Carl Merril - Academia.edu (original) (raw)

Papers by Carl Merril

Research paper thumbnail of Silver-Stain Detection of Proteins Separated by Polyacrylamide Gel Electrophoresis

ACS Symposium Series, 1987

... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS ... more ... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS the stain protocol employed by Dion and Pomenti(46), it is unlikely to be a factor in the Merril and Pratt protocol, since that protocol does not use glutaraldehyde. ...

Research paper thumbnail of Effect of Arterial Oxygen on Mammalian Brain Oxygen Tension

Nature, 1967

EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibro... more EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibroplasia in the cerebral cortex of newborn mice1, and exposure to oxygen at pressure greater than 2.5 atm. can often cause a grand mal type of convulsion in mature mammals2. The nature of such oxygen toxicity is unknown, and studies of the effect of this gas on various tissues have been hampered by the inability to monitor directly the oxygen tension in a tissue with accuracy.

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human myelin basic protein gene (MBP)

Human Molecular Genetics, 1992

Research paper thumbnail of Gel Staining Techniques

Research paper thumbnail of <i>Escherichia coli</i> K1's Capsule Is a Barrier to Bacteriophage T7

Applied and Environmental Microbiology, Aug 1, 2005

Escherichia coli strains that produce the K1 polysaccharide capsule have long been associated wit... more Escherichia coli strains that produce the K1 polysaccharide capsule have long been associated with pathogenesis. This capsule is believed to increase the cell's invasiveness, allowing the bacteria to avoid phagocytosis and inactivation by complement. It is also recognized as a receptor by some phages, such as K1F and K1-5, which have virion-associated enzymes that degrade the polysaccharide. In this report we show that expression of the K1 capsule in E. coli physically blocks infection by T7, a phage that recognizes lipopolysaccharide as the primary receptor. Enzymatic removal of the K1 antigen from the cell allows T7 to adsorb and replicate. This observation suggests that the capsule plays an important role as a defense against some phages that recognize structures beneath it and that the K1-specific phages evolved to counter this physical barrier.

Research paper thumbnail of Template for Taxonomic Proposal to the ICTV Executive Committee To create a new Genus in an existing Family

To remove from the list of tentative species in the genus "T7-like viruses" Enterobacteria phage ... more To remove from the list of tentative species in the genus "T7-like viruses" Enterobacteria phage SP6 Code † To create as type species in the new genus the species named* Code † To designate the following as species of the new genus*: Code † To designate the following as tentative species in the new genus*: † Assigned by ICTV officers * repeat these lines and the corresponding arguments for each genus created in the family Author(s) with email address(es) of the Taxonomic Proposal Old Taxonomic Order Order Family Genus Type Species Species in the Genus Tentative Species in the Genus Unassigned Species in the family New Taxonomic Order Order Family "SP6-like viruses" 2007.115B

Research paper thumbnail of SP6, PHIK1E, PHIK5, and PHIK1-5 are very closely related virulent phages that differ primarily in the tail fiber proteins that allow them to recognize and infect different hosts

Abstracts of the General Meeting of the American Society for Microbiology, Apr 19, 2001

Research paper thumbnail of Silver-Stain Detection of Proteins Separated by Polyacrylamide Gel Electrophoresis

Acs Symposium Series, Mar 18, 1987

... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS ... more ... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS the stain protocol employed by Dion and Pomenti(46), it is unlikely to be a factor in the Merril and Pratt protocol, since that protocol does not use glutaraldehyde. ...

