Jolanta Polanowska - Academia.edu (original) (raw)

Papers by Jolanta Polanowska

Journal of Chromatography A, 1999

Two serine proteinase inhibitors, designated clTI-1 and clTI-2 were purified from livers of chick... more Two serine proteinase inhibitors, designated clTI-1 and clTI-2 were purified from livers of chickens to apparent homogeneity by a combination of ethanol-acetone fractionation, gel filtration and ion-exchange chromatography on CM-cellulose and Mono S columns. The inhibitor clTI-1 is a single polypeptide chain, low-molecular-mass protein (Mr about 6200), very stable to heat and ethanol. It inhibits chicken, porcine and bovine trypsins as well as human plasmin. The second protein, clTI-2 of Mr 17,000 was shown to be a very effective inhibitor of both trypsins and human cathepsin G. Since both inhibitors are sensitive to arginine modification with phenylglyoxal it is assumed that this amino acid residue is present at the P1 position of the reactive site peptide bond. The N-terminal amino acid sequence of 28 residues of clTI-2 (SVDVSKYPSTVSKDGRTLVACPRILSPV) revealed a high homology of this protein to the third domain of the chicken ovoinhibitor, whereas, the clTI-1 (APPAAEKYYSLPPGAPRYYSPVV) has some sequence identity to a fragment of the human inter-alpha-trypsin inhibitor.

Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology, 1998

A series of tetrapeptide p-nitroanilide substrates of the general formula: suc-Ala-Ala-Pro-Aaa-p-... more A series of tetrapeptide p-nitroanilide substrates of the general formula: suc-Ala-Ala-Pro-Aaa-p-nitroanilide was used to map the S 1 binding pocket of human cathepsin G. Based on the k cat /K m parameter, the following order of preference was found: Lys = Phe s Arg = Leu s Met s Nle = Nva s Ala s Asp. Thus, the enzyme exhibits clear dual and equal trypsin-and chymotrypsin-like specificities. Particularly deleterious were L-branched side chains of Ile and Val. The P 1 substrate preferences found for cathepsin G are distinctly different from many other serine proteinases, including fiddler crab collagenase and chymotrypsin. The k cat /K m values obtained for P 1 Lys, Phe, Arg and Leu substrates correlate well with those determined for analogous P 1 mutants of basic pancreatic trypsin inhibitor (BPTI) obtained through recombinant techniques. To characterise the subsite specificity of the enzyme, a series of Cucurbita maxima trypsin inhibitor I (CMTI I) mutants were used comprising P 2^P3 P and P 12 P positions. All the mutants obtained were inhibitors of cathepsin G with association constants in the range: 10 5^1 0 9 M 31 . Some of the mutations destabilised complex formation. In particular, Met 8 CArg substitution at P 3 P, which increased association constant for chymotrypsin 46-fold, led to a 7-fold decrease of binding with cathepsin G. In addition, mutation of Ile 6 at position P 1 P either to Val or Asp was deleterious for cathepsin G. In two cases (Ala 18 CGly (P 12 P) and Pro 4 CThr (P 2 )), about a 10-fold increase in association constants was observed. ß 1998 Elsevier Science B.V. All rights reserved.

The EMBO Journal, 1999

Transient induction of the cyclin E gene in late G 1 gates progression into S. We show that this ... more Transient induction of the cyclin E gene in late G 1 gates progression into S. We show that this event is controlled via a cyclin E repressor module (CERM), a novel bipartite repressor element located near the cyclin E transcription start site. CERM consists of a variant E2F-binding site and a contiguous upstream AT-rich sequence which cooperate during G 0 /G 1 to delay cyclin E expression until late G 1 . CERM binds the protein complex CERC, which disappears upon progression through G 0 -G 1 and reappears upon entry into the following G 1 . CERC disappearance correlates kinetically with the liberation of the CERM module in vivo and cyclin E transcriptional induction. CERC contains E2F4/DP1 and a pocket protein, and sediments faster than classical E2F complexes in a glycerol gradient, suggesting the presence of additional components in a novel high molecular weight complex. Affinity purified CERC binds to CERM but not to canonical E2F sites, thus displaying behavior different from known E2F complexes. In cells nullizygous for members of the Rb family, CERC is still detectable and CERMdependent repression is functional. Thus p130, p107 and pRb function interchangeably in CERC. Notably, the CERC-CERM complex dissociates prematurely in pRb -/cells in correspondence with the premature expression of cyclin E. Thus, we identify a new regulatory module that controls repression of G 1 -specific genes in G 0 /G 1 .

Nature Methods, 2015

Many protein interactions are mediated by small linear motifs interacting specifically with defin... more Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this end, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to 1,000 domain-motif equilibrium binding affinities per day. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from human papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human 'PDZome'. We obtained sharply sequence-dependent binding profiles that quantitatively describe the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has wide potential for quantifying the specificities of interactomes.

BioTechniques, 2004

Page 1. 778 BioTechniques Vol. 36, No. 5 (2004) BENCHMARKS Multiprotein complexes are the functio... more Page 1. 778 BioTechniques Vol. 36, No. 5 (2004) BENCHMARKS Multiprotein complexes are the functional units of many cellular pro-cesses. Defining the components of these complexes, how they associate, and their intrinsic ...

PLoS ONE, 2013

Background: PDZ domains are highly abundant protein-protein interaction modules involved in the w... more Background: PDZ domains are highly abundant protein-protein interaction modules involved in the wiring of protein networks. Emerging evidence indicates that some PDZ domains also interact with phosphoinositides (PtdInsPs), important regulators of cell polarization and signaling. Yet our knowledge on the prevalence, specificity, affinity, and molecular determinants of PDZ-PtdInsPs interactions and on their impact on PDZ-protein interactions is very limited.

