SD.

Fig. 1.

Close modal

Fig. 2.

Mammary epithelia and vascular patterns of VEGF-25 mice and lactation defect of VEGF-89 mice. Whole mount preparations of mammary fat pads of wild-type (wt; A, C, E) and VEGF-25 mice (B, D, F) with additional Tie2-LacZ transgene (A and B). Major vessels are revealed by blue-bacterial β-galactosidase staining (A and B). Epithelium is stained red with carmine. Panels C-F are from animals perfused with ink before sacrifice. Ink containing vessels are black. Note the extensive capillary structure and the close juxtaposition of epithelium and capillaries. The size bars are indicated in microns. G and H represent H&E-stained sections of mammary tissue from wt and VEGF-89 mothers, which had been lactating for 3.5 days. Note the expanded structure of the milk-containing lobules in G and the paucity of expanded lobules in H.

Fig. 2.

Close modal

Fig. 3.

Acceleration of NeuYD tumor appearance and growth by VEGF-25. A, time of detection of tumors in NeuYD female mice (•) with the additional VEGF-25 transgene (+VEGF, ▴) are shown as a function of age. The average and SD of the time of first detection is indicated. Logrank tests of survival plots of the data indicated a statistically significant difference between NeuYD;VEGF-25 and NeuYD (P ≤ 0.001). B and C, tumor growth rates. The mean tumor volume (length × width2 and SD is shown as a function of elapsed time after first detection for the largest tumors of 9 NeuYD and 11 NeuYD;VEGF-25 mice. Trend lines were determined by linear regression analysis of the means. B, NeuYD tumors; C, NeuYD;VEGF-25 tumors. Linear regression analysis of all individual data points indicates that the difference between the slopes is significant (P < 0.0001).

Fig. 3.

Close modal

Fig. 4.

Mosaic development of mammary hyperplasia and preferential vascularization in NeuYD;VEGF-25 animals. A and B, whole mount mammary tissues were stained with carmine to reveal epithelium in red. Arrows point to branches displaying abnormal dysplastic morphology. C, an unfixed, 45-day-old NeuYD;VEGF-25 bigenic female mammary fat pad was photographed before dissection from the skin, revealing a swollen lymph node (white arrow) and increased diffuse vasculature (arrows). D, after dissection, mounting, and staining, the pattern of the diffuse vessels corresponds to the hyperplastic mammary epithelium (black arrows). Ink perfused, carmine stained, whole mounted NeuYD (E) and bigenic NeuYD;VEGF-25 (F) mammary fat pads are shown. Note the close juxtaposition of the vessels with the hyperplastic growths in the bigenic animals (F).

Fig. 4.

Close modal

Fig. 5.

Increased endothelial cell association with VEGF-25 epithelium and tumors. Acetone-fixed, frozen-sectioned mammary tissues from female mice with the indicated genotypes and ages were stained with CD31 antibody (brown color) and hematoxylin. Hyperplastic epithelium of 79 d NeuYD (A) and 45 d NeuYD;VEGF-25 bigenic mammary gland (B) are shown. C, 108 d NeuYD tumor. Black arrow points to large vessels with unstained erythrocytes. Red arrow points to area of degeneration. D, 72 d NeuYD;VEGF-25 mammary tumor. Note extensive vasculature surrounding fingers of tumor cells.

Fig. 5.

Close modal

Fig. 6.

Overlapping vascular endothelial growth factor (VEGF) and Neu RNA expression patterns in hyperplastic and tumor tissue. In situ hybridization (ISH) with Neu (A and C) or VEGF (B, D, E) probes is revealed by blue color. Nuclei were counterstained with neutral red. A and B, ISH was performed on sequential sections of NeuYD;VEGF-25 (mouse mammary tumor virus-Neundl-YD5 mouse strain;mouse mammary tumor virus vascular endothelial growth factor-25 mouse strain) bigenic, hyperplastic tissue. Control sense probes did not develop signals (not shown). C, Neu RNA expression in hyperplastic tissue of NeuYD animals. D, endogenous VEGF signal of section of a NeuYD tumor containing an apoptotic area. Apoptotic cells of an adjacent section of the tumor shown in D were detected by end labeling of DNA breaks (terminal deoxynucleotidyltransferase-mediated nick end labeling; brown color) in F. E, VEGF RNA detected in NeuYD;VEGF-25 tumor cells.

