Autocrine lysophosphatidic acid signaling activates β-catenin and promotes lung allograft fibrosis (original) (raw)
Cell isolation and culture conditions. Bronchoalveolar lavage from lung transplant recipients with and without evidence of BOS was utilized for MC isolation. BOS was identified based on criteria defined by International Society of Heart and Lung Transplantation guidelines and as previously described (3). Non-BOS MCs were obtained from lung transplant recipients who were BOS-free and had no evidence of acute rejection or infection with transbronchial biopsies and microbiological cultures, respectively. MCs were isolated and characterized as previously described (2). Briefly, cells isolated from bronchoalveolar lavage fluid by centrifugation (200 g for 5 minutes) were maintained in adherent culture conditions, and MCs were identified by their growth as fibroblastoid colony-forming units. Cells were passaged by trypsinization and maintained in culture in high-glucose DMEM (11965118, Gibco, Thermo Fisher Scientific) with 10% FBS (F2442, Sigma-Aldrich), 100 U/ml penicillin/streptomycin (15140122, Gibco), and 0.5% Fungizone (15290018, Gibco) at 37°C in humidified incubators with 5% CO2. Cells between passages 3 and 6 were used for experiments. The mesenchymal phenotype and purity of the cells were confirmed by staining for cell surface markers by flow cytometry. MCs demonstrated uniform expression of CD44, CD73, CD105, and CD90 and lacked expression of CD45, CD31, and EPCAM (Supplemental Figure 3). Reagents used for cell treatment included 1-oleoyl LPA (62215, Cayman Chemical) and human recombinant ATX (10803, Cayman Chemical). Before reagent treatments, cells were cultured in serum-free DMEM for 24 hours till they grew to approximately 70% confluence.
Immunoblot analysis. Whole cell lysates or nuclear fractions of MCs were extracted as previously reported (15). Mouse lung allografts with AM095 or placebo control treatment were homogenized with a Tissuemiser (15-338-420, Fisher Scientific) in CelLytic MT Cell Lysis Reagent (C3228, Sigma-Aldrich) supplemented with Protease Inhibitor Cocktail (P8340, Sigma-Aldrich) and Halt Phosphatase Inhibitor Cocktail (78426, Thermo Fisher Scientific). Then allograft homogenate was centrifuged at 4,000 g for 15 minutes and 17,000 g for 10 minutes at 4°C. Supernatants were collected, and protein concentration was determined with a Pierce Coomassie Plus (Bradford) Assay Kit (23236, Thermo Fisher Scientific) and a Thermo Scientific BioMate 3 Spectrophotometer. Western blotting was performed to analyze protein expression levels using primary antibodies against LPA1 (ab23698, Abcam, 1:200), human-specific NFAT1 (MAB6499, R&D Systems, 1:1,000), NFAT1 (MA1-025, Thermo Fisher Scientific, 1:1,000), ATX (10005375, Cayman Chemical, 1:100), β-catenin (ab6302, Abcam, 1:2,000), active β-catenin (05-665, Millipore, 1:1,000), phospho–GSK-3β (ab75814, Abcam, 1:500), collagen I (CL50111AP-1, Cedarlane, 1:500), GAPDH (MAB374, Millipore, 1:5,000), and SAM68 (sc-333, Santa Cruz Biotechnology Inc., 1:1,000). HRP-conjugated anti-mouse and anti-rabbit secondary antibodies were A8924 (Sigma-Aldrich, 1:20,000) and A0545 (Sigma-Aldrich, 1:10,000), respectively.
Gene silencing. For siRNA, MCs were transiently transfected at 60%–70% confluence with 100 nM siRNA targeting β-catenin (42816, Ambion), NFAT1 (M-003606-02-0005, Dharmacon), LPA1 (4050, Ambion), ATX (M-004601-02-0005, Dharmacon), and nontargeting scrambled siRNA (sc-37007, Santa Cruz Biotechnology Inc.) using Oligofectamine (12252-011, Invitrogen) in Opti-MEM I reduced serum medium overnight. Then MCs were cultured in serum-free DMEM for another 48 hours before any additional treatment or 72 hours before harvesting of cells for protein or RNA isolation. To silence ATX and LPA1 by shRNA, respectively, for adoptive transfer, DsRed-labeled MCs were infected with MISSION Lentiviral Transduction Particles (SHCLNV, Sigma-Aldrich) containing either a shRNA targeting ATX or LPA1 or with control silencing vector pLKO.1. The sequences of ATX or LPA1 shRNA constructs within the pLKO.1 vector were 5′-CCGGGCTCCTAATAATGGGACCCATCTCGAGATGGGTCCCATTATTAGGAGCTTTTTG-3′ and 5′-GGTTGCAATCGAGAGGCACATTACTCGAGTAATGTGCCTCTCGATTGCAATTTTTG-3′, respectively.
Immunohistochemical staining of human BO lesions. Immunohistochemistry staining was performed on human lung BO lesions in autopsy samples according to standard clinical laboratory procedures. Primary antibodies for β-catenin (ab6302, Abcam, 1:1,000), ATX (H-008-29, Phoenix Pharmaceuticals, 1:1,000), and α-SMA (ab124964, Abcam, 1:500) were used in this study. Imaging was performed with an Olympus BX41 microscope connected to an Olympus DP20 camera.