Research paper thumbnail of Polysaccharide-Degrading Phages

This chapter discusses some of the recent developments and ideas and focuses on phages that posse... more This chapter discusses some of the recent developments and ideas and focuses on phages that possess virion-bound capsule depolymerization activities rather than those that simply bind to surface carbohydrate structures. The best-characterized polysaccharide-degrading phages are those that infect various strains of Escherichia coli. Polysaccharide-degrading phages were also isolated from other gram-negative bacteria, and in the case of Klebsiella, a tremendous amount of diversity was found. Probably the most structurally characterized extracellular polysaccharide-degrading phage tail protein is the lysogenic Salmonella P22 tailspike. The crystal structures of both the catalytic domain and the head-binding domain have been solved. P22, Sf6, and related phages are lysogenic, have very little biological or sequence relationship to the SP6 group, and based on their tail protein structures, may be categorized as their own distinct group. We may find that multispecific phages encoding more than one tail protein are fairly widespread. While much of this work can be done by the use of molecular techniques, phage typing is still a rapid and reliable method for identifying capsular antigens. In a recent study, a phage endosialidase (endo E) was used as an antibacterial to treat infections by E. coli 1 strains. Phages have long been known to play a role in bacterial pathogenesis by transducing virulence factors such as toxin genes.

Research paper thumbnail of Alzheimer's disease, Down's syndrome, and aging

PubMed, 1982

Inevitably, reading is one of the requirements to be undergone. To improve the performance and qu... more Inevitably, reading is one of the requirements to be undergone. To improve the performance and quality, someone needs to have something new every day. It will suggest you to have more inspirations, then. However, the needs of inspirations will make you searching for some sources. Even from the other people experience, internet, and many books. Books and internet are the recommended media to help you improving your quality and performance.

Research paper thumbnail of Reconstruction of protein and nucleic acid sequences. I. Systematics and computer program

Biopolymers, Oct 1, 1964

The protein sequences now known have been reconstructed as a kind of intriguing logical‐mathemati... more The protein sequences now known have been reconstructed as a kind of intriguing logical‐mathematical puzzle using information about fragments of the molecules. We wish to show that the reconstruction can be done systematically by repeating a series of elementary operations on these same data governed by a set of well‐defined rules. The completely automatic reconstruction of polymer sequences by a high speed digital computer using these operations and rules is demonstrated.

Research paper thumbnail of The prospect for bacteriophage therapy in Western medicine

Nature Reviews Drug Discovery, Jun 1, 2003

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

Nucleic Acids Research, 1991

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human aromatase cytochrome P-450 gene (CYP19)

Nucleic Acids Research, 1991

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human tyrosine hydroxylase gene (TH)

Nucleic Acids Research, 1991

Source/Description: The polymorphic (TCAT)n repeat begins at base pair 1170 in intron 1 of the hu... more Source/Description: The polymorphic (TCAT)n repeat begins at base pair 1170 in intron 1 of the human tyrosine hydroxylase gene on chromosome I lpl5.5-pl5 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 254 bp. Primer Sequences: CAGCTGCCCTAGTCAGCAC (TCAT strand); GCTTCCGAGTGCAGGTCACA (AGTA strand). Frequency: Estimated from 70 chromosomes of unrelated individuals. Heterozygosity index = 78%. PIC = 0.75. Allele (bp) Frequency KI 260 0.21 K2 256 0.26 K3 252 0.13 K4 248 0.14 KS 244 0.26 Mendelian Inheritance: Co-dominant segregation was observed in two informative families. Chromosomal Localization: The human tyrosine hydroxylase gene has been assigned to chromosome llpl5.5 (3). Other Comments: The PCR reaction was performed on 80 ng of genomic DNA using 100 pmoles of each oligonucleotide primer. The samples were processed as described (4) except that the denaturation cycle at 94°C was extended to 1.4 minutes. The tetranucleotide repeat was based on a (TCAT)9 sequence.