Fig. 6.

Close modal

Fig. 7.

Loss of tight junction organization in NeuYD mammary tumors. Hyperplasia and tumors were immunostained with antibodies against mouse keratin 18 (mK18; green), zonula occludens-1 (ZO-1; red), E-cadherin (red), CD31 (red), T-cadherin (green), and Bandeiraea simplicifolia lectin B4 (BSL-1, green) and analyzed with a confocal microscope. Keratin antibody reacts with the mammary epithelium and tumor cells (A-G, green). ZO-1 staining is organized near the lumen surface of ductal structures but in a punctate pattern within NeuYD and NeuYD;VEGF-25 (mouse mammary tumor virus-Neundl-YD5 mouse strain;mouse mammary tumor virus vascular endothelial growth factor-25 mouse strain) hyperplasia (A and B, red arrows). In NeuYD tumors, ZO-1 staining remains punctated (C, red arrow) and is increased in NeuYD;VEGF-25 tumors (D, red) but in some instances does not colocalize with mK18 (see red arrow). Staining with Bandeiraea simplicifolia confirmed that although there is some punctate staining (H, red arrow), the majority of ZO-1 expression in NeuYD;VEGF-25 tumors are associated with the endothelium (H, yellow arrow). Basolateral distribution of E-cadherin (F, red arrow) is found over all surfaces of hyperplastic cells (E and F, red) and in tumors (G, red). Vascularity increases in NeuYD;VEGF-25 tumors as seen by T-cadherin on the endothelium (I and J, green) and colocalized with CD31 (K, red and L, yellow). Scale bars, 25 μm.

Fig. 7.

Close modal

Fig. 8.

Increased endothelial and decreased hypoxia-responsive gene expression in NeuYD;VEGF-25 tumors. RNA from NeuYD and NeuYD;VEGF-25 mammary tumors was transcribed into cDNA and amplified by real-time PCR with primers specific for the indicated gene products. Signals for each product were normalized to that of cyclophilin A (CPH/peptidylprolyl isomerase A) and then to NeuYD tumor values. The values are the average and SD from three different tumors of each genotype, each measured in at least two separate Q-PCR assays. NeuYD;VEGF tumors are indicated (□) relative to NeuYD tumors (▪).

Fig. 8.

Close modal

Fig. 9.

Lung metastasis in NeuYD;VEGF-25 (mouse mammary tumor virus-Neundl-YD5 mouse strain;mouse mammary tumor virus vascular endothelial growth factor-25 mouse strain) mice. All panels show histological sections of lung from a NeuYD;VEGF-25 tumor-bearing animal. Sections shown in A, C, and D were stained with H&E. B was a section of the same specimen shown in A but subjected to Neu in situ hybridization (ISH). Insets in A and B show increased magnifications of emboli. Arrow in A points to cell-limited boundary. C and D show additional examples of tumor emboli. Note erythrocytes adjacent to the tumor embolus within a vascular space in C and large tumor colony in D. E and F show the appearance of antibody staining of CD31. Both panels represent examples of small tumor cell colonies surrounded by endothelial cells located within a larger vessel. E and F show CD31 immunohistochemical staining in brown.

Fig. 9.

Close modal

Target	Primer sequence
VEGF_a_ cDNA	CGCGAAGCTTAGTCCGAGCCGGAGAGAG
	GGCCGAATTCGTGACATGGTTAATCGGTCTTTC
VEGF ISH	TTTCTGCTCTCTTGGGTG
	TAATACGACTCACTATAGGGCCGCCTTGGCTTGTCACA
Neu ISH	CGCTCACTGCGGGAGCTG
	TAATACGACTCACTATAGGGGATGAATGTCACCGGGCT
MMTV vector	CGTGTTTGAATTTGGACTGACGAC
	ATCACTGAGCTAAATCCCCAACCC
MMTV-VEGF	GAAAGACCGATTAACCATGTCAC
	TCAGCAGTAGCCTCATCATCA
MMTV-NeundlYD5	TTTCCTGCAGCAGCCTAA
	CGGAACCCACATCAGGC
CD31/Pecam	CCAAGGCCAAACAGAAAC
	GATTTATGGGTTTTACTGCATC
Flk1/Kdr	CCGAAGAATTGTGAGAACAG
	GAGCAAACCAACCAATTAAG
VE-Cad/Cdh5	CATCTCAGGGAATGAACCTC
	GCCTCTTTGTGTCTGTATGC