ATX ELISA and ATX activity assay. BOS and Non-BOS cell lines were cultured in 60-mm dishes until confluent. Cells were washed once with PBS and then serum starved for 24 hours. Serum-free supernatant was collected, and ATX levels were measured with a Human ENPP-2/Autotaxin Quantikine ELISA Kit (DENP20, R&D Systems) according to the manufacturer’s protocol. Absorbance at 450 nm was measured using a SpectraMax M3 multi-mode microplate reader (Molecular Devices). For ATX activity, cell supernatant was collected, centrifuged at 17,000 g for 10 minutes at 4°C to sediment floating cells or debris, and concentrated to one-eighth of the original volume with an Amicon Ultra-4 Centrifugal Filter Unit with Ultracel-3 membrane (UFC800308, EMD Millipore). After measurement of protein concentration, an equal amount of total protein was subjected to ATX activity assay with the fluorogenic phospholipid ATX substrate FS-3 (L-2000, Echelon) (49, 50). Briefly, 30 μl supernatant and 40 μl FS-3 solution (containing 5 μM FS-3, 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 50 mM Tris-HCl pH 8.0, and 1 mg/ml BSA) were mixed and loaded to a Costar 96-well black-wall, clear-bottom plate. Fluorescence of samples was measured using a SpectraMax M3 multi-mode microplate reader (Molecular Devices) at excitation and emission wavelengths of 485 nm and 528 nm, respectively.
For ATX activity assays in lung lysates, 20 μl allograft lysate and 40 μl FS-3 solution were mixed, and ATX activity was measured similarly for placebo- and PF-8380–treated lung allografts.
RNA isolation and real-time PCR. Total RNA was isolated using the RNeasy Mini Kit (74104, QIAGEN), and cDNA was synthesized with the High Capacity cDNA reverse transcription kit (4368814, Applied Biosystems). Real-time PCR for ATX, Axin2, NFAT1, LPA1, and β-actin was conducted with probes Hs00905125_m1, Hs_00610344_m1, Hs00905451_m1, Hs_00173500_m1, and 4310881E (Applied Biosystems), respectively, and TaqMan Gene Expression Master Mix (4369016, Applied Biosystems). Real-time PCR for COL1A1 transcripts was conducted in SYBR Green PCR Master Mix (4309155, Applied Biosystems) and with the following primers: COL1A1F, GTGCGATGACGTGATCTGTGA and COL1A1R, CGGTGGTTTCTTGGTCGGT. The relative mRNA levels of the target genes were calculated as equal to 2−(Δ_C_t target mRNA – Δ_C_t β-actin).
GFP-NFAT1 subcellular localization by live cell imaging. Plasmid for expressing GFP-NFAT1 fusion protein was provided by Jaime Modiano of the University of Minnesota, Minneapolis, Minnesota, USA (51). Non-BOS MCs were transfected with GFP-NFAT1–expressing plasmid using Lipofectamine LTX reagent (94756, Invitrogen) and Plus reagent (10964-021, Invitrogen) according to the manufacturer’s instructions. Stable clones of cells expressing GFP-NFAT1 were selected in complete DMEM supplemented with 150 μg ml−1 G418 sulfate (10131-035, Gibco) and maintained in 100 μg ml−1 G418-containing medium. GFP-NFAT1 localization and nucleus staining by Hoechst 33342 (62249, Thermo Scientific) in live cells were examined using a Nikon Eclipse TE2000-E microscope equipped with a Cool Snap HQ2 camera operated with the Metamorph program.
Murine orthotopic lung transplantation model and β-galactosidase staining. Orthotopic left lung transplantations were performed using a previously described technique (30). Male mice aged 8–12 weeks and weighing 24–30 g were used as donors or recipients. Isografts were performed in the B6D2F1/J lungs→B6D2F1/J strain combinations, and allogeneic transplants were performed in the B6D2F1/J lungs→DBA/2J strain combinations. A surgical microscope (SZX16-SZX2; Olympus) with ×2.1 to ×34.5 magnifications was used for all procedures. Buprenorphine was given to recipient mice at the conclusion of the procedure and again every 12 hours until 3 days after transplant. Morphometric analysis and hydroxyproline quantification were performed as described previously (30). For β-catenin transcriptional activity assays, Axin2lacZ mice of B6D2F1/J was generated by crossing C57BL/6 Axin2lacZ (B6.129P2-Axin2tm1Wbm/J, stock 009120, The Jackson Laboratory) females with DBA/2J males. For β-galactosidase staining, sections were incubated in staining solution: 1 mg/ml Salmon-gal (6-chloro-3-indolyl-β-d-galactopyranoside) (X668, Lab Scientific) and 0.4 mM NBT (4-nitro blue tetrazolium chloride) (11383213001, Roche) in PBS at 37°C for 3 hours (52).
Oral gavage. Oral gavage was performed in a containment room of the University of Michigan animal facility. PF-8380 (HY-13344, MedChem Express) and AM095 were dissolved in PEG 400 at a concentration of 6 mg/ml. Body weights of animals were measured daily. Treatment with PF-8380 or AM095 was administered by oral gavage twice daily at a dosage of 30 mg/kg body weight starting from day 14 after lung transplantation. Placebo-treated mice were given vehicle (PEG 400) via oral gavage ingestion. On day 40 after lung transplantation, mice were sacrificed, and lung allografts were harvested for Western blotting, hydroxyproline assay, or immunohistochemistry.
Statistics. Statistical significance was analyzed using GraphPad Prism 6 Software. Data are presented as mean values ± SEM unless otherwise noted. Significance was assessed with Student’s t test for comparisons of 2 groups, or with ANOVA and a post hoc Bonferroni test for 3 or more groups. P values less than 0.05 were considered significant.
Study approval. Written informed consent was received from lung transplant recipient participants included in the study. Human lung-resident MCs from bronchoalveolar lavage were isolated under a protocol approved by the Institutional Review Board of the University of Michigan. Mouse experiments were performed according to IACUC-approved protocols at the University of Michigan.