CAMKIIγ suppresses an efferocytosis pathway in macrophages and promotes atherosclerotic plaque necrosis (original) (raw)

Mice. Ldlr–/– mice on the C57BL/6J background (stock 002207) and Lysozyme M-Cre (LysM-Cre) mice also on the C57BL/6J background (stock 004781) were purchased from The Jackson Laboratory. Mertk–/– mice have been described previously (39). Camk2gfl/fl mice were generated as previously described (39). Camk2gfl/fl mice were bred to Ldlr–/– mice to obtain homozygotes for both genes of interest and then subsequently crossed to LysM-Cre+/– mice to obtain Camk2gfl/fl Ldlr–/– LysM-Cre+/– mice and littermate control mice (Camk2gfl/fl Ldlr–/–). Throughout the manuscript, these mice are referred to as M-CaMKII–KO mice, where M refers to myeloid, and control mice, respectively. Mice were backcrossed for more than 10 generations to the C57BL/6J background.

Measurement of lipids, insulin, and glucose and complete blood counts. Fasting blood glucose was measured using a glucometer (One Touch Ultra, Lifescan) in mice that were fasted for 4 hours with free access to water. Standard kits were used to measure plasma insulin (Crystal Chem, catalog 90080), plasma triglycerides (Wako, Triglyceride M Kit), and cholesterol (Wako, Cholesterol E kit) per the manufacturer’s instructions. Complete blood cell count including leukocyte differential was obtained using a FORCYTE Hematology Analyzer (Oxford Science).

Human plaque histology. The specimens used in the PIT versus TCFA coronary plaque study (65% men, age 71.7 ± 12.4 years) were obtained at autopsy. Specimens were formalin fixed, paraffin embedded, and sectioned prior to analysis. Lesions were classified according to Virmani et al. (71). The carotid artery specimens were obtained from patients undergoing carotid endarterectomy for high-grade stenosis of the internal carotid artery at the Division of Vascular Surgery, University Medical Center, Johannes-Gutenberg University. According to preoperative assessment by a consulting neurologist, carotid stenoses were classified as either asymptomatic or symptomatic, defined as TIA or stroke within the past 6 months. After retrieval in the operating room, the excised plaques were rinsed in physiologic saline, immediately snap-frozen in liquid nitrogen, and then transferred to –80°C for storage until processing. Samples were fixed in 4% formalin overnight, decalcified in EDTA for 4 days, and then embedded in paraffin blocks. Serial sections were obtained at 5-μm intervals. Prior to immunofluorescence staining, all sections from both cohorts were deparaffinized in xylene and then rehydrated in a graded series of ethanol concentrations. Sections were then boiled for 20 minutes in an antigen retrieval buffer (10 mM Tris, 0.5 M EDTA, 0.05% Tween-20). After rinsing in PBS and blocking in serum-free protein blocking buffer (DAKO, catalog X0909) for 1 hour, sections were incubated overnight at 4°C with primary antibodies directed toward p-CaMKII (Novus Biologicals, catalog NB300-184, 1:100), CD68 (DAKO, catalog M0814, 1:100), or SMαA (Sigma-Aldrich, catalog C6198, 1:100). After rinsing in PBS, slides were incubated with secondary antibodies for 2 hours at room temperature. Parallel slides were used for staining with isotype controls. Slides were mounted with DAPI-containing mounting solution, and images were obtained using a Leica microscope and analyzed using FIJI/ImageJ software (NIH). Two slides, each with 2 sections, were assessed for each patient. In parallel, adjacent sections from asymptomatic and symptomatic carotid artery specimens were stained with Harris’ H&E. Total lesion and necrotic core areas were defined as previously described (43).

