Eric Adriaenssens - Academia.edu (original) (raw)

Papers by Eric Adriaenssens

Cancer Research, Jun 15, 2022

Among pediatric brain tumors, Diffuse Intrinsic Pontine Gliomas (DIPGs) display a particularly di... more Among pediatric brain tumors, Diffuse Intrinsic Pontine Gliomas (DIPGs) display a particularly dismal prognosis, highlighted by their median survival lower than one year. Indeed, DIPGs’ location and infiltrative properties preclude their surgical resection. Moreover, DIPGs poorly respond to chemotherapeutic agents. In this context, the only treatment for these tumors remains palliative radiotherapy, systematically followed by tumor progression. In addition to their resistance to therapies, DIPGs are characterized by recurrent histone H3 mutations. The H3.3K27M mutation is the most frequent and results from a heterozygous single nucleotide variant in the H3F3A gene, inducing the lysine 27 substitution by a methionine. Although H3.3K27M’s driver role in DIPGs tumorigenesis is now established, its role in their chemo- and radioresistance remains unclear. Aiming to decipher the potential role of this mutation in pediatric gliomas’ resistance to therapies, we established isogenic cellular models of H3.3K27M induction and reversion.We first induced H3.3K27M mutation in three initially non-mutated supratentorial pediatric glioma cell lines. Thus, we generated models that stably expressed the dominant-negative H3.3K27M or the wild type H3.3 as controls. Complementarily, to study H3.3K27M roles in a DIPG cell context, we also developed H3.3K27M reversion models in two initially mutated DIPG cell lines by applying a gene-editing strategy based on the combinatorial use of the CRISPR/Cas9 technology and an insert.We showed that H3.3K27M induction in Res259 and KNS42 cells conferred a radioresistant phenotype to a fractionated radiotherapy schedule. Besides, we performed a screening of 80 anti-cancer drugs, which revealed a differential impact of the mutation on the drug sensitivity profiles of our three H3.3K27M-induced cell lines. These results indicate that H3.3K27M can control pediatric glioma cells’ resistance to therapies, but in a heterogeneous way depending on the cellular context. Along this line, we are currently characterizing the chemo- and radiotherapy response of our new DIPG H3.3K27M-reversed models. Altogether, our first results support a role for H3.3K27M in pediatric gliomas resistance to treatments, and our complementary models pave the way for identifying new H3.3K27M-dependent mechanisms and promising targets to sensitize DIPGs to therapies. Citation Format: Andria Rakotomalala, Paul Lewandowski, Quentin Bailleul, Clara Savary, Mélanie Arcicasa, Christine Bal, Maud Hamadou, Paul Huchedé, Audrey Restouin, Remy Castellano, Yves Collette, Audrey Vincent, Pierre-Olivier Angrand, Eric Adriaenssens, Xuefen Le Bourhis, Pierre Leblond, Marie Castets, Eddy Pasquier, Alessandro Furlan, Samuel Meignan. Engineering new cellular models to decipher H3.3K27M mutation role in DIPGs' resistance to therapies [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 1671.

Frontiers in Genetics, Apr 29, 2015

Long non-coding RNAs (lncRNAs) are transcripts without protein-coding potential but having a pivo... more Long non-coding RNAs (lncRNAs) are transcripts without protein-coding potential but having a pivotal role in numerous biological functions. Long non-coding RNAs act as regulators at different levels of gene expression including chromatin organization, transcriptional regulation, and post-transcriptional control. Misregulation of lncRNAs expression has been found to be associated to cancer and other human disorders. Here, we review the different types of lncRNAs, their mechanisms of action on genome formatting and expression and emphasized on the multifaceted action of the H19 lncRNA.