The EMBO Journal, 2006

The BRCA1 tumour suppressor and its heterodimeric partner BARD1 constitute an E3-ubiquitin (Ub) l... more The BRCA1 tumour suppressor and its heterodimeric partner BARD1 constitute an E3-ubiquitin (Ub) ligase and function in DNA repair by unknown mechanisms. We show here that the Caenorhabditis elegans BRCA1/ BARD1 (CeBCD) complex possesses an E3-Ub ligase responsible for ubiquitylation at DNA damage sites following ionizing radiation (IR). The DNA damage checkpoint promotes the association of the CeBCD complex with E2-Ub conjugating enzyme, Ubc5(LET-70), leading to the formation of an active E3-Ub ligase on chromatin following IR. Correspondingly, defects in Ubc5(let-70) or the DNA damage checkpoint genes atl-1 or mre-11 abolish CeBCDdependent ubiquitylation in vivo. Extending these findings to human cells reveals a requirement for UbcH5c, the MRN complex, c-H2AX and a co-dependence for ATM and ATR kinases for BRCA1-dependent ubiquitylation at DNA damage sites. Furthermore, we demonstrate that the DNA damage checkpoint promotes the association between BRCA1 and UbcH5c to form an active E3-Ub ligase on chromatin after IR. These data reveal that BRCA1-dependent ubiquitylation is activated at sites of DNA repair by the checkpoint as part of a conserved DNA damage response.

Proceedings of the National Academy of Sciences, 2000

The retinoblastoma protein pRB is involved in the transcriptional control of genes essential for ... more The retinoblastoma protein pRB is involved in the transcriptional control of genes essential for cell cycle progression and differentiation. pRB interacts with different transcription factors and thereby modulates their activity by sequestration, corepression, or activation. We report that pRB, but not p107 and p130, binds to and facilitates repression by p120 E4F , a ubiquitously expressed GLI-Kruppel-related protein identified as a cellular target of E1A. The interaction involves two distinct regions of p120 E4F and the Cterminal part of pRB. In vivo pRB-p120 E4F complexes can only be detected in growth-arrested cells, and accordingly contain the hypophosphorylated form of pRB. Repression of an E4F-responsive promoter is strongly increased by combined expression of p120 E4F and pRB, which correlates with pRB-dependent enhancement of p120 E4F binding activity. Elevated levels of p120 E4F have been shown to block growth of mouse fibroblasts in G1. We find this requires pRB, because RB ؊/؊ fibroblasts are significantly less sensitive to excess p120 E4F .

Molecular & Cellular Proteomics, 2013

Protein-protein interactions organize the localization, clustering, signal transduction, and degr... more Protein-protein interactions organize the localization, clustering, signal transduction, and degradation of cellular proteins and are therefore implicated in numerous biological functions. These interactions are mediated by specialized domains able to bind to modified or unmodified peptides present in binding partners. Among the most broadly distributed protein interaction domains, PSD95-disc large-zonula occludens (PDZ) domains are usually able to bind carboxy-terminal sequences of their partners. In an effort to accelerate the discovery of PDZ domain interactions, we have constructed an array displaying 96% of the human PDZ domains that is amenable to rapid two-hybrid screens in yeast. We have demonstrated that this array can efficiently identify interactions using carboxy-terminal sequences of PDZ domain binders such as the E6 oncoviral protein and protein kinases (PDGFRβ, BRSK2, PCTK1, ACVR2B, and HER4); this has been validated via mass spectrometry analysis. Taking advantage of this array, we show that PDZ domains of Scrib and SNX27 bind to the carboxy-terminal region of the planar cell polarity receptor Vangl2. We also have demonstrated the requirement of Scrib for the promigratory function of Vangl2 and described the morphogenetic function of SNX27 in the early Xenopus embryo. The resource presented here is thus adapted for the screen of PDZ interactors and, furthermore, should facilitate the understanding of PDZ-mediated functions.

Genes, Chromosomes and Cancer, 2000

E2F transcription factors (E2F1 to 6) are central players in the control of animal cell prolifera... more E2F transcription factors (E2F1 to 6) are central players in the control of animal cell proliferation as regulators of genes involved in cell cycle progression and in transformation. In this report, we have investigated the potential involvement of the E2F5 gene in tumorigenesis. We show that E2F5 can promote the formation of morphologically transformed foci in primary baby rat kidney cells (BRK) when it is overexpressed in the presence of its heterodimeric partner DP1 and activated RAS. This suggests that E2F5 behaves like a MYC-type cooperating oncogene in functional assays, prompting us to monitor potential amplifications of the E2F5 gene in primary human tumors. We mapped the human E2F5 gene to 8q21.1-21.3 equidistant from the MOS (8q12) and MYC (8q24) oncogenes. Since the long arm of chromosome 8 is frequently the site of increased gene copy number (ICN) in breast cancer, we screened 442 breast tumor DNAs for gains of E2F5, MOS, and MYC genes. The three genes showed ICN, albeit at variable incidence and levels of amplification, with the ICN of E2F5 occurring concomitantly with those of MOS and/or MYC in almost half of the cases. Moreover, a marked increase of the 2. 5-kb E2F5 transcript was also detected in some tumors and tumor cell lines. In conclusion, the evidence that sustained unregulated expression of E2F5 can cooperate with other oncogenes to promote cell transformation in functional assays, together with the detection of chromosomal amplifications and overexpressions of the E2F5 gene in breast tumors, provides the first indications that E2F5 deregulation may have a role in human tumor development.

FEBS Letters, 2000

The bipartite repressor elements, termed cell cycle-dependent element (CDE)/cell cycle regulatory... more The bipartite repressor elements, termed cell cycle-dependent element (CDE)/cell cycle regulatory element (CCRE)-cell cycle homology region (CHR) control the growth-dependent transcription of the cyclin A, cdc25C, cdc2 genes. Here, we have identified a functional element displaying the signature of the CDE-CHR in the promoter of the mouse RB2 (p130) gene, encoding the retinoblastoma protein family (pRB)-related protein p130. This element locates close to the major transcription start site where it makes major groove contacts with proteins that can be detected in a cellular context using in vivo genomic footprinting techniques. Inactivation of either the CDE or CHR sequence strongly up-regulates the p130 promoter activity in exponentially growing cells, a situation where endogenous p130 gene expression is almost undetectable. Electrophoretic mobility shift assays suggest that two different protein complexes bind independently to the p130 CDE and CHR elements, and that the protein(s) bound to the CDE might be related to those bound on cyclin A and cdc2 promoters.