Mouse atherosclerotic lesion analysis. Eight to ten-week-old male control or M-CaMKII–KO mice were placed on a WD (Envigo, TD 88137) for 8, 12, or 16 weeks. Three temporally separate cohorts were structured to include 10 to 14 mice per group with birthdates within 1 to 2 weeks of each other. At the time of harvest, mice were euthanized using isoflurane. Blood was removed by left ventricular puncture, and the vasculature was then perfused with cold PBS. Aortic roots were placed in OCT and immediately frozen or fixed in paraformaldehyde and paraffin embedded. Serial 6-μm (paraffin) or 8-μm (frozen) sections were obtained for analysis. For morphometric analysis, 6 paraffin sections 60 μm apart were stained with Harris’ H&E. Total lesion and necrotic core areas were defined as previously described (43). Collagen staining was performed using picrosirius red (Polysciences, catalog 24901A) per the manufacturer’s instructions. Collagen cap thickness was quantified from 3 distinct regions of the plaque as previously described (43). TUNEL staining was performed using a kit per the manufacturer’s instructions (Roche, catalog 12156792910). For immunofluorescence staining, frozen sections were fixed in cold acetone for 10 minutes. After blocking for 1 hour in serum-free protein blocking buffer (DAKO, catalog X0909), sections were incubated overnight at 4°C with the following primary antibodies: Mac3 (BD Biosciences — Pharmingen, catalog 550292, 1:100), SMαA (Sigma-Aldrich, catalog C6198, 1:100), CD3 (Abcam, catalog ab16669, 1:200), Foxp3 (eBioscience, 14-5773-82, 1:200), vWF (Abcam, catalog ab11713, 1:200), p-CaMKII (Novus Biologicals, catalog NB300-184, 1:100), CaMKIIγ (Novus Biologicals, catalog NBP2-15685, 1:100), or cleaved caspase-3 (Cell Signaling Technologies, catalog 9661, 1:100). Two slides, each with 2 sections, were assessed for each mouse. Parallel slides were used for staining with isotype controls. After rinsing in PBS, slides were incubated with secondary antibodies for 2 hours at room temperature. Slides were counterstained with DAPI, and data were quantified as the percentage of cells positive for markers of interest out of total DAPI+ nuclei. All images were captured using a Zeiss fluorescence microscope and analyzed using ImageJ by an observer blinded to the group assignment of each sample.

In situ zymography for collagenase activity. Frozen sections were warmed to 37°C and incubated with 20 μg/ml solution of DQ collagen IV (Invitrogen, catalog D12052) or DQ collagen I (Invitrogen, catalog D12060) at 37°C overnight. Slides were washed in PBS and then mounted with DAPI-containing solution. Images were captured using a Zeiss fluorescence microscope and analyzed using FIJI/ImageJ by an observer blinded to the group assignment of each sample.

In situ efferocytosis. Experimentation was carried out as previously described by our laboratory (10, 72). In brief, aortic root sections were stained with TUNEL (Roche) followed by Mac-3 (BD Biosciences — Pharmingen) to label lesional macrophages. Apoptotic cells were then determined to be either macrophage associated (colocalizing or juxtaposed with macrophages) or free (not associated with macrophages). Data were plotted as a ratio of associated to free cells to represent efferocytosis efficiency. Images were captured using a Zeiss fluorescence microscope and analyzed using FIJI/ImageJ by an observer blinded to the group assignment of each sample.

LCM. Aortic root lesional material from 5 mice was captured (twelve 5-μm sections per mouse) using a PALM LCM microscope as previously described (72). RNA was isolated using the RNeasy Mini Kit (QIAGEN, catalog 74106) and linearly amplified using the Message Amp II aRNA Kit (Ambion, catalog AM1751). Purity of RNA was estimated by measuring absorbance at 260 and 280 nm using a NanoDrop (ThermoScientific), and RNA with an A260/280 greater than 1.8 was used for cDNA synthesis. cDNA was synthesized using the SuperScript VILO cDNA Synthesis Kit (Invitrogen, catalog 11754050), and RT-qPCR was conducted using a 7500 Real-Time PCR System (Applied Biosystems) and SYBR Green reagents (Applied Biosystems). Specific primer sets used were as follows_:_ Abca1 forward AAAACCGCAGACATCCTTCAG, Abca1 reverse CATACCGAAACTCGTTCACCC; Atf6 forward TGGGTTCGGATATCGCTGTG, Atf6 reverse TGGACTTGGGACTTTGAGCC; Ddit3 (CHOP) forward CTGGAAGCCTGGTATGAGGAT, Ddit3 (CHOP) reverse CAGGGTCAAGAGTAGTGAAGGT; Dnajb9 forward CCCCAGTGTCAAACTGTACCAG, Dnajb9 reverse AGCGTTTCCAATTTTCCATAAATT; Nr1h3 (LXRα) forward ATCGCCTTGCTGAAGACCTCTG, Nr1h3 (LXRα) reverse GATGGGGTTGATGAACTCCACC; Nr1h2 (LXRβ) forward CCCCACAAGTTCTCTGGACACT, Nr1h2 (LXRβ) reverse TGACGTGGCGGAGGTACTG; Mertk forward CAGGGCCTTTACCAGGGAGA, Mertk reverse TGTGTGCTGGATGTGATCTTC; Il1b forward GCAACTGTTCCTGAACTCAACT, Il1b reverse ATCTTTTGGGGTCCGTCAACT; Il6 forward TAGTCCTTCCTACCCCAATTTCC, Il6 reverse TTGGTCCTTAGCCACTCCTTC; Tnfa forward CTTCTGTCTACTGAACTTCGGG, Tnfa reverse CAGGCTTGTCACTCGAATTTTG; and spliced Xbp1 forward AAGAACACGCTTGGGAATGG, spliced Xbp1 reverse CTGCACCTGCTGCGGAC.