HAL (Le Centre pour la Communication Scientifique Directe), 2013

Tumor Biology, Aug 13, 2020

Diffuse Intrinsic Pontine Glioma is one of the worst pediatric brain tumors regarding prognosis d... more Diffuse Intrinsic Pontine Glioma is one of the worst pediatric brain tumors regarding prognosis due notably to intrinsic cell resistance to radio and chemotherapy. One of the main characteristics of DIPG cells is the presence of a mono-allelic mutation on the lysine 27 of histone H3 (H3K27M). This mutation inhibits the trimethylation of this lysine that leads to strong modifications of gene expression. Until now, even though this mutation seems to be a driver event in tumorigenesis, its role in cell resistance to treatment has not been deciphered, due to a lack of relevant cellular models. This way, in order to evaluate the role of the mutation on resistance to treatment, we first induced the mutation in three H3K27-unmutated pediatric glioma cell lines. In parallel, using the CRISPR/Cas9 technology, we are establishing DIPG cellular models in which the mutation will be reversed. By gene trapping approach, we aim to restore an H3F3Awt/wt genotype. After validation, these models would result in original tools to study the impact of H3K27M mutation in DIPG cells resistance to treatment. For the model of induction, the transfected cell lines exhibit the mutation accompanied by a loss of H3K27me3 mark and H3.3 overexpression. For now, we showed an increased cell growth due to the mutation in two cell lines, under normoxia as well as under hypoxia. On contrary there was no impact on resistance to chemotherapy or ionizing radiation. In the third cell line, we didn't observe any impact on cell growth, but an increase of cell radioresistance. Concerning the mutation reversion, our preliminary results show homologous recombination at the right locus in the genome, and some clones present a loss of the mutation confirmed by sequencing. After the removal of resistance cassette by action of a recombinase protein, we will be able to evaluate the biological effects of mutation reversion. To sum up, these different models would allow us to decipher cellular and molecular mechanism induced by the H3.3K27M mutation in DIPG cells including resistance to treatment, and thus, to possibly identify putative therapeutic targets. Citation Format: Quentin Bailleul, Mélanie Arcicasa, Audrey Hochart, Andria Rakotomalala, Marie Castets, Eddy Pasquier, Pierre-Olivier Angrand, Eric Adriaenssens, Xuefen Le Bourhis, Pierre Leblond, Samuel Meignan. Impact of H3.3K27M mutation on diffuse intrinsic pontine glioma's resistance to treatment [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 5005.

International Journal of Molecular Sciences, Dec 16, 2022

This article is an open access article distributed under the terms and conditions of the Creative... more This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY

Oncogene, Sep 3, 2007

of the original article: Tamoxifen (TAM), is widely used as a single agent in adjuvant treatment ... more of the original article: Tamoxifen (TAM), is widely used as a single agent in adjuvant treatment of breast cancer. Here, we investigated the effects of TAM in combination with tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in estrogen receptor-a (ER-a)-positive and-negative breast cancer cells. We showed that cotreatment with TAM and TRAIL synergistically induced apoptosis regardless of ERa status. By contrast, cotreatment did not affect the viability of normal breast epithelial cells. Cotreatment with TAM and TRAIL in breast cancer cells decreased the levels of antiapoptotic proteins including FLIPs and Bcl-2, and enhanced the levels of proapoptotic proteins such as FADD, caspase 8, tBid, Bax and caspase 9. Furthermore, cotreatment-induced apoptosis was efficiently reduced by FADD-or Bid-siRNA, indicating the implication of both extrinsic and intrinsic pathways in synergistic apoptosis induction. Importantly, cotreatment totally arrested tumor growth in an ERa negative MDA-MB-231 tumor xenograft model. The abrogation of tumor growth correlated with enhanced apoptosis in tumor tissues. Our findings raise the possibility to use TAM in combination with TRAIL for breast cancers, regardless of ERa status.

Current Cancer Drug Targets, Sep 1, 2004

We show here that nerve growth factor (NGF), the prototypic neurotrophin, can be targeted in brea... more We show here that nerve growth factor (NGF), the prototypic neurotrophin, can be targeted in breast cancer to inhibit tumor cell proliferation, survival, and metastasis. Analysis of a series of biopsies revealed widespread expression of NGF in the majority of human breast tumors, with anti-NGF immunoreactivity concentrated in the epithelial cancer cells. Moreover, immunodeficient mice xenografted with human breast cancer cells and treated with either anti-NGF antibodies or small interfering RNA against NGF displayed inhibited tumor growth and metastasis. Such treatments directed against NGF induced a decrease in cell proliferation with a concomitant increase in apoptosis of breast cancer cells and an inhibition of tumor angiogenesis. Together, these data indicate that targeting NGF in breast cancer may have therapeutic ramifications. [Cancer Res 2008;68(2):346–51]