EMBO Reports, 2002

We have identified previously a repressor element in the transcription start site region of the c... more We have identified previously a repressor element in the transcription start site region of the cyclin E1 promoter that periodically associates with an atypical, high molecular weight E2F complex, termed CERC. Purification of native CERC reveals the presence of the type II arginine methyltransferase PRMT5, which can mono-or symetrically dimethylate arginine residues in proteins. Chromatin immunoprecipitations (ChIPs) show that PRMT5 is associated specifically with the transcription start site region of the cyclin E1 promoter. ChIP analyses also show that this correlates with the presence on the same promoter region of arginine-methylated proteins including histone H4, an in vitro substrate of PRMT5. Consistent with its presence within the repressor complex, forced expression of PRMT5 negatively affects cyclin E1 promoter activity and cellular proliferation, effects that require its methyltransferase activity. These data provide the first direct experimental evidence that a type II arginine methylase is involved in the control of transcription and proliferation. contributed equally to this work 642 EMBO reports vol. 3 | no. 7 | 2002 E. Fabbrizio et al.

Developmental Cell, 2011

Centrosome duplication occurs once per cell cycle and ensures that the two resulting centrosomes ... more Centrosome duplication occurs once per cell cycle and ensures that the two resulting centrosomes assemble a bipolar mitotic spindle. Centriole formation is fundamental for centrosome duplication. In Caenorhabditis elegans, the evolutionarily conserved proteins SPD-2, ZYG-1, SAS-6, SAS-5, and SAS-4 are essential for centriole formation, but how they function is not fully understood. Here, we demonstrate that Protein Phosphatase 2A (PP2A) is also critical for centriole formation in C. elegans embryos. We find that PP2A subunits genetically and physically interact with the SAS-5/SAS-6 complex. Furthermore, we show that PP2A-mediated dephosphorylation promotes centriolar targeting of SAS-5 and ensures SAS-6 delivery to the site of centriole assembly. We find that PP2A is similarly needed for the presence of HsSAS-6 at centrioles and for centriole formation in human cells. These findings lead us to propose that PP2A-mediated loading of SAS-6 proteins is critical at the onset of centriole formation.

Developmental Biology, 2011

Current Biology, 2004

BRCA1 pathway is likely to provide important mechanistic insights into its role in DNA repair pro... more BRCA1 pathway is likely to provide important mechanistic insights into its role in DNA repair processes but has Am Klopferspitz 18a Germany been limited by the apparent absence of BRCA1 or its partners in yeast, worms, or flies. As part of a detailed search of the C. elegans genome sequence for putative DNA repair genes, we identified a putative ortholog of BARD1 (K04C2.4, Ce-brd-1; 1A). K04C2.4 encodes a protein (Ce-BRD-1) of 670 amino acids with 23% identity and 41% similarity to Inherited germline mutations in the tumor suppressor human BARD1. Containing a putative N-terminal RING gene BRCA1 predispose individuals to early onset finger domain, three ankyrin repeats in the central region breast and ovarian cancer [1]. BRCA1 together with of the protein, and two C-terminal BRCT repeat doits structurally related partner BARD1 is required for mains, Ce-BRD-1 is most related to Xenopus laevis homologous recombination and DNA double-strand BARD1 ( [16]. Given that BRCA1 occurs as a break repair, but how they perform these functions heterodimer with BARD1, the identification of Ce-BRD-1 remains elusive [2, 3]. As part of a comprehensive raised the possibility that a BRCA1 homolog may also search for DNA repair genes in C. elegans, we identiexist in the nematode. However, extensive sequence fied a BARD1 ortholog. In protein interaction screens, searches of the C. elegans genome failed to uncover a Ce-BRD-1 was found to interact with components of potential BRCA1 homolog. the sumoylation pathway, the TACC domain protein

Cell Host & Microbe, 2011

The cuticle and epidermis of Caenorhabditis elegans provide the first line of defense against inv... more The cuticle and epidermis of Caenorhabditis elegans provide the first line of defense against invading pathogens. Upon invasion by the fungal pathogen Drechmeria coniospora, C. elegans responds by upregulating the expression of antimicrobial peptides (AMPs) in the epidermis via activation of at least two pathways, a neuroendocrine TGF-b pathway and a p38 MAPK pathway. Here, we identify the sodium-neurotransmitter symporter SNF-12, a member of the solute carrier family (SLC6), as being essential for both these immune signaling pathways. We also identify the STAT transcription factor-like protein STA-2 as a direct physical interactor of SNF-12 and show that the two proteins function together to regulate AMP gene expression in the epidermis. Both SNF-12 and STA-2 act cell autonomously and specifically in the epidermis to govern the transcriptional response to fungal infection. These findings reveal an unorthodox mode of regulation for a STAT factor and highlight the molecular plasticity of innate immune signaling.

