Cheol Kyu Han - Academia.edu (original) (raw)
Papers by Cheol Kyu Han
Journal of Chemical Information and Computer Sciences, Apr 28, 1999
In order to describe the degree of interaction of a molecule with its environments by descriptors... more In order to describe the degree of interaction of a molecule with its environments by descriptors, several three-dimensional descriptors have been proposed. With the physical properties calculated around a molecule, scalar, vector, and tensor (zeroth, first, and second moments) of the physical properties were calculated and were used as descriptors for calculating the similarity index between the molecules. The tensors contain the information on the spatial distribution of those physical properties around the molecule. Hydration Free Energy Density (HFED) proposed by No et al. was used to calculate HFED tensor. The descriptors were used for the similarity index calculations between substituted benzenes and between lead compounds of HIV-1 protease inhibitors. The substituted benzenes are grouped according to the similarity indices. The grouping seems reasonable from the viewpoint of a chemical sense. The lead fragments of the HIV-1 protease inhibitors have a high similarity among themselves though their chemical formulas are not very similar, the lead fragments are diverse. Although the chemical formulas are diverse, the spatial distribution of the physical properties around the molecules is similar. The descriptors have high discriminating power in the similarity calculation between the molecules.
Journal of Chemical Information and Modeling, 1999
In order to describe the degree of interaction of a molecule with its environments by descriptors... more In order to describe the degree of interaction of a molecule with its environments by descriptors, several three-dimensional descriptors have been proposed. With the physical properties calculated around a molecule, scalar, vector, and tensor (zeroth, first, and second moments) of the physical properties were calculated and were used as descriptors for calculating the similarity index between the molecules. The tensors contain the information on the spatial distribution of those physical properties around the molecule. Hydration Free Energy Density (HFED) proposed by No et al. was used to calculate HFED tensor. The descriptors were used for the similarity index calculations between substituted benzenes and between lead compounds of HIV-1 protease inhibitors. The substituted benzenes are grouped according to the similarity indices. The grouping seems reasonable from the viewpoint of a chemical sense. The lead fragments of the HIV-1 protease inhibitors have a high similarity among themselves though their chemical formulas are not very similar, the lead fragments are diverse. Although the chemical formulas are diverse, the spatial distribution of the physical properties around the molecules is similar. The descriptors have high discriminating power in the similarity calculation between the molecules.
Bioorganic & Medicinal Chemistry Letters, 2012
International Journal of Cancer, 2005
Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In ou... more Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In our study reported here, the effects of 4 highly potent methionine aminopeptidase 2 (MetAP2) inhibitors, IDR-803, IDR-804, IDR-805 and CKD-732 (designed by structure-based molecular modeling), on angiogenesis and tumor growth were assessed. Concentrations of these inhibitors as low as 2.5 nM were able to inhibit the growth of human umbilical vein endothelial cells (HUVEC) by as much as 50%, arresting growth in the G1 stage of mitosis. An intracellular accumulation of p21(WAF1/Cip1) protein was also observed. Furthermore, at higher concentrations (25 nM) of these 4 MetAP2 inhibitors, a significant induction of apoptosis was apparent in the same HUVEC cultures. As a result of these findings, the possible anticancer effects of these inhibitors were examined, utilizing the SNU-398 hepatoma cell line. Interestingly, pretreatment with these inhibitors led to an increased number of apoptotic cells of up to 60% or more, compared to untreated controls. Moreover, utilizing an in vivo xenografted murine model, these inhibitors suppressed the growth of engrafted tumor. In conclusion, these 4 inhibitory compounds potently exert an antiangiogenic effect to inhibit the growth of cancers in vivo and could potentially be useful for the treatment of a variety of cancers.