Experimental Cell Research, May 1, 2002

The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as ... more The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as an RNA molecule. We previously reported that in breast adenocarcinoma, H19 is often overexpressed in stromal cells and preferentially located at the epithelium/stroma boundary, suggesting that epithelial/mesenchymal interactions can control H19 RNA expression. In some cases of breast adenocarcinoma with poor prognosis, H19 is overexpressed in epithelial cells. Therefore we examined whether mesenchymal factors can induce H19 expression in epithelial cells. Using quantitative RT-PCR and in situ hybridization, we found that when mammary epithelial cells were cultured in collagen gels, H19 expression was strongly up-regulated compared to when cells were cultured on plastic. Collagen gels allow threedimensional growth of epithelial cells and morphogenetic responses to soluble factors. A conditioned medium from MRC-5 fibroblasts caused branching morphogenesis of HBL-100 cells and invasive growth of MDA-MB-231 cells, whereas MCF-7 cells were unresponsive. Induction of H19 expression correlated with morphological changes in HBL-100 and in MDA-MB-231 cells, whereas H19 expression was not induced in MCF-7 cells. Using a blocking antibody, HGF/SF was identified as the fibroblast-derived growth factor capable of inducing H19 expression and cell morphogenesis. We further demonstrated that H19 promoter activity was stimulated by various growth factors using transient transfection in MDCK epithelial cells. HGF/SF was more efficient than EGF or FGF-2 in transactivating the H19 promoter, whereas IGF-2, TGF␤-1, and TNF-␣ were ineffective. This activation by HGF/SF was prevented by pharmacological inhibition of MAP kinase or of phospholipase C. We conclude that H19 is a target gene for HGF/SF, a known regulator of epithelial/mesenchymal interactions, and suggest that the up-regulation of H19 may be implicated in morphogenesis and/or migration of epithelial cells.

HAL (Le Centre pour la Communication Scientifique Directe), 2012

Cancer Letters, May 1, 2019

This work was supported by grants from the "Ligue Nationale Contre le Cancer", "Fondation ARC pou... more This work was supported by grants from the "Ligue Nationale Contre le Cancer", "Fondation ARC pour la recherche sur le cancer", "Groupement des Entreprises Françaises dans la Lutte contre le Cancer (GEFLUC)" and the SIRIC Oncolille.

Purpose: Given that nerve growth factor has previously been shown to be involved in breast cancer... more Purpose: Given that nerve growth factor has previously been shown to be involved in breast cancer progression, we have tested here the hypothesis that the other neurotrophins (NT) are expressed and have an influence in breast tumor growth.Experimental Design: The expression of brain-derived neurotrophic factor (BDNF), NT-3 and NT-4/5, as well as the neurotrophin receptor p75NTR, TrkB, and TrkC, was studied by RT-PCR, Western blotting, and immunohistochemistry in cell lines and tumor biopsies. The biological impacts of neurotrophins, and associated mechanisms, were analyzed in cell cultures and xenografted mice.Results: BDNF and NT-4/5 were expressed and secreted by breast cancer cells, and the use of blocking antibodies suggested an autocrine loop mediating cell resistance to apoptosis. The corresponding tyrosine kinase receptor TrkB was only rarely observed at full length, whereas the expression of TrkB-T1, lacking the kinase domain, as well as p75NTR, were detected in all tested breast cancer cell lines and tumor biopsies. In contrast, NT-3 and TrkC were not detected. SiRNA against p75NTR and TrkB-T1 abolished the antiapoptotic effect of BDNF and NT-4/5, whereas the pharmacological inhibitors K252a and PD98059 had no effect, suggesting the involvement of p75NTR and TrkB-T1, but not kinase activities from Trks and MAPK. In xenografted mice, anti-BDNF, anti-NT-4/5, anti-p75NTR, or anti-TrkB-T1 treatments resulted in tumor growth inhibition, characterized by an increase in cell apoptosis, but with no change in proliferation.Conclusion: BDNF and NT-4/5 contribute to breast cancer cell survival and can serve as prospective targets in attempts to inhibit tumor growth. Clin Cancer Res; 17(7); 1741–52. ©2011 AACR.

