A COL1A1 Sp1 binding site polymorphism predisposes to osteoporotic fracture by affecting bone density and quality (original) (raw)
Meta-analysis of clinical studies. Clinical studies in which the COL1A1 Sp1 polymorphism had been related to BMD or osteoporotic fracture in adults were identified by electronic searches of MEDLINE between October 1996 and October 2000. Sixteen eligible studies were identified (3–17, 19). For quantitative variables, standardized mean differences between genotypes (equivalent to SD units or Z-scores) were calculated from source data using a fixed effects model. Peto odds ratios were similarly calculated for categorical variables by calculating the number of events in each genotype group. When relevant data were unavailable in the source publications, they was obtained from the corresponding author. Funnel plots (20) were used to detect evidence of possible bias resulting from selective publication of positive studies.
Patient samples. Functional studies were performed using samples of bone tissue obtained from patients undergoing routine orthopedic surgical procedures. Studies of allele-specific transcription were performed using RNA extracted from bone samples obtained at transiliac biopsy (n = 6) or from osteoblasts cultured from femoral heads obtained during routine orthopedic surgical procedures (n = 4) in 7 female and 3 male patients of mean ± SD age of 68 ± 11.2 years. Studies of collagen protein production and RNA expression were performed on primary osteoblasts cultured from samples of trabecular bone obtained from the femoral heads of 17 female and 11 male patients undergoing surgery for hip fracture (n = 13) or osteoarthritis (n = 15). The mean ± SD age of these patients was 79 ± 12.2 years. Biomechanical studies were performed on trabecular bone samples from femoral heads obtained from 17 females and 6 males of mean ± SD age 76.3 ± 8.4 years. In 17 cases, bone samples were obtained from femoral heads removed from patients undergoing hip replacement surgery as a result of osteoporotic fracture. In the remaining six cases, samples were obtained at post-mortem from individuals with no known history of bone disease who had died suddenly. None of the patients included in any of these studies had received medication known to affect calcium metabolism such as corticosteroids, bisphosphonates, calcitonin or active metabolites of vitamin D. The study was approved by the local hospital ethical committee, and all patients or their relatives gave informed consent to tissue samples being included.
Electrophoretic mobility shift assays. Sense and antisense oligonucleotides corresponding to the “S” allele (AGGGAATGGGGGCGGGATGAGGGCCT) and the “s” allele (AGGGAATGTGGGCGGGATGAGGGCCT) (sense strand shown, Sp1 binding site underlined, and polymorphic base in boldface type) were synthesized, annealed, and end-labeled with γ32P-ATP (Amersham Pharmacia Biotech UK Ltd., Buckinghamshire, United Kingdom) using T4 Polynucleotide Kinase (Promega Corp., Madison, Wisconsin, USA). The labeled oligonucleotides (0.04 μM) were incubated at 30°C for 30 minutes with human recombinant Sp1 (hrSp1; 10 ng; Promega Corp.); BSA (20 μg; Promega Corp.); and varying concentrations of either “S” or “s” unlabeled competitor oligonucleotides. In some experiments, anti Sp1 antibody (2 μg; Santa Cruz Biotechnology, Santa Cruz, California, USA) was used to confirm specificity of binding. The samples were analyzed on a 4% polyacrylamide gel and visualized by Bio-Rad Personal Molecular Imager, and band intensity was quantitated by Quantity One software (both, Bio-Rad Laboratories Inc., Hercules, California, USA).