Target	Primer sequence
VEGF_a_ cDNA	CGCGAAGCTTAGTCCGAGCCGGAGAGAG
	GGCCGAATTCGTGACATGGTTAATCGGTCTTTC
VEGF ISH	TTTCTGCTCTCTTGGGTG
	TAATACGACTCACTATAGGGCCGCCTTGGCTTGTCACA
Neu ISH	CGCTCACTGCGGGAGCTG
	TAATACGACTCACTATAGGGGATGAATGTCACCGGGCT
MMTV vector	CGTGTTTGAATTTGGACTGACGAC
	ATCACTGAGCTAAATCCCCAACCC
MMTV-VEGF	GAAAGACCGATTAACCATGTCAC
	TCAGCAGTAGCCTCATCATCA
MMTV-NeundlYD5	TTTCCTGCAGCAGCCTAA
	CGGAACCCACATCAGGC
CD31/Pecam	CCAAGGCCAAACAGAAAC
	GATTTATGGGTTTTACTGCATC
Flk1/Kdr	CCGAAGAATTGTGAGAACAG
	GAGCAAACCAACCAATTAAG
VE-Cad/Cdh5	CATCTCAGGGAATGAACCTC
	GCCTCTTTGTGTCTGTATGC

VEGF, vascular endothelial growth factor; ISH, in situ hybridization; MMTV, mouse mammary tumor virus; Pecam, platelet/endothelial cell adhesion molecule; Flk1, fetal liver kinase 1; Kdr, kinase insert domain-containing receptor; VE-Cad, vascular endothelial-cadherin. Cdh5, H-cadherin.

Genotype	Mouse no.	Age (days)	Mets/section_a_	Method_b_
Neu	84	111	0	H&E
Neu, T_c_	15	123	0	H&E
Neu	83	129	0	H&E
Neu	56	139	0	H&E, ISH
Neu	85	135	0	H&E, CD31
Neu	70	139	0	H&E
Neu, VEGF	43	56	21	H&E
Neu, VEGF	79	65	2	H&E, ISH
Neu, VEGF, T	42	66	12	H&E, ISH, CD31
Neu, VEGF	112	66	12	H&E
Neu, VEGF, T	72	67	4	H&E
Neu, VEGF	14	68	21	H&E
Neu, VEGF	23	72	3	H&E
Neu, VEGF	25	72	4	H&E, CD31
Neu, VEGF, T	91	72	13	H&E, CD31
Neu, VEGF, T	89	74	7	H&E
Neu, VEGF, T	25	89	7	H&E
			9.6 ± 6.8

Genotype	Mouse no.	Age (days)	Mets/section_a_	Method_b_
Neu	84	111	0	H&E
Neu, T_c_	15	123	0	H&E
Neu	83	129	0	H&E
Neu	56	139	0	H&E, ISH
Neu	85	135	0	H&E, CD31
Neu	70	139	0	H&E
Neu, VEGF	43	56	21	H&E
Neu, VEGF	79	65	2	H&E, ISH
Neu, VEGF, T	42	66	12	H&E, ISH, CD31
Neu, VEGF	112	66	12	H&E
Neu, VEGF, T	72	67	4	H&E
Neu, VEGF	14	68	21	H&E
Neu, VEGF	23	72	3	H&E
Neu, VEGF	25	72	4	H&E, CD31
Neu, VEGF, T	91	72	13	H&E, CD31
Neu, VEGF, T	89	74	7	H&E
Neu, VEGF, T	25	89	7	H&E
			9.6 ± 6.8

Tumor cell emboli per lung section. Mets, metastases/section.