Supplemental Fig. 1. The 149 bp band obtained in RT-PCR detection (Fig. 1A) was sequenced to veri... more Supplemental Fig. 1. The 149 bp band obtained in RT-PCR detection (Fig. 1A) was sequenced to verify the correspondance to NGF. NGF PCR product has been cloned into pCR 2.1 Topo plasmid, amplified with specific plasmid primers (M13) and sequenced using an ABI PRISM (abgene). The following sequence, demonstrating the correspondance to NGF, was obtained (508) 5'caacaggactcacaggagcaagcggtcatcatcccatcccatcttccacaggggcgaattctcggtgtgtgacagtgtcagcgtgtgggttg gggataagacc accgccacagacatcaagggcaaggaggtgatggtgttgggagaggt3' (657) and the raw data obtained for the sens and anti-sens are displayed below.

HAL (Le Centre pour la Communication Scientifique Directe), 2013

Supplementary Figure 2 from Nerve Growth Factor Is a Potential Therapeutic Target in Breast Cancer

Bioinformatics

Motivation Nowadays, epigenetic gene regulations are studied in each part of the biology, from em... more Motivation Nowadays, epigenetic gene regulations are studied in each part of the biology, from embryonic development to diseases such as cancers and neurodegenerative disorders. Currently, to quantify and compare CpG methylation levels of a specific region of interest, the most accessible technique is the bisulfite sequencing PCR (BSP). However, no existing user-friendly tool is able to analyze data from all approaches of BSP. Therefore, the most convenient way to process results from the direct sequencing of PCR products (direct-BSP) is to manually analyze the chromatogram traces, which is a repetitive and prone to error task. Results Here, we implement a new R-based tool, called ABSP for analysis of bisulfite sequencing PCR, providing a complete analytic process of both direct-BSP and cloning-BSP data. It uses the raw sequencing trace files (.ab1) as input to compute and compare CpG methylation percentages. It is fully automated and includes a user-friendly interface as a built-in...

Cancer Research, Jun 15, 2022

Among pediatric brain tumors, Diffuse Intrinsic Pontine Gliomas (DIPGs) display a particularly di... more Among pediatric brain tumors, Diffuse Intrinsic Pontine Gliomas (DIPGs) display a particularly dismal prognosis, highlighted by their median survival lower than one year. Indeed, DIPGs’ location and infiltrative properties preclude their surgical resection. Moreover, DIPGs poorly respond to chemotherapeutic agents. In this context, the only treatment for these tumors remains palliative radiotherapy, systematically followed by tumor progression. In addition to their resistance to therapies, DIPGs are characterized by recurrent histone H3 mutations. The H3.3K27M mutation is the most frequent and results from a heterozygous single nucleotide variant in the H3F3A gene, inducing the lysine 27 substitution by a methionine. Although H3.3K27M’s driver role in DIPGs tumorigenesis is now established, its role in their chemo- and radioresistance remains unclear. Aiming to decipher the potential role of this mutation in pediatric gliomas’ resistance to therapies, we established isogenic cellular models of H3.3K27M induction and reversion.We first induced H3.3K27M mutation in three initially non-mutated supratentorial pediatric glioma cell lines. Thus, we generated models that stably expressed the dominant-negative H3.3K27M or the wild type H3.3 as controls. Complementarily, to study H3.3K27M roles in a DIPG cell context, we also developed H3.3K27M reversion models in two initially mutated DIPG cell lines by applying a gene-editing strategy based on the combinatorial use of the CRISPR/Cas9 technology and an insert.We showed that H3.3K27M induction in Res259 and KNS42 cells conferred a radioresistant phenotype to a fractionated radiotherapy schedule. Besides, we performed a screening of 80 anti-cancer drugs, which revealed a differential impact of the mutation on the drug sensitivity profiles of our three H3.3K27M-induced cell lines. These results indicate that H3.3K27M can control pediatric glioma cells’ resistance to therapies, but in a heterogeneous way depending on the cellular context. Along this line, we are currently characterizing the chemo- and radiotherapy response of our new DIPG H3.3K27M-reversed models. Altogether, our first results support a role for H3.3K27M in pediatric gliomas resistance to treatments, and our complementary models pave the way for identifying new H3.3K27M-dependent mechanisms and promising targets to sensitize DIPGs to therapies. Citation Format: Andria Rakotomalala, Paul Lewandowski, Quentin Bailleul, Clara Savary, Mélanie Arcicasa, Christine Bal, Maud Hamadou, Paul Huchedé, Audrey Restouin, Remy Castellano, Yves Collette, Audrey Vincent, Pierre-Olivier Angrand, Eric Adriaenssens, Xuefen Le Bourhis, Pierre Leblond, Marie Castets, Eddy Pasquier, Alessandro Furlan, Samuel Meignan. Engineering new cellular models to decipher H3.3K27M mutation role in DIPGs' resistance to therapies [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 1671.