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human beta-actin related pseudogene H-beta-Ac-psi-2 (ACTBP2)

Nucleic Acids Research, 1992

Research paper thumbnail of Reconstruction of Protein and Nucleic Acid Sequences: Alanine Transfer Ribonucleic Acid

Research paper thumbnail of Therapeutic and Prophylactic Applications of Bacteriophage Components in Modern Medicine

Cold Spring Harbor Perspectives in Medicine, 2014

As the interactions of phage with mammalian innate and adaptive immune systems are better delinea... more As the interactions of phage with mammalian innate and adaptive immune systems are better delineated and with our ability to recognize and eliminate toxins and other potentially harmful phage gene products, the potential of phage therapies is now being realized. Early efforts to use phage therapeutically were hampered by inadequate phage purification and limited knowledge of phage-bacterial and phage-human relations. However, although use of phage as an antibacterial therapy in countries that require controlled clinical studies has been hampered by the high costs of patient trials, their use as vaccines and the use of phage components such as lysolytic enzymes or lysozymes has progressed to the point of commercial applications. Recent studies concerning the intimate associations between mammalian hosts and bacterial and phage microbiomes should hasten this progress.

Research paper thumbnail of Effect of Arterial Oxygen on Mammalian Brain Oxygen Tension

Nature, Oct 1, 1967

EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibro... more EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibroplasia in the cerebral cortex of newborn mice1, and exposure to oxygen at pressure greater than 2.5 atm. can often cause a grand mal type of convulsion in mature mammals2. The nature of such oxygen toxicity is unknown, and studies of the effect of this gas on various tissues have been hampered by the inability to monitor directly the oxygen tension in a tissue with accuracy.

Research paper thumbnail of Reconstruction of protein and nucleic acid sequences: IV. The algebra of free monoids and the fragmentation stratagem

Bulletin of Mathematical Biology, Jun 1, 1966

The problem of determining the sequence of a biopolymer from its fragments is stated in mathemati... more The problem of determining the sequence of a biopolymer from its fragments is stated in mathematical terms. Using concrete properties of a free monoid, certain general classes of biopolymers are shown to be insolvable from fragment data produced by complete digestion where enzymes specific for any possible combination of chemical bonds are employed.

Research paper thumbnail of Silver-Stain Detection of Proteins Separated by Polyacrylamide Gel Electrophoresis

ACS Symposium Series, 1987

... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS ... more ... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS the stain protocol employed by Dion and Pomenti(46), it is unlikely to be a factor in the Merril and Pratt protocol, since that protocol does not use glutaraldehyde. ...

Research paper thumbnail of Effect of Arterial Oxygen on Mammalian Brain Oxygen Tension

Nature, 1967

EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibro... more EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibroplasia in the cerebral cortex of newborn mice1, and exposure to oxygen at pressure greater than 2.5 atm. can often cause a grand mal type of convulsion in mature mammals2. The nature of such oxygen toxicity is unknown, and studies of the effect of this gas on various tissues have been hampered by the inability to monitor directly the oxygen tension in a tissue with accuracy.

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human myelin basic protein gene (MBP)

Human Molecular Genetics, 1992

Research paper thumbnail of Gel Staining Techniques

Research paper thumbnail of <i>Escherichia coli</i> K1's Capsule Is a Barrier to Bacteriophage T7

Applied and Environmental Microbiology, Aug 1, 2005

Escherichia coli strains that produce the K1 polysaccharide capsule have long been associated wit... more Escherichia coli strains that produce the K1 polysaccharide capsule have long been associated with pathogenesis. This capsule is believed to increase the cell's invasiveness, allowing the bacteria to avoid phagocytosis and inactivation by complement. It is also recognized as a receptor by some phages, such as K1F and K1-5, which have virion-associated enzymes that degrade the polysaccharide. In this report we show that expression of the K1 capsule in E. coli physically blocks infection by T7, a phage that recognizes lipopolysaccharide as the primary receptor. Enzymatic removal of the K1 antigen from the cell allows T7 to adsorb and replicate. This observation suggests that the capsule plays an important role as a defense against some phages that recognize structures beneath it and that the K1-specific phages evolved to counter this physical barrier.