Cell, 2003

global genome repair (GGR) and transcription-coupled repair (TCR). GGR repairs the DNA damage ove... more global genome repair (GGR) and transcription-coupled repair (TCR). GGR repairs the DNA damage over the entire genome, while TCR removes DNA lesions significantly faster from the transcribed strand of active genes than from the nontranscribed strand or the bulk of DNA 1 Dana-Farber Cancer Institute (Friedberg et al., 1995; Svejstrup, 2002). 2 Harvard Medical School Various types of NER-defects are found in individuals 3 Brigham and Women's Hospital with the inherited syndromes xeroderma pigmentosum Boston, Massachusetts 02115 (XP), Cockayne syndrome (CS), and trichothiodystrophy 4 Graduate School of Frontier Biosciences (TTD) (Bootsma et al., 1998). XP patients are sun sensi-Osaka University tive and generally show a greatly increased incidence 5 Core Research for Evolutional Science and of UV-induced skin cancers. Cell fusion studies have Technology (CREST) identified seven XP complementation groups (XP-A Japan Science and Technology Corporation through XP-G) and a variant form (XP-V). In general, Suita, Osaka 565-0871 patients with XP-A, -B, -D, -F, and -G are defective in Japan both TCR and GGR, while those with XP-C are defective only in GGR (Bootsma et al., 1998). XP-V defines patients with the clinical symptoms of XP, which shows normal Summary NER but defective trans-lesion DNA synthesis (Friedberg et al., 2002). Nucleotide excision repair (NER) is a major cellular XP-E cells are biochemically heterogeneous and defense against the carcinogenic effects of ultraviolet some, but not all, XP-E cell lines lack an activity that light from the sun. Mutational inactivation of NER probinds to damaged DNA (Friedberg et al., 1995; Bootsma teins, like DDB and CSA, leads to hereditary diseases et al., 1998). This activity is associated with a UV-damsuch as xeroderma pigmentosum (XP) and Cockayne aged DNA binding protein (DDB) composed of the DDB1 syndrome (CS). Here, we show that DDB2 and CSA (or p127) and DDB2 (or p48) subunits (Keeney et al., are each integrated into nearly identical complexes 1993). Mutations in the DDB2 gene, which encodes a via interaction with DDB1. Both complexes contain WD40 repeat-containing protein, have been found in cullin 4A and Roc1 and display ubiquitin ligase activity. XP-E cell lines that are lacking the damaged DNA bind-They also contain the COP9 signalosome (CSN), a ing activity. The absence of this activity has been linked known regulator of cullin-based ubiquitin ligases. to the deficiency in GGR of CPDs in these XP-E cells Strikingly, CSN differentially regulates ubiquitin ligase (Friedberg et al., 1995; Bootsma et al., 1998). Although activity of the DDB2 and CSA complexes in response the exact mechanisms whereby DDB contributes to NER to UV irradiation. Knockdown of CSN with RNA interare not clear, DDB has been shown to stimulate binding ference leads to defects in NER. These results suggest of XPA and replication protein A (RPA) to damaged DNA that the distinct UV response of the DDB2 and CSA (Wakasugi et al., 2001). This result suggests that DDB complexes is involved in diverse mechanisms of NER. stimulates NER by recruiting core NER factors to damaged DNA via interaction with XPA and RPA. Introduction Like XP patients, CS patients show hypersensitivity to sunlight but have no predisposition to skin cancer. Nucleotide excision repair (NER) acts on a wide variety However, CS patients show a distinctive array of severe of helix-distorting DNA lesions, including the cyclobudevelopmental and neurological abnormalities as well tane pyrimidine dimers (CPDs) and (6-4) pyrimidine-pyrias premature aging (Friedberg et al., 1995; Bootsma et midone photoproducts induced by UV light (Friedberg al., 1998). Classical CS is caused by mutations in either et al., 1995; Svejstrup, 2002). The core reaction of NER the CSA or CSB genes. CSA-and CSB-deficient cells involves removal of an approximately 27-30 nt oligonu-(CS-A and CS-B, respectively) are proficient in GGR but cleotide fragment containing the photoproduct. This exshow a defect in TCR. While mutations in the CSA and cision reaction occurs by positioned hydrolysis of the CSB genes account for over 90% of CS patients, mutaphosphodiester bonds at precise distances 5Ј and 3Ј to tions in the XPB, XPD, and XPG genes also underlie a the lesion, exclusively on the damaged DNA strand. small number of CS cases (XP-B/CS, XP-D/CS, and XP-G/ Once the damage-containing fragment is excised, the CS, respectively) (Friedberg et al., 1995; Bootsma et al., gap generated in the DNA duplex is repaired by DNA 1998). Of these gene products, CSB, XPB, XPD, and XPG appear to play a role in general transcription (reviewed in synthesis using the opposite, normal DNA strand as a Selby and Sancar, 1997; Lee et al., 2002), suggesting template (Friedberg et al., 1995; Svejstrup, 2002). It has that transcriptional defects are the underlying cause of been shown that NER can operate via two pathways: growth and developmental defects in CS. Moreover, CSB, XPB, XPD, and XPG appear to be involved in TCR *Correspondence: yoshihiro_nakatani@dfci.harvard.edu of oxidative lesions such as thymine glycol and 8-oxogu-6 These authors contributed equally to this work. anine. TCR of oxidative damage in a transcribed se-7 Present address: Cancer Research UK, Clare Hall Laboratories, South Mimms, Herts EN6 3LD, United Kingdom. quence has been shown to be defective in CS-B, XP-B/ Cell 358 independent DNA excision repair pathways in human cells. Mutat. Res. 274, 57-64. N-terminally FLAG-HA-epitope-tagged wild-type or mutant (D151N) CSN was stably expressed in HeLa cells and purified as described Cooper, P.K., Nouspikel, T., Clarkson, S.G., and Leadon, S.A. (1997). (Ikura et al., 2000; Ogawa et al., 2002). The substrates for NEDD8-Defective transcription-coupled repair of oxidative base damage and ubiquitin-deconjugating activities were prepared as follows. in Cockayne syndrome patients from XP group G. Science 275, NEDD8-Cul 4A-containing DDB2 complex was immunopurified from 990-993. the solubilized chromatin fraction of e-DDB2-expressing HeLa cells Cope, G.A., Suh, G.S., Aravind, L., Schwarz, S.E., Zipursky, S.L., 30 min after UV irradiation as described above. Ubiquitinated Cul4A Koonin, E.V., and Deshaies, R.J. (2002). Role of predicted metallowas obtained by in vitro ubiquitination of the partial DDB2 complex protease motif of Jab1/Csn5 in cleavage of NEDD8 from CUL1. lacking CSN as described above. After the ubiquitination reaction, Science 298, 608-611. the complex was purified by immunoprecipitation with M2 anti-Elsasser, S., Gali, R.R., Schwickart, M., Larsen, C.N., Leggett, D.S., Flag antibody-conjugated agarose and used as a substrate. These Muller, B., Feng, M.T., Tubing, F., Dittmar, G.A., and Finley, D. (2002). substrates were incubated with 50 ng of the wild-type and mutant Proteasome subunit Rpn1 binds ubiquitin-like protein domains. Nat. CSN in 10 l of CSK buffer (10 mM Pipes-KOH [pH 6.8], 100 mM Cell Biol. 4, 725-730. NaCl, 300 mM sucrose, and 3 mM MgCl 2 ) at 30ЊC for 30 min. After Friedberg, E.C., Walker, G.C., and Siede, W. (1995). DNA Repair and incubation, modification of Cul4A was analyzed by immunoblotting Mutagenesis (Washington, D.C.: American Society of Microbiology). with Cul4A antibody. Friedberg, E.C., Wagner, R., and Radman, M. (2002). Specialized CSN5 Knockdown DNA polymerases, cellular survival, and the genesis of mutations. The following siRNA precursors were expressed into BJ1 fibroblasts Science 296, 1627-1630. (BD Biosciences Clontech) via pSUPER.retro (Brummelkamp et al., Glickman, M.H., Rubin, D.M., Coux, O., Wefes, I., Pfeifer, G., Cjeka, 2002). These transcripts are predicted to be folded into a 19 bp Z., Baumeister, W., Fried, V.A., and Finley, D. (1998). A subcomplex stem-loop structure and processed to functional siRNA. Note that of the proteasome regulatory particle required for ubiquitin-conjuthe target 19 nt sequences are underlined. Transduced subpopulagate degradation and related to the COP9-signalosome and eIF3. tions were selected with 3 g/ml puromycin. CSN5 siRNA-1: 5ЈGCU Cell 94, 615-623. CAGAGUAUCGAUGAAAUUCAAGAGAUUUCAUCGAUACUCUGAG Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu. CUU 3Ј CSN5 siRNA-2: 5ЈCAUGCAGGAAGCUCAGAGUUUCAAGA Rev. Biochem. 67, 425-479. GAACUCUGAGCUUCCUGCAUGUU 3Ј. Ikura, T., Ogryzko, V.V., Grigoriev, M., Groisman, R., Wang, J., Horikoshi, M., Scully, R., Qin, J., and Nakatani, Y. (2000). Involvement Antibodies of the TIP60 histone acetylase complex in DNA repair and apoptosis. Antibody employed are as follows: anti-CSA (Santa Cruz Biotechnol-Cell 102, 463-473. ogy, Inc.), anti-CSN1 to CSN8 (Affiniti), anti-multiubiquitin (FK2) (MBL), anti-DDB1 and -DDB2 (