Frontiers in Genetics, Apr 29, 2015

Long non-coding RNAs (lncRNAs) are transcripts without protein-coding potential but having a pivo... more Long non-coding RNAs (lncRNAs) are transcripts without protein-coding potential but having a pivotal role in numerous biological functions. Long non-coding RNAs act as regulators at different levels of gene expression including chromatin organization, transcriptional regulation, and post-transcriptional control. Misregulation of lncRNAs expression has been found to be associated to cancer and other human disorders. Here, we review the different types of lncRNAs, their mechanisms of action on genome formatting and expression and emphasized on the multifaceted action of the H19 lncRNA.

HAL (Le Centre pour la Communication Scientifique Directe), 2013

Tumor Biology, Aug 13, 2020

Diffuse Intrinsic Pontine Glioma is one of the worst pediatric brain tumors regarding prognosis d... more Diffuse Intrinsic Pontine Glioma is one of the worst pediatric brain tumors regarding prognosis due notably to intrinsic cell resistance to radio and chemotherapy. One of the main characteristics of DIPG cells is the presence of a mono-allelic mutation on the lysine 27 of histone H3 (H3K27M). This mutation inhibits the trimethylation of this lysine that leads to strong modifications of gene expression. Until now, even though this mutation seems to be a driver event in tumorigenesis, its role in cell resistance to treatment has not been deciphered, due to a lack of relevant cellular models. This way, in order to evaluate the role of the mutation on resistance to treatment, we first induced the mutation in three H3K27-unmutated pediatric glioma cell lines. In parallel, using the CRISPR/Cas9 technology, we are establishing DIPG cellular models in which the mutation will be reversed. By gene trapping approach, we aim to restore an H3F3Awt/wt genotype. After validation, these models would result in original tools to study the impact of H3K27M mutation in DIPG cells resistance to treatment. For the model of induction, the transfected cell lines exhibit the mutation accompanied by a loss of H3K27me3 mark and H3.3 overexpression. For now, we showed an increased cell growth due to the mutation in two cell lines, under normoxia as well as under hypoxia. On contrary there was no impact on resistance to chemotherapy or ionizing radiation. In the third cell line, we didn't observe any impact on cell growth, but an increase of cell radioresistance. Concerning the mutation reversion, our preliminary results show homologous recombination at the right locus in the genome, and some clones present a loss of the mutation confirmed by sequencing. After the removal of resistance cassette by action of a recombinase protein, we will be able to evaluate the biological effects of mutation reversion. To sum up, these different models would allow us to decipher cellular and molecular mechanism induced by the H3.3K27M mutation in DIPG cells including resistance to treatment, and thus, to possibly identify putative therapeutic targets. Citation Format: Quentin Bailleul, Mélanie Arcicasa, Audrey Hochart, Andria Rakotomalala, Marie Castets, Eddy Pasquier, Pierre-Olivier Angrand, Eric Adriaenssens, Xuefen Le Bourhis, Pierre Leblond, Samuel Meignan. Impact of H3.3K27M mutation on diffuse intrinsic pontine glioma's resistance to treatment [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 5005.