Method of detection; H&E, hematoxylin and eosin stain; CD31, immunohistochemical stain; ISH, in situ hybridization.

T, Tie2-LacZ; Neu, MMTV-NeuYD; VEGF, MMTV-VEGF-25.

Acknowledgments

We thank Jacqueline Avis for generating transgenic mice by pronuclear injection and Abraham Gomez for expert care of animals.

References

Muller W. J., Sinn E., Pattengale P. K., Wallace R., Leder P. Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene.

Cell

105

-115,

1988

Siegel P. M., Hardy W. R., Muller W. J. Mammary gland neoplasia: insights from transgenic mouse models..

Bioessays

554

-563,

2000

Dankort D., Jeyabalan N., Jones N., Dumont D. J., Muller W. J. Multiple ErbB2/Neu phosphorylation sites mediate transformation through distinct effector proteins.

J. Biol. Chem.

276

38921

-38928,

2001

Dankort D., Maslikowski B., Warner N., Kanno N., Kim H., Wang Z., Moran M. F., Oshima R. G., Cardiff R. D., Muller W. J. Grb2 and Shc adapter proteins play distinct roles in Neu (ErbB2)- induced mammary tumorigenesis: implications for human breast cancer..

Mol. Cell. Biol.

1540

-1551,

2001

Khoury H., Dankort D. L., Sadekova S., Naujokas M. A., Muller W. J., Park M. Distinct tyrosine autophosphorylation sites mediate induction of epithelial mesenchymal like transition by an activated ErbB2/Neu receptor.

Oncogene

788

-799,

2001

Gale N. W., Yancopoulos G. D. Growth factors acting via endothelial cell-specific receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development..

Genes Dev.

1055

-1066,

1999

Yancopoulos G. D., Davis S., Gale N. W., Rudge J. S., Wiegand S. J., Holash J. Vascular-specific growth factors and blood vessel formation.

Nature (Lond.)

407

242

-248,

2000

Grunstein J., Masbad J. J., Hickey R., Giordano F., Johnson R. S. Isoforms of vascular endothelial growth factor act in a coordinate fashion to recruit and expand tumor vasculature.

Mol. Cell. Biol.

7282

-7291,

2000

Thurston G., Suri C., Smith K., McClain J., Sato T. N., Yancopoulos G. D., McDonald D. M. Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1.

Science (Wash. DC)

286

2511

-2514,

1999

Folkman J., Watson K., Ingber D., Hanahan D. Induction of angiogenesis during the transition from hyperplasia to neoplasia.

Nature (Lond.)

339

-61,

1989

Inoue M., Hager J. H., Ferrara N., Gerber H. P., Hanahan D. VEGF-A has a critical, nonredundant role in angiogenic switching and pancreatic β cell carcinogenesis.

Cancer Cell

193

-202,

2002

Bergers G., Brekken R., McMahon G., Vu T. H., Itoh T., Tamaki K., Tanzawa K., Thorpe P., Itohara S., Werb Z., Hanahan D. Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis.

Nat. Cell Biol.

737

-744,

2000

Gannon G., Mandriota S. J., Cui L., Baetens D., Pepper M. S., Christofori G. Overexpression of vascular endothelial growth factor-A165 enhances tumor angiogenesis but not metastasis during β-cell carcinogenesis.

Cancer Res.

603

-608,

2002

Coussens L. M., Raymond W. W., Berger G., Laig-Webster M., Behrendtsen O., Werb Z., Caughey G. H., Hanahan D. Inflammatory mast cells up-regulate angiogenesis during squamous epithelial carcinogenesis.

Genes Dev.

1382

-1397,

1999

Yen L., You X. L., Al Moustafa A. E., Batist G., Hynes N. E., Mader S., Meloche S., Alaoui-Jamali M. A. Heregulin selectively upregulates vascular endothelial growth factor secretion in cancer cells and stimulates angiogenesis.