BMC Genomics, 2010

Background: Proteins may evolve through the recruitment and modification of discrete domains, and... more Background: Proteins may evolve through the recruitment and modification of discrete domains, and in many cases, protein action can be dissected at the domain level. PDZ domains are found in many important structural and signaling complexes, and are generally thought to interact with their protein partners through a C-terminal consensus sequence. We undertook a comprehensive search for protein partners of all individual PDZ domains in C. elegans to characterize their function and mode of interaction. Results: Coupling high-throughput yeast two-hybrid screens with extensive validation by co-affinity purification, we defined a domain-orientated interactome map. This integrates PDZ domain proteins in numerous cell-signaling pathways and shows that PDZ domain proteins are implicated in an unexpectedly wide range of cellular processes. Importantly, we uncovered a high frequency of non-canonical interactions, not involving the C-terminus of the protein partner, which were directly confirmed in most cases. We completed our study with the generation of a yeast array representing the entire set of PDZ domains from C. elegans and provide a proof-of-principle for its application to the discovery of PDZ domain targets for any protein or peptide of interest. Conclusions: We provide an extensive domain-centered dataset, together with a clone resource, that will help future functional study of PDZ domains. Through this unbiased approach, we revealed frequent non-canonical interactions between PDZ domains and their protein partners that will require a re-evaluation of this domain's molecular function.

Oncogene, 1999

The p16-cyclin D-pRB-E2F pathway is frequently deregulated in human tumors. This critical regulat... more The p16-cyclin D-pRB-E2F pathway is frequently deregulated in human tumors. This critical regulatory pathway controls the G1/S transition of the mammalian cell cycle by positive and negative regulation of E2Fresponsive genes required for DNA replication. To assess the value of the transcription factors E2Fs as targets for antiproliferative strategies, we have initiated a program aiming to develop inhibitors targeting speci®cally these proteins in vitro and in vivo. The cellular activity of E2F is the result of the heterodimeric association of two families of proteins, E2Fs and DPs, which then bind DNA. Here, we use a two hybrid approach to isolate from combinatorial libraries peptide aptamers that speci®cally interact with E2Fs DNA binding and dimerization domains. One of these is a potent inhibitor of E2F binding activity in vitro and in mammalian ®broblasts, blocks cells in G1, and the free variable region from this aptamer has the same eect. Our experiments argue that the variable region of this aptamer is structured, and that it functions by binding E2F with a motif that resembles a DP heterodimerization region, and blocking E2F's association with DP. These results show that cell proliferation can be inhibited using genetically-selected synthetic peptides that speci®cally target protein-protein interaction motifs within cell cycle regulators. These results also emphasize the critical role of the E2F pathway for cell proliferation and might allow the design of novel antiproliferative agents targeting the cyclin/CDK-pRB-E2F pathway.

Journal of Chromatography A, 1999

Two serine proteinase inhibitors, designated clTI-1 and clTI-2 were purified from livers of chick... more Two serine proteinase inhibitors, designated clTI-1 and clTI-2 were purified from livers of chickens to apparent homogeneity by a combination of ethanol-acetone fractionation, gel filtration and ion-exchange chromatography on CM-cellulose and Mono S columns. The inhibitor clTI-1 is a single polypeptide chain, low-molecular-mass protein (Mr about 6200), very stable to heat and ethanol. It inhibits chicken, porcine and bovine trypsins as well as human plasmin. The second protein, clTI-2 of Mr 17,000 was shown to be a very effective inhibitor of both trypsins and human cathepsin G. Since both inhibitors are sensitive to arginine modification with phenylglyoxal it is assumed that this amino acid residue is present at the P1 position of the reactive site peptide bond. The N-terminal amino acid sequence of 28 residues of clTI-2 (SVDVSKYPSTVSKDGRTLVACPRILSPV) revealed a high homology of this protein to the third domain of the chicken ovoinhibitor, whereas, the clTI-1 (APPAAEKYYSLPPGAPRYYSPVV) has some sequence identity to a fragment of the human inter-alpha-trypsin inhibitor.

Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology, 1998

A series of tetrapeptide p-nitroanilide substrates of the general formula: suc-Ala-Ala-Pro-Aaa-p-... more A series of tetrapeptide p-nitroanilide substrates of the general formula: suc-Ala-Ala-Pro-Aaa-p-nitroanilide was used to map the S 1 binding pocket of human cathepsin G. Based on the k cat /K m parameter, the following order of preference was found: Lys = Phe s Arg = Leu s Met s Nle = Nva s Ala s Asp. Thus, the enzyme exhibits clear dual and equal trypsin-and chymotrypsin-like specificities. Particularly deleterious were L-branched side chains of Ile and Val. The P 1 substrate preferences found for cathepsin G are distinctly different from many other serine proteinases, including fiddler crab collagenase and chymotrypsin. The k cat /K m values obtained for P 1 Lys, Phe, Arg and Leu substrates correlate well with those determined for analogous P 1 mutants of basic pancreatic trypsin inhibitor (BPTI) obtained through recombinant techniques. To characterise the subsite specificity of the enzyme, a series of Cucurbita maxima trypsin inhibitor I (CMTI I) mutants were used comprising P 2^P3 P and P 12 P positions. All the mutants obtained were inhibitors of cathepsin G with association constants in the range: 10 5^1 0 9 M 31 . Some of the mutations destabilised complex formation. In particular, Met 8 CArg substitution at P 3 P, which increased association constant for chymotrypsin 46-fold, led to a 7-fold decrease of binding with cathepsin G. In addition, mutation of Ile 6 at position P 1 P either to Val or Asp was deleterious for cathepsin G. In two cases (Ala 18 CGly (P 12 P) and Pro 4 CThr (P 2 )), about a 10-fold increase in association constants was observed. ß 1998 Elsevier Science B.V. All rights reserved.

The EMBO Journal, 1999

Transient induction of the cyclin E gene in late G 1 gates progression into S. We show that this ... more Transient induction of the cyclin E gene in late G 1 gates progression into S. We show that this event is controlled via a cyclin E repressor module (CERM), a novel bipartite repressor element located near the cyclin E transcription start site. CERM consists of a variant E2F-binding site and a contiguous upstream AT-rich sequence which cooperate during G 0 /G 1 to delay cyclin E expression until late G 1 . CERM binds the protein complex CERC, which disappears upon progression through G 0 -G 1 and reappears upon entry into the following G 1 . CERC disappearance correlates kinetically with the liberation of the CERM module in vivo and cyclin E transcriptional induction. CERC contains E2F4/DP1 and a pocket protein, and sediments faster than classical E2F complexes in a glycerol gradient, suggesting the presence of additional components in a novel high molecular weight complex. Affinity purified CERC binds to CERM but not to canonical E2F sites, thus displaying behavior different from known E2F complexes. In cells nullizygous for members of the Rb family, CERC is still detectable and CERMdependent repression is functional. Thus p130, p107 and pRb function interchangeably in CERC. Notably, the CERC-CERM complex dissociates prematurely in pRb -/cells in correspondence with the premature expression of cyclin E. Thus, we identify a new regulatory module that controls repression of G 1 -specific genes in G 0 /G 1 .

Nature Methods, 2015

Many protein interactions are mediated by small linear motifs interacting specifically with defin... more Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this end, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to 1,000 domain-motif equilibrium binding affinities per day. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from human papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human 'PDZome'. We obtained sharply sequence-dependent binding profiles that quantitatively describe the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has wide potential for quantifying the specificities of interactomes.

BioTechniques, 2004

Page 1. 778 BioTechniques Vol. 36, No. 5 (2004) BENCHMARKS Multiprotein complexes are the functio... more Page 1. 778 BioTechniques Vol. 36, No. 5 (2004) BENCHMARKS Multiprotein complexes are the functional units of many cellular pro-cesses. Defining the components of these complexes, how they associate, and their intrinsic ...

PLoS ONE, 2013

Background: PDZ domains are highly abundant protein-protein interaction modules involved in the w... more Background: PDZ domains are highly abundant protein-protein interaction modules involved in the wiring of protein networks. Emerging evidence indicates that some PDZ domains also interact with phosphoinositides (PtdInsPs), important regulators of cell polarization and signaling. Yet our knowledge on the prevalence, specificity, affinity, and molecular determinants of PDZ-PtdInsPs interactions and on their impact on PDZ-protein interactions is very limited.

The EMBO Journal, 2006

The BRCA1 tumour suppressor and its heterodimeric partner BARD1 constitute an E3-ubiquitin (Ub) l... more The BRCA1 tumour suppressor and its heterodimeric partner BARD1 constitute an E3-ubiquitin (Ub) ligase and function in DNA repair by unknown mechanisms. We show here that the Caenorhabditis elegans BRCA1/ BARD1 (CeBCD) complex possesses an E3-Ub ligase responsible for ubiquitylation at DNA damage sites following ionizing radiation (IR). The DNA damage checkpoint promotes the association of the CeBCD complex with E2-Ub conjugating enzyme, Ubc5(LET-70), leading to the formation of an active E3-Ub ligase on chromatin following IR. Correspondingly, defects in Ubc5(let-70) or the DNA damage checkpoint genes atl-1 or mre-11 abolish CeBCDdependent ubiquitylation in vivo. Extending these findings to human cells reveals a requirement for UbcH5c, the MRN complex, c-H2AX and a co-dependence for ATM and ATR kinases for BRCA1-dependent ubiquitylation at DNA damage sites. Furthermore, we demonstrate that the DNA damage checkpoint promotes the association between BRCA1 and UbcH5c to form an active E3-Ub ligase on chromatin after IR. These data reveal that BRCA1-dependent ubiquitylation is activated at sites of DNA repair by the checkpoint as part of a conserved DNA damage response.

Proceedings of the National Academy of Sciences, 2000

The retinoblastoma protein pRB is involved in the transcriptional control of genes essential for ... more The retinoblastoma protein pRB is involved in the transcriptional control of genes essential for cell cycle progression and differentiation. pRB interacts with different transcription factors and thereby modulates their activity by sequestration, corepression, or activation. We report that pRB, but not p107 and p130, binds to and facilitates repression by p120 E4F , a ubiquitously expressed GLI-Kruppel-related protein identified as a cellular target of E1A. The interaction involves two distinct regions of p120 E4F and the Cterminal part of pRB. In vivo pRB-p120 E4F complexes can only be detected in growth-arrested cells, and accordingly contain the hypophosphorylated form of pRB. Repression of an E4F-responsive promoter is strongly increased by combined expression of p120 E4F and pRB, which correlates with pRB-dependent enhancement of p120 E4F binding activity. Elevated levels of p120 E4F have been shown to block growth of mouse fibroblasts in G1. We find this requires pRB, because RB ؊/؊ fibroblasts are significantly less sensitive to excess p120 E4F .