International Journal of Molecular Sciences, Dec 16, 2022

This article is an open access article distributed under the terms and conditions of the Creative... more This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY

Oncogene, Sep 3, 2007

of the original article: Tamoxifen (TAM), is widely used as a single agent in adjuvant treatment ... more of the original article: Tamoxifen (TAM), is widely used as a single agent in adjuvant treatment of breast cancer. Here, we investigated the effects of TAM in combination with tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in estrogen receptor-a (ER-a)-positive and-negative breast cancer cells. We showed that cotreatment with TAM and TRAIL synergistically induced apoptosis regardless of ERa status. By contrast, cotreatment did not affect the viability of normal breast epithelial cells. Cotreatment with TAM and TRAIL in breast cancer cells decreased the levels of antiapoptotic proteins including FLIPs and Bcl-2, and enhanced the levels of proapoptotic proteins such as FADD, caspase 8, tBid, Bax and caspase 9. Furthermore, cotreatment-induced apoptosis was efficiently reduced by FADD-or Bid-siRNA, indicating the implication of both extrinsic and intrinsic pathways in synergistic apoptosis induction. Importantly, cotreatment totally arrested tumor growth in an ERa negative MDA-MB-231 tumor xenograft model. The abrogation of tumor growth correlated with enhanced apoptosis in tumor tissues. Our findings raise the possibility to use TAM in combination with TRAIL for breast cancers, regardless of ERa status.

Current Cancer Drug Targets, Sep 1, 2004

We show here that nerve growth factor (NGF), the prototypic neurotrophin, can be targeted in brea... more We show here that nerve growth factor (NGF), the prototypic neurotrophin, can be targeted in breast cancer to inhibit tumor cell proliferation, survival, and metastasis. Analysis of a series of biopsies revealed widespread expression of NGF in the majority of human breast tumors, with anti-NGF immunoreactivity concentrated in the epithelial cancer cells. Moreover, immunodeficient mice xenografted with human breast cancer cells and treated with either anti-NGF antibodies or small interfering RNA against NGF displayed inhibited tumor growth and metastasis. Such treatments directed against NGF induced a decrease in cell proliferation with a concomitant increase in apoptosis of breast cancer cells and an inhibition of tumor angiogenesis. Together, these data indicate that targeting NGF in breast cancer may have therapeutic ramifications. [Cancer Res 2008;68(2):346–51]

Experimental Cell Research, May 1, 2002

The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as ... more The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as an RNA molecule. We previously reported that in breast adenocarcinoma, H19 is often overexpressed in stromal cells and preferentially located at the epithelium/stroma boundary, suggesting that epithelial/mesenchymal interactions can control H19 RNA expression. In some cases of breast adenocarcinoma with poor prognosis, H19 is overexpressed in epithelial cells. Therefore we examined whether mesenchymal factors can induce H19 expression in epithelial cells. Using quantitative RT-PCR and in situ hybridization, we found that when mammary epithelial cells were cultured in collagen gels, H19 expression was strongly up-regulated compared to when cells were cultured on plastic. Collagen gels allow threedimensional growth of epithelial cells and morphogenetic responses to soluble factors. A conditioned medium from MRC-5 fibroblasts caused branching morphogenesis of HBL-100 cells and invasive growth of MDA-MB-231 cells, whereas MCF-7 cells were unresponsive. Induction of H19 expression correlated with morphological changes in HBL-100 and in MDA-MB-231 cells, whereas H19 expression was not induced in MCF-7 cells. Using a blocking antibody, HGF/SF was identified as the fibroblast-derived growth factor capable of inducing H19 expression and cell morphogenesis. We further demonstrated that H19 promoter activity was stimulated by various growth factors using transient transfection in MDCK epithelial cells. HGF/SF was more efficient than EGF or FGF-2 in transactivating the H19 promoter, whereas IGF-2, TGF␤-1, and TNF-␣ were ineffective. This activation by HGF/SF was prevented by pharmacological inhibition of MAP kinase or of phospholipase C. We conclude that H19 is a target gene for HGF/SF, a known regulator of epithelial/mesenchymal interactions, and suggest that the up-regulation of H19 may be implicated in morphogenesis and/or migration of epithelial cells.