Quantitative PCR. RNA was isolated from macrophages using an RNeasy Kit (QIAGEN), and cDNA was synthesized from RNA (ranging from 500 ng to 1 μg per reaction) using a cDNA synthesis kit (Applied Biosystems, catalog 4374966). Real-time PCR was performed using a 7500 Real-Time PCR System and SYBR Green reagents (Applied Biosystems). Mouse primer sets used are listed above. Human primer sets used were as follows: CAMK2G forward AACAAAAACAGTCTCGTAAGCCC, CAMK2G reverse GCCCTTGATCCCATCTGTAGC (recognizes both mouse and human sequences); NR1H3 (LXRα) forward AAGCCCTGCATGCCTACGT, NR1H3 reverse TGCAGACGCAGTGCAAACA; and MERTK forward CTCTGGCGTAGAGCTATCACT, MERTK reverse AGGCTGGGTTGGTGAAAACA. Commercially available human ATF6 primers were used (QIAGEN, catalog PPH20143A-200).

Murine bone marrow–derived macrophage culture. Mice were euthanized with isoflurane, and hind legs were removed. Femurs and tibias were flushed with DMEM containing 4.5 g/l glucose, 20% L-cell media, 10% HI-FBS, and 1% penicillin/streptomycin using a 26-gauge needle. Cell suspensions were passed over a 40-μm filter, centrifuged at 500 g, resuspended in 50 ml of media, and plated into five 100-mm dishes. Cells were incubated for 4 days, after which nonadherent cells and debris were aspirated and medium was replaced with fresh medium. After 7 to 10 days of differentiation, with media changed every 2 to 3 days, cells were harvested for use in various experiments.

Human monocyte–derived macrophage culture. Human leukocytes were isolated from buffy coats of deidentified healthy donors (New York Blood Center, New York, New York, USA). In brief, buffy coat was gently layered onto Histopaque solution (Sigma-Aldrich, catalog 10771) and centrifuged at 1,620 g for 25 minutes at room temperature. Leukocytes were removed from the middle layer, washed with RPMI containing 10% FBS and 1% penicillin/streptomycin, and then centrifuged at 1,620 g for 5 minutes. This wash step was repeated once before resuspending the pellet in RPMI media and plating cells into 12-well plates. After approximately 3 to 4 hours, when more than 50% of the cells were adherent, the medium was changed to RPMI containing 10% FBS, 1% penicillin/streptomycin, and 10 ng/ml GM-CSF (PeproTech, catalog 300-03). Medium was replaced with fresh GM-CSF–containing medium every 2 days. Cells were used for experiments between days 7 and 14, when cells were more than 80% confluent.

Immunoblotting. Whole cell lysates were harvested in 2× Laemmli buffer. Nuclear extracts for the detection of activated/cleaved ATF6 were prepared using a kit per the manufacturer’s instructions (Active Motif, catalog 40010). Cell extracts were electrophoresed on 4%–20% gradient SDS-polyacrylamide gels and transferred to 0.45-μm nitrocellulose membranes. Blots were blocked in Tris-buffered saline with 0.1% Tween-20 containing either 5% BSA or nonfat milk at room temperature for 1 hour. Membranes were then incubated overnight at 4°C with primary antibodies, which included those for ABCA1 (Novus Biologicals, catalog NB400-105, 1:1000), ATF6 (Novus Biologicals, catalog NBP1-40256, 1:500), DACH1 (Proteintech, catalog 10914-1-AP, 1:1000), HDAC4 (Cell Signaling Technologies, catalog 2072, 1:1000), phospho-HDAC4 (Cell Signaling Technologies, catalog 3424S, 1:1000), LXRα (Abcam, catalog ab41902,1:2000), nucleophosmin (Cell Signaling Technologies, catalog 3542, 1:1000), or β-actin (HRP conjugate, Cell Signaling Technologies, catalog 5125, 1:5000).

Transfection of siRNAs. Bone marrow–derived macrophages were plated at 0.5 × 106 cells/well in a 24-well plate and allowed to adhere overnight. Commercially available siRNAs for CaMKIIγ (QIAGEN), ATF6 (QIAGEN), and LXRα (QIAGEN) were used. siRNAs were prepared for transfection using Lipofectamine RNAiMax (Invitrogen, catalog 13778-150) per the manufacturer’s instructions. Cells were harvested or used for further experiments 36 to 72 hours after transfection as noted in figure legends.