Molecular & Cellular Proteomics, 2013

Protein-protein interactions organize the localization, clustering, signal transduction, and degr... more Protein-protein interactions organize the localization, clustering, signal transduction, and degradation of cellular proteins and are therefore implicated in numerous biological functions. These interactions are mediated by specialized domains able to bind to modified or unmodified peptides present in binding partners. Among the most broadly distributed protein interaction domains, PSD95-disc large-zonula occludens (PDZ) domains are usually able to bind carboxy-terminal sequences of their partners. In an effort to accelerate the discovery of PDZ domain interactions, we have constructed an array displaying 96% of the human PDZ domains that is amenable to rapid two-hybrid screens in yeast. We have demonstrated that this array can efficiently identify interactions using carboxy-terminal sequences of PDZ domain binders such as the E6 oncoviral protein and protein kinases (PDGFRβ, BRSK2, PCTK1, ACVR2B, and HER4); this has been validated via mass spectrometry analysis. Taking advantage of this array, we show that PDZ domains of Scrib and SNX27 bind to the carboxy-terminal region of the planar cell polarity receptor Vangl2. We also have demonstrated the requirement of Scrib for the promigratory function of Vangl2 and described the morphogenetic function of SNX27 in the early Xenopus embryo. The resource presented here is thus adapted for the screen of PDZ interactors and, furthermore, should facilitate the understanding of PDZ-mediated functions.

Genes, Chromosomes and Cancer, 2000

E2F transcription factors (E2F1 to 6) are central players in the control of animal cell prolifera... more E2F transcription factors (E2F1 to 6) are central players in the control of animal cell proliferation as regulators of genes involved in cell cycle progression and in transformation. In this report, we have investigated the potential involvement of the E2F5 gene in tumorigenesis. We show that E2F5 can promote the formation of morphologically transformed foci in primary baby rat kidney cells (BRK) when it is overexpressed in the presence of its heterodimeric partner DP1 and activated RAS. This suggests that E2F5 behaves like a MYC-type cooperating oncogene in functional assays, prompting us to monitor potential amplifications of the E2F5 gene in primary human tumors. We mapped the human E2F5 gene to 8q21.1-21.3 equidistant from the MOS (8q12) and MYC (8q24) oncogenes. Since the long arm of chromosome 8 is frequently the site of increased gene copy number (ICN) in breast cancer, we screened 442 breast tumor DNAs for gains of E2F5, MOS, and MYC genes. The three genes showed ICN, albeit at variable incidence and levels of amplification, with the ICN of E2F5 occurring concomitantly with those of MOS and/or MYC in almost half of the cases. Moreover, a marked increase of the 2. 5-kb E2F5 transcript was also detected in some tumors and tumor cell lines. In conclusion, the evidence that sustained unregulated expression of E2F5 can cooperate with other oncogenes to promote cell transformation in functional assays, together with the detection of chromosomal amplifications and overexpressions of the E2F5 gene in breast tumors, provides the first indications that E2F5 deregulation may have a role in human tumor development.

FEBS Letters, 2000

The bipartite repressor elements, termed cell cycle-dependent element (CDE)/cell cycle regulatory... more The bipartite repressor elements, termed cell cycle-dependent element (CDE)/cell cycle regulatory element (CCRE)-cell cycle homology region (CHR) control the growth-dependent transcription of the cyclin A, cdc25C, cdc2 genes. Here, we have identified a functional element displaying the signature of the CDE-CHR in the promoter of the mouse RB2 (p130) gene, encoding the retinoblastoma protein family (pRB)-related protein p130. This element locates close to the major transcription start site where it makes major groove contacts with proteins that can be detected in a cellular context using in vivo genomic footprinting techniques. Inactivation of either the CDE or CHR sequence strongly up-regulates the p130 promoter activity in exponentially growing cells, a situation where endogenous p130 gene expression is almost undetectable. Electrophoretic mobility shift assays suggest that two different protein complexes bind independently to the p130 CDE and CHR elements, and that the protein(s) bound to the CDE might be related to those bound on cyclin A and cdc2 promoters.

EMBO Reports, 2002

We have identified previously a repressor element in the transcription start site region of the c... more We have identified previously a repressor element in the transcription start site region of the cyclin E1 promoter that periodically associates with an atypical, high molecular weight E2F complex, termed CERC. Purification of native CERC reveals the presence of the type II arginine methyltransferase PRMT5, which can mono-or symetrically dimethylate arginine residues in proteins. Chromatin immunoprecipitations (ChIPs) show that PRMT5 is associated specifically with the transcription start site region of the cyclin E1 promoter. ChIP analyses also show that this correlates with the presence on the same promoter region of arginine-methylated proteins including histone H4, an in vitro substrate of PRMT5. Consistent with its presence within the repressor complex, forced expression of PRMT5 negatively affects cyclin E1 promoter activity and cellular proliferation, effects that require its methyltransferase activity. These data provide the first direct experimental evidence that a type II arginine methylase is involved in the control of transcription and proliferation. contributed equally to this work 642 EMBO reports vol. 3 | no. 7 | 2002 E. Fabbrizio et al.

Developmental Cell, 2011

Centrosome duplication occurs once per cell cycle and ensures that the two resulting centrosomes ... more Centrosome duplication occurs once per cell cycle and ensures that the two resulting centrosomes assemble a bipolar mitotic spindle. Centriole formation is fundamental for centrosome duplication. In Caenorhabditis elegans, the evolutionarily conserved proteins SPD-2, ZYG-1, SAS-6, SAS-5, and SAS-4 are essential for centriole formation, but how they function is not fully understood. Here, we demonstrate that Protein Phosphatase 2A (PP2A) is also critical for centriole formation in C. elegans embryos. We find that PP2A subunits genetically and physically interact with the SAS-5/SAS-6 complex. Furthermore, we show that PP2A-mediated dephosphorylation promotes centriolar targeting of SAS-5 and ensures SAS-6 delivery to the site of centriole assembly. We find that PP2A is similarly needed for the presence of HsSAS-6 at centrioles and for centriole formation in human cells. These findings lead us to propose that PP2A-mediated loading of SAS-6 proteins is critical at the onset of centriole formation.