Research paper thumbnail of Template for Taxonomic Proposal to the ICTV Executive Committee To create a new Genus in an existing Family

To remove from the list of tentative species in the genus "T7-like viruses" Enterobacteria phage ... more To remove from the list of tentative species in the genus "T7-like viruses" Enterobacteria phage SP6 Code † To create as type species in the new genus the species named* Code † To designate the following as species of the new genus*: Code † To designate the following as tentative species in the new genus*: † Assigned by ICTV officers * repeat these lines and the corresponding arguments for each genus created in the family Author(s) with email address(es) of the Taxonomic Proposal Old Taxonomic Order Order Family Genus Type Species Species in the Genus Tentative Species in the Genus Unassigned Species in the family New Taxonomic Order Order Family "SP6-like viruses" 2007.115B

Research paper thumbnail of SP6, PHIK1E, PHIK5, and PHIK1-5 are very closely related virulent phages that differ primarily in the tail fiber proteins that allow them to recognize and infect different hosts

Abstracts of the General Meeting of the American Society for Microbiology, Apr 19, 2001

Research paper thumbnail of Silver-Stain Detection of Proteins Separated by Polyacrylamide Gel Electrophoresis

Acs Symposium Series, Mar 18, 1987

... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS ... more ... While this mechanism may play a role in Page 9. 82 NEW DIRECTIONS IN ELECTROPHORETIC METHODS the stain protocol employed by Dion and Pomenti(46), it is unlikely to be a factor in the Merril and Pratt protocol, since that protocol does not use glutaraldehyde. ...

Research paper thumbnail of Polysaccharide-Degrading Phages

This chapter discusses some of the recent developments and ideas and focuses on phages that posse... more This chapter discusses some of the recent developments and ideas and focuses on phages that possess virion-bound capsule depolymerization activities rather than those that simply bind to surface carbohydrate structures. The best-characterized polysaccharide-degrading phages are those that infect various strains of Escherichia coli. Polysaccharide-degrading phages were also isolated from other gram-negative bacteria, and in the case of Klebsiella, a tremendous amount of diversity was found. Probably the most structurally characterized extracellular polysaccharide-degrading phage tail protein is the lysogenic Salmonella P22 tailspike. The crystal structures of both the catalytic domain and the head-binding domain have been solved. P22, Sf6, and related phages are lysogenic, have very little biological or sequence relationship to the SP6 group, and based on their tail protein structures, may be categorized as their own distinct group. We may find that multispecific phages encoding more than one tail protein are fairly widespread. While much of this work can be done by the use of molecular techniques, phage typing is still a rapid and reliable method for identifying capsular antigens. In a recent study, a phage endosialidase (endo E) was used as an antibacterial to treat infections by E. coli 1 strains. Phages have long been known to play a role in bacterial pathogenesis by transducing virulence factors such as toxin genes.

Research paper thumbnail of Alzheimer's disease, Down's syndrome, and aging

PubMed, 1982

Inevitably, reading is one of the requirements to be undergone. To improve the performance and qu... more Inevitably, reading is one of the requirements to be undergone. To improve the performance and quality, someone needs to have something new every day. It will suggest you to have more inspirations, then. However, the needs of inspirations will make you searching for some sources. Even from the other people experience, internet, and many books. Books and internet are the recommended media to help you improving your quality and performance.

Research paper thumbnail of Reconstruction of protein and nucleic acid sequences. I. Systematics and computer program

Biopolymers, Oct 1, 1964

The protein sequences now known have been reconstructed as a kind of intriguing logical‐mathemati... more The protein sequences now known have been reconstructed as a kind of intriguing logical‐mathematical puzzle using information about fragments of the molecules. We wish to show that the reconstruction can be done systematically by repeating a series of elementary operations on these same data governed by a set of well‐defined rules. The completely automatic reconstruction of polymer sequences by a high speed digital computer using these operations and rules is demonstrated.