HAL (Le Centre pour la Communication Scientifique Directe), 2012

Cancer Letters, May 1, 2019

This work was supported by grants from the "Ligue Nationale Contre le Cancer", "Fondation ARC pou... more This work was supported by grants from the "Ligue Nationale Contre le Cancer", "Fondation ARC pour la recherche sur le cancer", "Groupement des Entreprises Françaises dans la Lutte contre le Cancer (GEFLUC)" and the SIRIC Oncolille.

Purpose: Given that nerve growth factor has previously been shown to be involved in breast cancer... more Purpose: Given that nerve growth factor has previously been shown to be involved in breast cancer progression, we have tested here the hypothesis that the other neurotrophins (NT) are expressed and have an influence in breast tumor growth.Experimental Design: The expression of brain-derived neurotrophic factor (BDNF), NT-3 and NT-4/5, as well as the neurotrophin receptor p75NTR, TrkB, and TrkC, was studied by RT-PCR, Western blotting, and immunohistochemistry in cell lines and tumor biopsies. The biological impacts of neurotrophins, and associated mechanisms, were analyzed in cell cultures and xenografted mice.Results: BDNF and NT-4/5 were expressed and secreted by breast cancer cells, and the use of blocking antibodies suggested an autocrine loop mediating cell resistance to apoptosis. The corresponding tyrosine kinase receptor TrkB was only rarely observed at full length, whereas the expression of TrkB-T1, lacking the kinase domain, as well as p75NTR, were detected in all tested breast cancer cell lines and tumor biopsies. In contrast, NT-3 and TrkC were not detected. SiRNA against p75NTR and TrkB-T1 abolished the antiapoptotic effect of BDNF and NT-4/5, whereas the pharmacological inhibitors K252a and PD98059 had no effect, suggesting the involvement of p75NTR and TrkB-T1, but not kinase activities from Trks and MAPK. In xenografted mice, anti-BDNF, anti-NT-4/5, anti-p75NTR, or anti-TrkB-T1 treatments resulted in tumor growth inhibition, characterized by an increase in cell apoptosis, but with no change in proliferation.Conclusion: BDNF and NT-4/5 contribute to breast cancer cell survival and can serve as prospective targets in attempts to inhibit tumor growth. Clin Cancer Res; 17(7); 1741–52. ©2011 AACR.

Supplemental Fig. 1. The 149 bp band obtained in RT-PCR detection (Fig. 1A) was sequenced to veri... more Supplemental Fig. 1. The 149 bp band obtained in RT-PCR detection (Fig. 1A) was sequenced to verify the correspondance to NGF. NGF PCR product has been cloned into pCR 2.1 Topo plasmid, amplified with specific plasmid primers (M13) and sequenced using an ABI PRISM (abgene). The following sequence, demonstrating the correspondance to NGF, was obtained (508) 5'caacaggactcacaggagcaagcggtcatcatcccatcccatcttccacaggggcgaattctcggtgtgtgacagtgtcagcgtgtgggttg gggataagacc accgccacagacatcaagggcaaggaggtgatggtgttgggagaggt3' (657) and the raw data obtained for the sens and anti-sens are displayed below.

HAL (Le Centre pour la Communication Scientifique Directe), 2013

Supplementary Figure 2 from Nerve Growth Factor Is a Potential Therapeutic Target in Breast Cancer

Bioinformatics

Motivation Nowadays, epigenetic gene regulations are studied in each part of the biology, from em... more Motivation Nowadays, epigenetic gene regulations are studied in each part of the biology, from embryonic development to diseases such as cancers and neurodegenerative disorders. Currently, to quantify and compare CpG methylation levels of a specific region of interest, the most accessible technique is the bisulfite sequencing PCR (BSP). However, no existing user-friendly tool is able to analyze data from all approaches of BSP. Therefore, the most convenient way to process results from the direct sequencing of PCR products (direct-BSP) is to manually analyze the chromatogram traces, which is a repetitive and prone to error task. Results Here, we implement a new R-based tool, called ABSP for analysis of bisulfite sequencing PCR, providing a complete analytic process of both direct-BSP and cloning-BSP data. It uses the raw sequencing trace files (.ab1) as input to compute and compare CpG methylation percentages. It is fully automated and includes a user-friendly interface as a built-in...