Journal of Medicinal Chemistry, 2006
Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as p... more Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as potent destabilizer for microtubule formation, very little is known about MDL-27048, a competitive inhibitor for colchicine and podophyllotoxin. The structural basis for the interaction of antimitotic agents with tubulin was investigated by molecular modeling, and we propose binding models for MDL-27048 against tubulin. The proposed model was not only consistent with previous competition experiment data between colchicine and MDL-27048, but further suggested an additional binding cavity on tubulin. Based on this finding from the proposed MDL-tubulin complex, we performed molecular design studies to identify new antimitotic agents. These new chalcone derivatives exerted growth inhibitory effects on all four human hepatoma and one renal epithelial cell lines tested and induced strong cell cycle arrest at G2/M phase. Furthermore, these compounds exhibited a strong inhibitory effect on tubulin polymerization in vitro. Therefore, we suggest that the validated MDL-27048 model would serve as a potent platform for designing new molecular entities for anticancer agents targeted to microtubules.
Human Mutation, 2003
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is a n X-linked recessively inherited disea... more Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is a n X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T , 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs , we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.
Bioinformatics, 2008
Pharmaceutical industry has been striving to reduce the costs of drug development and increase pr... more Pharmaceutical industry has been striving to reduce the costs of drug development and increase productivity. Among the many different attempts, drug repositioning (retargeting existing drugs) comes into the spotlight because of its financial efficiency. We introduce IDMap which predicts novel relationships between targets and chemicals and thus is capable of repositioning the marketed drugs by using text mining and chemical structure information. Also capable of mapping commercial chemicals to possible drug targets and vice versa, IDMap creates convenient environments for identifying the potential lead and its targets, especially in the field of drug repositioning.
Bioorganic & Medicinal Chemistry Letters, 2008
In an effort to minimize side effects associated with low selectivity against PDE isozymes, we ha... more In an effort to minimize side effects associated with low selectivity against PDE isozymes, we have successfully identified a series of 6,7,8-substituted quinzaolines as potent inhibitors of PDE5 with high level of isozyme selectivity, especially against PDE6 and PDE11. PDE5 potency and isozyme selectivity of quinazolines were greatly improved with substitutions both at 6- and 8-position. The synthesis, structure-activity relationships and in vivo efficacy of this novel series of potent PDE5 inhibitors are described.
Journal of Chemical Information and Computer Sciences, Apr 28, 1999
In order to describe the degree of interaction of a molecule with its environments by descriptors... more In order to describe the degree of interaction of a molecule with its environments by descriptors, several three-dimensional descriptors have been proposed. With the physical properties calculated around a molecule, scalar, vector, and tensor (zeroth, first, and second moments) of the physical properties were calculated and were used as descriptors for calculating the similarity index between the molecules. The tensors contain the information on the spatial distribution of those physical properties around the molecule. Hydration Free Energy Density (HFED) proposed by No et al. was used to calculate HFED tensor. The descriptors were used for the similarity index calculations between substituted benzenes and between lead compounds of HIV-1 protease inhibitors. The substituted benzenes are grouped according to the similarity indices. The grouping seems reasonable from the viewpoint of a chemical sense. The lead fragments of the HIV-1 protease inhibitors have a high similarity among themselves though their chemical formulas are not very similar, the lead fragments are diverse. Although the chemical formulas are diverse, the spatial distribution of the physical properties around the molecules is similar. The descriptors have high discriminating power in the similarity calculation between the molecules.
Journal of Chemical Information and Modeling, 1999
In order to describe the degree of interaction of a molecule with its environments by descriptors... more In order to describe the degree of interaction of a molecule with its environments by descriptors, several three-dimensional descriptors have been proposed. With the physical properties calculated around a molecule, scalar, vector, and tensor (zeroth, first, and second moments) of the physical properties were calculated and were used as descriptors for calculating the similarity index between the molecules. The tensors contain the information on the spatial distribution of those physical properties around the molecule. Hydration Free Energy Density (HFED) proposed by No et al. was used to calculate HFED tensor. The descriptors were used for the similarity index calculations between substituted benzenes and between lead compounds of HIV-1 protease inhibitors. The substituted benzenes are grouped according to the similarity indices. The grouping seems reasonable from the viewpoint of a chemical sense. The lead fragments of the HIV-1 protease inhibitors have a high similarity among themselves though their chemical formulas are not very similar, the lead fragments are diverse. Although the chemical formulas are diverse, the spatial distribution of the physical properties around the molecules is similar. The descriptors have high discriminating power in the similarity calculation between the molecules.