Oncogene

3460

-3469,

2000

Rak J., Mitsuhashi Y., Sheehan C., Tamir A., Viloria-Petit A., Filmus J., Mansour S. J., Ahn N. G., Kerbel R. S. Oncogenes and tumor angiogenesis: differential modes of vascular endothelial growth factor up-regulation in ras-transformed epithelial cells and fibroblasts..

Cancer Res.

490

-498,

2000

Laughner E., Taghavi P., Chiles K., Mahon P. C., Semenza G. L. HER2 (neu) signaling increases the rate of hypoxia-inducible factor 1α (HIF-1α) synthesis: novel mechanism for HIF-1-mediated vascular endothelial growth factor expression..

Mol. Cell. Biol.

3995

-4004,

2001

Siegel P. M., Ryan E. D., Cardiff R. D., Muller W. J. Elevated expression of activated forms of Neu/ErbB2 and ErbB-3 are involved in the induction of mammary tumors in transgenic mice: implications for human breast cancer..

EMBO J.

2149

-2164,

1999

Webster M. A., Hutchinson J. N., Rauh M. J., Muthuswamy S. K., Anton M., Tortorice C. G., Cardiff R. D., Graham F. L., Hassell J. A., Muller W. J. Requirement for both Shc and phosphatidylinositol 3′ kinase signaling pathways in polyomavirus middle T-mediated mammary tumorigenesis.

Mol. Cell. Biol.

2344

-2359,

1998

Saaristo A., Karpanen T., Alitalo K. Mechanisms of angiogenesis and their use in the inhibition of tumor growth and metastasis.

Oncogene

6122

-6129,

2000

Liotta L. A., Kohn E. C. The microenvironment of the tumour-host interface.

Nature (Lond.)

411

375

-379,

2001

Sugino T., Kusakabe T., Hoshi N., Yamaguchi T., Kawaguchi T., Goodison S., Sekimata M., Homma Y., Suzuki T. An invasion-independent pathway of blood-borne metastasis: a new murine mammary tumor model..

Am. J. Pathol.

160

1973

-1980,

2002

Sympson C. J., Talhouk R. S., Alexander C. M., Chin J. R., Clift S. M., Bissell M. J., Werb Z. Targeted expression of stromelysin-1 in mammary gland provides evidence for a role of proteinases in branching morphogenesis and the requirement for an intact basement membrane for tissue-specific gene expression.

J. Cell Biol.

125

681

-693,

1994

Wen F., Cecena G., Munoz-Ritchie V., Fuchs E., Chambon P., Oshima R. G. Expression of conditional cre recombinase in epithelial tissues of transgenic mice.

Genesis

100

-106,

2003

Soemarwoto I. N., Bern H. A. The effects of hormones on the vascular pattern of the mouse mammary gland.

Am. J. Anat.

103

403

-435,

1958

Trevor K., Oshima R. G. Preimplantation mouse embryos and liver express the same type I keratin gene product.

J. Biol. Chem.

260

15885

-15891,

1985

Braissant O., Wahli W. Differential expression of peroxisome proliferator-activated receptor-α, -β, and -γ during rat embryonic development.

Endocrinology

139

2748

-2754,

1998

Chomcznski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.

Anal. Biochem.

162

156

-159,

1987

Rozen S., Skaletsky H. Primer3 on the WWW for general users and for biologist programmers Krawetz S. Misener S. eds. .

Bioinformatics Methods and Protocols: Methods in Molecular Biology

365

-386, Humana Press Totowa, New Jersey

2000

Feroze-Merzoug F., Berquin I. M., Dey J., Chen Y. Q. Peptidylprolyl isomerase A (PPIA) as a preferred internal control over GAPDH and β-actin in quantitative RNA analyses.

Biotechniques

776

-778, 780, 782,

2002

Korpelainen E. I., Karkkainen M. J., Tenhunen A., Lakso M., Rauvala H., Vierula M., Parvinen M., Alitalo K. Overexpression of VEGF in testis and epididymis causes infertility in transgenic mice: evidence for nonendothelial targets for VEGF..

J. Cell Biol.

143

1705

-1712,

1998

Muthuswamy S. K., Li D., Lelievre S., Bissell M. J., Brugge J. S. ErbB2, but not ErbB1, reinitiates proliferation and induces luminal repopulation in epithelial acini.