Research paper thumbnail of The prospect for bacteriophage therapy in Western medicine

Nature Reviews Drug Discovery, Jun 1, 2003

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

Nucleic Acids Research, 1991

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human aromatase cytochrome P-450 gene (CYP19)

Nucleic Acids Research, 1991

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human tyrosine hydroxylase gene (TH)

Nucleic Acids Research, 1991

Source/Description: The polymorphic (TCAT)n repeat begins at base pair 1170 in intron 1 of the hu... more Source/Description: The polymorphic (TCAT)n repeat begins at base pair 1170 in intron 1 of the human tyrosine hydroxylase gene on chromosome I lpl5.5-pl5 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 254 bp. Primer Sequences: CAGCTGCCCTAGTCAGCAC (TCAT strand); GCTTCCGAGTGCAGGTCACA (AGTA strand). Frequency: Estimated from 70 chromosomes of unrelated individuals. Heterozygosity index = 78%. PIC = 0.75. Allele (bp) Frequency KI 260 0.21 K2 256 0.26 K3 252 0.13 K4 248 0.14 KS 244 0.26 Mendelian Inheritance: Co-dominant segregation was observed in two informative families. Chromosomal Localization: The human tyrosine hydroxylase gene has been assigned to chromosome llpl5.5 (3). Other Comments: The PCR reaction was performed on 80 ng of genomic DNA using 100 pmoles of each oligonucleotide primer. The samples were processed as described (4) except that the denaturation cycle at 94°C was extended to 1.4 minutes. The tetranucleotide repeat was based on a (TCAT)9 sequence.

Research paper thumbnail of Tetranucleotide repeat polymorphism at the human beta-actin related pseudogene H-beta-Ac-psi-2 (ACTBP2)

Nucleic Acids Research, 1992

Research paper thumbnail of Reconstruction of Protein and Nucleic Acid Sequences: Alanine Transfer Ribonucleic Acid

Research paper thumbnail of Therapeutic and Prophylactic Applications of Bacteriophage Components in Modern Medicine

Cold Spring Harbor Perspectives in Medicine, 2014

As the interactions of phage with mammalian innate and adaptive immune systems are better delinea... more As the interactions of phage with mammalian innate and adaptive immune systems are better delineated and with our ability to recognize and eliminate toxins and other potentially harmful phage gene products, the potential of phage therapies is now being realized. Early efforts to use phage therapeutically were hampered by inadequate phage purification and limited knowledge of phage-bacterial and phage-human relations. However, although use of phage as an antibacterial therapy in countries that require controlled clinical studies has been hampered by the high costs of patient trials, their use as vaccines and the use of phage components such as lysolytic enzymes or lysozymes has progressed to the point of commercial applications. Recent studies concerning the intimate associations between mammalian hosts and bacterial and phage microbiomes should hasten this progress.

Research paper thumbnail of Effect of Arterial Oxygen on Mammalian Brain Oxygen Tension

Nature, Oct 1, 1967

EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibro... more EXPOSURE to one atmosphere of oxygen has been found to cause changes similar to retrolental fibroplasia in the cerebral cortex of newborn mice1, and exposure to oxygen at pressure greater than 2.5 atm. can often cause a grand mal type of convulsion in mature mammals2. The nature of such oxygen toxicity is unknown, and studies of the effect of this gas on various tissues have been hampered by the inability to monitor directly the oxygen tension in a tissue with accuracy.

Research paper thumbnail of Reconstruction of protein and nucleic acid sequences: IV. The algebra of free monoids and the fragmentation stratagem

Bulletin of Mathematical Biology, Jun 1, 1966

The problem of determining the sequence of a biopolymer from its fragments is stated in mathemati... more The problem of determining the sequence of a biopolymer from its fragments is stated in mathematical terms. Using concrete properties of a free monoid, certain general classes of biopolymers are shown to be insolvable from fragment data produced by complete digestion where enzymes specific for any possible combination of chemical bonds are employed.