Bioorganic & Medicinal Chemistry Letters, 2012
International Journal of Cancer, 2005
Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In ou... more Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In our study reported here, the effects of 4 highly potent methionine aminopeptidase 2 (MetAP2) inhibitors, IDR-803, IDR-804, IDR-805 and CKD-732 (designed by structure-based molecular modeling), on angiogenesis and tumor growth were assessed. Concentrations of these inhibitors as low as 2.5 nM were able to inhibit the growth of human umbilical vein endothelial cells (HUVEC) by as much as 50%, arresting growth in the G1 stage of mitosis. An intracellular accumulation of p21(WAF1/Cip1) protein was also observed. Furthermore, at higher concentrations (25 nM) of these 4 MetAP2 inhibitors, a significant induction of apoptosis was apparent in the same HUVEC cultures. As a result of these findings, the possible anticancer effects of these inhibitors were examined, utilizing the SNU-398 hepatoma cell line. Interestingly, pretreatment with these inhibitors led to an increased number of apoptotic cells of up to 60% or more, compared to untreated controls. Moreover, utilizing an in vivo xenografted murine model, these inhibitors suppressed the growth of engrafted tumor. In conclusion, these 4 inhibitory compounds potently exert an antiangiogenic effect to inhibit the growth of cancers in vivo and could potentially be useful for the treatment of a variety of cancers.
Journal of Medicinal Chemistry, 2006
Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as p... more Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as potent destabilizer for microtubule formation, very little is known about MDL-27048, a competitive inhibitor for colchicine and podophyllotoxin. The structural basis for the interaction of antimitotic agents with tubulin was investigated by molecular modeling, and we propose binding models for MDL-27048 against tubulin. The proposed model was not only consistent with previous competition experiment data between colchicine and MDL-27048, but further suggested an additional binding cavity on tubulin. Based on this finding from the proposed MDL-tubulin complex, we performed molecular design studies to identify new antimitotic agents. These new chalcone derivatives exerted growth inhibitory effects on all four human hepatoma and one renal epithelial cell lines tested and induced strong cell cycle arrest at G2/M phase. Furthermore, these compounds exhibited a strong inhibitory effect on tubulin polymerization in vitro. Therefore, we suggest that the validated MDL-27048 model would serve as a potent platform for designing new molecular entities for anticancer agents targeted to microtubules.
Human Mutation, 2003
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is a n X-linked recessively inherited disea... more Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is a n X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T , 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs , we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.
Bioinformatics, 2008
Pharmaceutical industry has been striving to reduce the costs of drug development and increase pr... more Pharmaceutical industry has been striving to reduce the costs of drug development and increase productivity. Among the many different attempts, drug repositioning (retargeting existing drugs) comes into the spotlight because of its financial efficiency. We introduce IDMap which predicts novel relationships between targets and chemicals and thus is capable of repositioning the marketed drugs by using text mining and chemical structure information. Also capable of mapping commercial chemicals to possible drug targets and vice versa, IDMap creates convenient environments for identifying the potential lead and its targets, especially in the field of drug repositioning.
Bioorganic & Medicinal Chemistry Letters, 2008
In an effort to minimize side effects associated with low selectivity against PDE isozymes, we ha... more In an effort to minimize side effects associated with low selectivity against PDE isozymes, we have successfully identified a series of 6,7,8-substituted quinzaolines as potent inhibitors of PDE5 with high level of isozyme selectivity, especially against PDE6 and PDE11. PDE5 potency and isozyme selectivity of quinazolines were greatly improved with substitutions both at 6- and 8-position. The synthesis, structure-activity relationships and in vivo efficacy of this novel series of potent PDE5 inhibitors are described.