Allele-specific transcription. Allele specific transcription was assessed by a semi-nested RT-PCR assay designed to detect relative abundance of unspliced nuclear RNA derived from each allele, based on analysis of an RFLP created by the polymorphic Sp1 site in intron 1 (Figure 3a). Total RNA was extracted from transiliac bone samples or primary human osteoblasts obtained from patients who were heterozygous for the polymorphism using an acid phenol-guanidinium thiocyanate–based method as described previously (21). Complementary DNA (cDNA) was prepared by reverse-transcribing 5 μg total RNA from each patient using SuperScript RNaseH̄ RT (200 U; Life Technologies Ltd., Paisley, United Kingdom) with random hexamer primers according to the manufacturers protocol. The first round of the semi-nested PCR was carried out with the following primer set: 5′- TAACTTCTGGACTATTTGCGGACTTTTTGG –3′ (p1) and 5′– GGGCGAGGGAGGAGAGAA –3′ (p3), which amplifies a 283-bp region surrounding the polymorphic site in the first intron of COL1A1. The thermal cycling protocol was: 95°C for 2 minutes, 58°C for 1 minute, 72°C for 1 minute (one cycle), 95°C for 50 seconds, 58°C for 1 minute, 72°C for 1 minute (13 cycles); 95°C for 50 seconds, 58°C for 1 minute, 72°C for 3 minutes (one cycle). Undiluted products from this reaction were used as template in a second-round PCR using a fluorescently labeled forward primer of the same sequence as in the first round and the following reverse primer: 5′– GTCCAGCCCTCATCCTGGCC – 3′ (p2), which introduces a restriction site for the enzyme _Msc_I in products derived from the “s” allele (3). The second-round PCR used the following thermal cycling protocol: 94°C for 3 minutes, 62°C for 10 seconds, ramping at 1°C per 10 seconds to 72°C, 72°C for 15 seconds (one cycle); 94°C for 50 seconds, 62°C for 10 seconds, ramping 1°C per 10 seconds to 72°C, 72°C for 15 seconds (26 cycles); 94°C for 50 seconds, 62°C for 10 seconds, ramping 1°C per 10 seconds to 72°C, 72°C for 5 minutes (one cycle). Allele-specific transcripts were detected by digesting the products of the second-round PCR with the restriction enzyme _Msc_I and quantitated by electrophoresis using an ABI 377 sequencer and GeneScan software (Applied Biosystems, Warrington, United Kingdom). Results were expressed as the ratio of “s” allele product abundance to “S” allele product abundance. In each assay, a sample of genomic DNA and non–reverse-transcribed RNA from the same patient was amplified along with the sample of cDNA to control for possible allele-specific differences in the efficiency of the PCR and contamination of cDNA with genomic DNA. Extensive experiments were conducted to validate the assay, including spiking experiments in which samples of target DNA corresponding to each allele were mixed in known amounts and product abundance assessed, and varying cycle number in the second round of the PCR to ensure that product abundance lay within the linear phase of PCR amplification under the conditions chosen. These experiments showed that the ratio of allele-specific products accurately reflected the relative abundance of target molecules under the conditions chosen (data not shown).
Effect of the COL1A1 polymorphism on allele-specific transcription in heterozygotes. (a) Position of the primers designed to detect the polymorphic site at position 1240 in the first intron of the human COL1A1 gene (Sequence Accession number M20789). (b) Representative electropherograms from GeneScan analysis of RFLP-PCR assays from one patient. Equivalent amounts of genomic DNA (gDNA; top), cDNA (middle), and non–reverse-transcribed RNA (bottom) were used as PCR template. The increased abundance of “s” allele–derived transcripts is reflected by the greater area under the curve of the “s”-derived PCR products on RFLP-PCR analysis of cDNA. (c) Mean ± SEM ratios of product abundance derived from the “s” and “S” alleles for gDNA. Ratios were measured in duplicate samples of gDNA and cDNA from ten patients.
Collagen protein production. Collagen protein production was assessed using primary cultures of human osteoblasts obtained from patients undergoing joint replacement surgery as described previously (22). The cells were grown to confluence and pulse labeled for 4 hours with 14C-proline (Amersham Pharmacia Biotech UK Ltd.) (2 μCi/ml) in the presence of 50 μg/ml ascorbic acid. After 24 hours, the conditioned medium was removed, protease inhibitors added (100 μM PMSF, 5 mM EGTA, 2 μg/ml leupeptin) and proteins were precipitated by the addition of ammonium sulfate (176 mg/ml) with slow stirring for 16 hours at 4°C. Cell layer proteins were extracted into 0.5 M acetic acid (pH 2.0). Proteins derived from the cell layer and conditioned medium were combined and digested with pepsin 1 mg/ml overnight at 4°C with stirring to degrade noncollagenous proteins and remove nonhelical portions of collagen. The reaction was terminated by neutralization of samples to pH 7.0, and samples were then extensively dialyzed against 0.1 M acetic acid before lyophilization. Collagen samples from each culture were resolved on SDS-PAGE in triplicate using 4% stacking gel and 6% separating gel and α1(I) and α2(I) chains quantified using Packard Instant Phosphorimaging system (Packard Instrument Co., Meriden, Connecticut, USA).