Nat. Cell Biol.

785

-792,

2001

Bissell M. J., Bilder D. Polarity determination in breast tissue: desmosomal adhesion, myoepithelial cells, and laminin 1..

Breast Cancer Res.

117

-119,

2003

Bilder D., Li M., Perrimon N. Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors.

Science (Wash. DC)

289

113

-116,

2000

Hoover K. B., Liao S. Y., Bryant P. J. Loss of the tight junction MAGUK ZO-1 in breast cancer: relationship to glandular differentiation and loss of heterozygosity..

Am. J. Pathol.

153

1767

-1773,

1998

Kominsky S. L., Argani P., Korz D., Evron E., Raman V., Garrett E., Rein A., Sauter G., Kallioniemi O. P., Sukumar S. Loss of the tight junction protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and invasive ductal carcinoma of the breast.

Oncogene

2021

-2033,

2003

Nunbhakdi-Craig V., Machleidt T., Ogris E., Bellotto D., White C. L., III, Sontag E. Protein phosphatase 2A associates with and regulates atypical PKC and the epithelial tight junction complex.

J. Cell Biol.

158

967

-978,

2002

Ranscht B., Dours-Zimmermann M. T. T-cadherin, a novel cadherin cell adhesion molecule in the nervous system lacks the conserved cytoplasmic region.

Neuron

391

-402,

1991

Wyder L., Vitaliti A., Schneider H., Hebbard L. W., Moritz D. R., Wittmer M., Ajmo M., Klemenz R. Increased expression of H/T-cadherin in tumor-penetrating blood vessels.

Cancer Res.

4682

-4688,

2000

Ryan H. E., Lo J., Johnson R. S. HIF-1 α is required for solid tumor formation and embryonic vascularization.

EMBO J.

3005

-3015,

1998

Murakami T., Nishiyama T., Shirotani T., Shinohara Y., Kan M., Ishii K., Kanai F., Nakazuru S., Ebina Y. Identification of two enhancer elements in the gene encoding the type 1 glucose transporter from the mouse which are responsive to serum, growth factor, and oncogenes.

J. Biol. Chem.

267

9300

-9306,

1992

Dang C. V., Semenza G. L. Oncogenic alterations of metabolism.

Trends Biochem. Sci.

-72,

1999

Mamluk R., Gechtman Z., Kutcher M. E., Gasiunas N., Gallagher J., Klagsbrun M. Neuropilin-1 binds vascular endothelial growth factor 165, placenta growth factor-2, and heparin via its b1b2 domain.

J. Biol. Chem.

277

24818

-24825,

2002

Bachelder R. E., Crago A., Chung J., Wendt M. A., Shaw L. M., Robinson G., Mercurio A. M. Vascular endothelial growth factor is an autocrine survival factor for neuropilin-expressing breast carcinoma cells.

Cancer Res.

5736

-5740,

2001

2004

330 Views

38 Web of Science

39 Crossref

Angiogenic Acceleration of Neu Induced Mammary Tumor Progression and Metastasis (original) (raw)

Abstract

INTRODUCTION

MATERIALS AND METHODS

Vector Construction.

Transgenic Mice.

Mammary Tumor Analysis.

Protein Analysis.

Histology.

Immunochemistry.

In Situ Hybridization.

RNA Analysis.

RESULTS

Tolerance of VEGF164 Expression During Normal Mammary Gland Development.

Normal Mammary Gland Development in VEGF-25 Mice.

VEGF164 Acceleration of Tumor Appearance and Growth.

Increased Vascular Association with Hyperplastic Mammary Epithelium.

Mosaic Expression of Transgenic NeuYD and VEGF.

Disruption of Tight Junction Organization in Hyperplasia and Neoplasia.

Accelerated Tumor Formation Does Not Reflect Increased Neu Signaling.

Decreased Hypoxia-Responsive Gene Expression in Well-Vascularized Tumors.

Increased Vascularity Results in Tumor Cell Colonization of the Lung.

DISCUSSION

Acknowledgments

References

Citing articles via

Email alerts