LPS stimulation of bone marrow–derived macrophages. Control and CaMKII-KO bone marrow–derived macrophages were plated at 0.2 × 106 cells per well of a 24-well plate and allowed to adhere overnight. The following day, cells were exposed to medium containing 1 ng/ml LPS (Sigma-Aldrich, catalog L4391) or vehicle control. After incubating for 4 hours, cells were harvested for mRNA analysis.

In vitro efferocytosis. Bone marrow–derived macrophages were plated at 1 × 106 cells/well in a 12-well plate and allowed to adhere overnight. In some experiments, cells were preincubated with KN92 (Calbiochem, catalog 422709) or KN93 (Calbiochem, catalog 422708). Jurkat cells were labeled with PKH67-GL (2 μM; Sigma-Aldrich) per the manufacturer’s instructions, resuspended in full medium at a density of 3 × 106 cells/ml, and exposed to UV light (254 nm, UVP) for 5 minutes to induce apoptosis. After UV exposure, cells were incubated in a 37°C incubator with 5% CO2 for 1 hour. We routinely obtained approximately 80% early ACs (annexin V+ PI–) using this procedure. Macrophage medium was replaced with medium containing Jurkat cells to achieve a cell ratio of 3:1 Jurkat cells/macrophages. After incubation for 45 minutes at 37°C, the medium was aspirated and the macrophages were washed twice with cold PBS. Images were obtained using a Nikon fluorescent microscope and analyzed using FIJI/ImageJ to quantify the percentage of macrophages labeled with PKH67-tagged ACs.

Flow cytometry. Cells were suspended in FACS staining buffer (PBS containing 2% FBS) at an approximate density of 1 × 106 cells/100 μl and preincubated with Fc block for 20 minutes on ice. Cells were then labeled with FITC-F4/80 (eBioscience, catalog 11-4801-82) and biotinylated anti-MerTK (R&D Systems, catalog BAF591) or isotype controls for 60 minutes on ice. Cells were washed and then incubated with secondary antibody directed at streptavidin for 45 minutes on ice. Cells were washed in FACS buffer and then resuspended for analysis on a BD FACS Canto II. Data were analyzed using FlowJo software.

Confocal microscopy for MerTK staining. Frozen sections were prepared as above. Sections were fixed in cold acetone for 5 minutes, washed in PBS, and then incubated in biotin-blocking buffer (Thermo Scientific, catalog E21390) for 1 hour. Sections were then incubated with biotinylated anti-MerTK (R&D Systems, catalog BAF591) at 4°C overnight, followed by incubation with Alexa Fluor 488–conjugated streptavidin for 1 hour. Slides were mounted with DAPI-containing solution, viewed on a Nikon A1 confocal microscope, and analyzed using FIJI/ImageJ software.