RNase protection assay. Steady-state mRNA levels were assessed by RNase protection assay (RPA) using the RPA III kit (Ambion Inc., Austin, Texas, USA). For these experiments, a 267-bp fragment of human COL1A1 cDNA-spanning exons 1 and 2 (Sequence Accession number Z74615 bases 83–350) and a 495-bp fragment of human COL1A2 cDNA spanning exons 25-32 (Sequence Accession number J03464 bases 2001–2496) were cloned into pGEM T-easy vectors (Promega Corp.). As an internal control, we used a 170-bp fragment of the human β-actin cDNA spanning exon 1 (Sequence Accession number X63432 bases 545–715) cloned into the same vector. Antisense transcripts labeled with [α-32P]UTP were generated from each clone with SP6 RNA polymerase using Riboprobe in vitro transcription system (Promega Corp.). Patient samples (10 μg RNA) were hybridized in a single tube with COL1A1, COL1A2, and β-actin probes. Protected fragments were separated on a 5% denaturing polyacrylamide gel and quantified using by a Packard Instant Phosphorimager. The ratio of COL1A1/COL1A2 transcripts was then calculated after correcting for β-actin expression.
Bone composition and biomechanical studies. Cylindrical cores of bone were removed from the superior, posterior, medial, and central sites in the femoral head using a 9-mm-diameter hollow drill bit as described previously (23). These sites were chosen to represent regions subjected to a range of loading conditions in vivo (24). Articular cartilage and the subchondral bone plate were removed from the bone cores, and both ends were trimmed parallel. The resulting cores of trabecular bone, having a mean height 7.7 ± 1.6 mm, were subjected to an unconstrained compression test using an Instron 5564 materials testing machine (Instron, High Wycombe, United Kingdom). The test was performed at a strain rate of 20% per minute (0.0033%/second). The apparent density of washed and defatted bone samples was calculated by dividing the total mass by the sample volume, calculated from caliper measurements of diameter and length. The stiffness, yield stress, and energy to yield were determined from the characteristics of the stress-strain curve using standard techniques described previously (23). Bone composition was determined by dehydrating the samples at 105°C for 48 hours followed by ashing at 600°C for 24 hours. Water content was defined as the difference between wet and dry masses; mineral content by the final mass after ashing, and organic content by the difference between the dry mass and the ash mass. In our laboratory, the precision of bone composition measurements is less than 0.1% (25).
Statistical analysis. Data from the meta-analysis were analyzed using the RevMan 4.1 software package obtained from the Cochrane Collaboration (The Nordic Cochrane Centre, Rigshospitalet, Copenhagen, Denmark; http://www.cochrane.dk). Odds ratios and standardized mean differences were calculated under fixed effects and random effects models, with essentially similar results; because of this, data are presented for the fixed effects models only. Funnel plots (20) were made to check for evidence of publication bias. Statistical analysis of EMSA data was carried out using GraphPad Prism software (GraphPad Software Inc., San Diego, California, USA), assuming a one-site competitor binding model and nonlinear regression analysis. Statistical analysis of all other data was carried out using Minitab version 12 (Minitab Inc., State College, Pennsylvania, USA). Between-genotype differences in allele-specific transcription, protein levels, mRNA levels, and bone composition were assessed by Student’s t test. Analysis of genotype-specific differences in yield strength was by general linear model (GLM) ANOVA using sampling site and genotype as grouping variables and sample density as a covariate. The influences of age, sex, diagnosis, and genotype on other data resulting from in vitro experiments was assessed by GLM ANOVA by entering sex and diagnosis as grouping variables and age as a covariate.