ChIP. Confluent 10-cm dishes of bone marrow–derived macrophages (1 dish per experimental condition) from each genotype were prepared for use on days 7 to 10 of differentiation. Cells were washed with cold PBS containing protease inhibitors and then incubated with 2 mM disuccinimidyl glutarate in PBS for 30 minutes at room temperature. Paraformaldehyde (PFA) was added to a final concentration of 1% before incubating for an additional 15 minutes at room temperature. Crosslinking was terminated by incubating cells in 200 mM Tris-HCl pH 8 followed by 100 mM Tris-HCl pH 8, each for 15 minutes. Cells were then harvested in 1 ml of cold PBS containing protease inhibitors and pelleted by centrifugation at 2000 g for 5 minutes at 4°C. Pellets were resuspended in 1 ml of nuclei isolation buffer (50 mM Tris-HCl pH 8, 60 mM KCl, 0.5% NP-40, 1× protease inhibitors) and incubated on ice for 10 minutes. Samples were again centrifuged at 2000 g for 5 minutes at 4°C, after which pellets were resuspended in 130 μl lysis buffer (50 mM Tris-HCl pH 8, 0.5% SDS, 10 mM EDTA pH 8, 0.5 mM EGTA pH 8) and transferred to Covaris microtubes (catalog 520045). DNA was sheared to an average size of 400-500 bps using a Covaris S2 focused ultrasonicator set at duty 5%, intensity 4, cycles 200, 15 seconds for 12 total repetitions. After sonication, samples were centrifuged at maximum speed for 10 minutes at 4°C and supernatants were harvested to fresh tubes. Fragmented chromatin (25 μl) was removed for use as input. These samples were treated with elution buffer (0.1 M NaHCO3, 1% SDS, 0.2 M NaCl, and 0.25 μg/ml RNase A) and incubated for 30 minutes at room temperature to digest RNA, followed by incubation at 65°C for 4 hours to reverse protein crosslinks. Samples were then treated with proteinase K in 100 μM EDTA/6.5 mM Tris-HCl pH 8 for 1 hour at 45°C. The resulting products were purified using a QIAquick PCR Purification Kit (QIAGEN, catalog 28106) and quantitated using a NanoDrop spectrophotometer. For each sample, 200 ng was run on an agarose gel to ensure that even and adequate sonication of chromatin was obtained. The remaining 105 μl of the sheared chromatin sample was diluted to 200 μl in lysis buffer and then further diluted to a final volume of 1 ml in dilution buffer (1% Triton X-100, 2 mM EDTA pH 8, 150 mM NaCl, 20 mM Tris-HCl pH 8, 1× protease inhibitors). These samples were then precleared by incubating with 0.25 μg of normal mouse IgG per 1 μg of chromatin for 1 hour with end-over-end rotation at 4°C, followed by the addition of 40 μl of prewashed magnetic beads (Dynabeads, Invitrogen, catalog 10004D) for an additional hour. Using a magnetic rack to pellet the beads, the supernatant from each sample was removed and divided into two 500-μl aliquots. Each aliquot was brought to a final volume of 1 ml with dilution buffer, and then 1 μg of either normal mouse IgG or mouse anti-ATF6 antibody (Novus Biologicals, catalog NBP1-40256) was added to each 5 μg of chromatin. Samples were rotated end-over-end overnight at 4°C, then centrifuged at maximum speed for 10 minutes at 4°C. Supernatants were transferred to fresh tubes, 40 μl of beads was added, and samples were then incubated for 2 hours with rotation at 4°C. After immunoprecipitation, beads were washed once for 5 minutes with wash buffer no. 1 (20 mM Tris-HCl pH 7, 150 mM NaCl, 0,1% SDS, 1% Triton X-100, 2 mM EDTA pH 8), then once with wash buffer no. 2 (10 mM Tris-HCl pH 7, 250 mM LiCl, 1% NP-40, 0.7% sodium deoxycholate, 1 mM EDTA pH 8), and then finally with Tris-EDTA buffer pH 8. After the final wash, samples were treated with elution buffer containing RNase A and then proteinase K, and the samples were purified for PCR as described above. The presence of a Nr1h3 (LXRα) intronic region in the anti-ATF6 precipitated samples was quantified by qPCR and expressed relative to the input genomic DNA (Nr1h3 specific primers: forward ATCTGGGCGGGGATAGAGTT, reverse GGCAGAACCACAAGACTGGA). Primers to a region of the Nr1h3 gene that does not contain the consensus ATF6 site were used to confirm that no nonspecific binding of the ATF6 antibody was obtained (nonspecific Nr1h3 primers: forward GGCTAGGGGGAATGAGATGC, reverse TGCTCCCAATAGAGGACCCA).

Viral transduction. Bone marrow–derived macrophages were plated at 0.2 × 106 cells/well in a 24-well plate and allowed to adhere overnight. High-titer (5 × 106 pfu/ml) adenovirus containing either CA-CaMKII or LacZ was produced by Viraquest Inc. based on previously described vectors (15, 32) that were a gift of Harold Singer (Albany Medical Center). Macrophages were transduced with 200 MOI of LacZ or CA-CaMKII virus and harvested for mRNA or protein 60 hours later.

Statistics. All results are represented as mean + SEM. Normality was determined using D’Agostino-Pearson and/or Shapiro-Wilk normality testing. P values for normally distributed data were calculated using either Student’s t test or 2-way ANOVA with post hoc Tukey’s analysis. P values for nonnormally distributed data were calculated using the Mann-Whitney U test. For the data in Figure 1B as well as Supplemental Figure 1, A and B, correlation coefficients (r) and P values were calculated using Pearson product-moment correlation analysis.

Study approval. For human studies, carotid endarterectomy samples were obtained from coauthor BD. Coronary artery samples were obtained from coauthor JCS. The specimens used in the PIT versus TCFA coronary plaque study were obtained at autopsy, with prior consent and in agreement with the code for proper secondary use of human tissue in the Netherlands (http://www.fmwv.nl). All samples were obtained with consent from patients. Use of all material conformed to the Declaration of Helsinki and was approved by the appropriate university ethics review boards. For animal studies, all mice were cared for according to NIH and IACUC guidelines in a barrier facility at Columbia University Medical Center, and procedures involving mice were performed with the approval of the Columbia University Medical Center IACUC.