Developmental Biology, 2011

Current Biology, 2004

BRCA1 pathway is likely to provide important mechanistic insights into its role in DNA repair pro... more BRCA1 pathway is likely to provide important mechanistic insights into its role in DNA repair processes but has Am Klopferspitz 18a Germany been limited by the apparent absence of BRCA1 or its partners in yeast, worms, or flies. As part of a detailed search of the C. elegans genome sequence for putative DNA repair genes, we identified a putative ortholog of BARD1 (K04C2.4, Ce-brd-1; 1A). K04C2.4 encodes a protein (Ce-BRD-1) of 670 amino acids with 23% identity and 41% similarity to Inherited germline mutations in the tumor suppressor human BARD1. Containing a putative N-terminal RING gene BRCA1 predispose individuals to early onset finger domain, three ankyrin repeats in the central region breast and ovarian cancer [1]. BRCA1 together with of the protein, and two C-terminal BRCT repeat doits structurally related partner BARD1 is required for mains, Ce-BRD-1 is most related to Xenopus laevis homologous recombination and DNA double-strand BARD1 ( [16]. Given that BRCA1 occurs as a break repair, but how they perform these functions heterodimer with BARD1, the identification of Ce-BRD-1 remains elusive [2, 3]. As part of a comprehensive raised the possibility that a BRCA1 homolog may also search for DNA repair genes in C. elegans, we identiexist in the nematode. However, extensive sequence fied a BARD1 ortholog. In protein interaction screens, searches of the C. elegans genome failed to uncover a Ce-BRD-1 was found to interact with components of potential BRCA1 homolog. the sumoylation pathway, the TACC domain protein

Cell Host & Microbe, 2011

The cuticle and epidermis of Caenorhabditis elegans provide the first line of defense against inv... more The cuticle and epidermis of Caenorhabditis elegans provide the first line of defense against invading pathogens. Upon invasion by the fungal pathogen Drechmeria coniospora, C. elegans responds by upregulating the expression of antimicrobial peptides (AMPs) in the epidermis via activation of at least two pathways, a neuroendocrine TGF-b pathway and a p38 MAPK pathway. Here, we identify the sodium-neurotransmitter symporter SNF-12, a member of the solute carrier family (SLC6), as being essential for both these immune signaling pathways. We also identify the STAT transcription factor-like protein STA-2 as a direct physical interactor of SNF-12 and show that the two proteins function together to regulate AMP gene expression in the epidermis. Both SNF-12 and STA-2 act cell autonomously and specifically in the epidermis to govern the transcriptional response to fungal infection. These findings reveal an unorthodox mode of regulation for a STAT factor and highlight the molecular plasticity of innate immune signaling.

Cell, 2003

global genome repair (GGR) and transcription-coupled repair (TCR). GGR repairs the DNA damage ove... more global genome repair (GGR) and transcription-coupled repair (TCR). GGR repairs the DNA damage over the entire genome, while TCR removes DNA lesions significantly faster from the transcribed strand of active genes than from the nontranscribed strand or the bulk of DNA 1 Dana-Farber Cancer Institute (Friedberg et al., 1995; Svejstrup, 2002). 2 Harvard Medical School Various types of NER-defects are found in individuals 3 Brigham and Women's Hospital with the inherited syndromes xeroderma pigmentosum Boston, Massachusetts 02115 (XP), Cockayne syndrome (CS), and trichothiodystrophy 4 Graduate School of Frontier Biosciences (TTD) (Bootsma et al., 1998). XP patients are sun sensi-Osaka University tive and generally show a greatly increased incidence 5 Core Research for Evolutional Science and of UV-induced skin cancers. Cell fusion studies have Technology (CREST) identified seven XP complementation groups (XP-A Japan Science and Technology Corporation through XP-G) and a variant form (XP-V). In general, Suita, Osaka 565-0871 patients with XP-A, -B, -D, -F, and -G are defective in Japan both TCR and GGR, while those with XP-C are defective only in GGR (Bootsma et al., 1998). XP-V defines patients with the clinical symptoms of XP, which shows normal Summary NER but defective trans-lesion DNA synthesis (Friedberg et al., 2002). Nucleotide excision repair (NER) is a major cellular XP-E cells are biochemically heterogeneous and defense against the carcinogenic effects of ultraviolet some, but not all, XP-E cell lines lack an activity that light from the sun. Mutational inactivation of NER probinds to damaged DNA (Friedberg et al., 1995; Bootsma teins, like DDB and CSA, leads to hereditary diseases et al., 1998). This activity is associated with a UV-damsuch as xeroderma pigmentosum (XP) and Cockayne aged DNA binding protein (DDB) composed of the DDB1 syndrome (CS). Here, we show that DDB2 and CSA (or p127) and DDB2 (or p48) subunits (Keeney et al., are each integrated into nearly identical complexes 1993). Mutations in the DDB2 gene, which encodes a via interaction with DDB1. Both complexes contain WD40 repeat-containing protein, have been found in cullin 4A and Roc1 and display ubiquitin ligase activity. XP-E cell lines that are lacking the damaged DNA bind-They also contain the COP9 signalosome (CSN), a ing activity. The absence of this activity has been linked known regulator of cullin-based ubiquitin ligases. to the deficiency in GGR of CPDs in these XP-E cells Strikingly, CSN differentially regulates ubiquitin ligase (Friedberg et al., 1995; Bootsma et al., 1998). Although activity of the DDB2 and CSA complexes in response the exact mechanisms whereby DDB contributes to NER to UV irradiation. Knockdown of CSN with RNA interare not clear, DDB has been shown to stimulate binding ference leads to defects in NER. These results suggest of XPA and replication protein A (RPA) to damaged DNA that the distinct UV response of the DDB2 and CSA (Wakasugi et al., 2001). This result suggests that DDB complexes is involved in diverse mechanisms of NER. stimulates NER by recruiting core NER factors to damaged DNA via interaction with XPA and RPA. Introduction Like XP patients, CS patients show hypersensitivity to sunlight but have no predisposition to skin cancer. Nucleotide excision repair (NER) acts on a wide variety However, CS patients show a distinctive array of severe of helix-distorting DNA lesions, including the cyclobudevelopmental and neurological abnormalities as well tane pyrimidine dimers (CPDs) and (6-4) pyrimidine-pyrias premature aging (Friedberg et al., 1995; Bootsma et midone photoproducts induced by UV light (Friedberg al., 1998). Classical CS is caused by mutations in either et al., 1995; Svejstrup, 2002). The core reaction of NER the CSA or CSB genes. CSA-and CSB-deficient cells involves removal of an approximately 27-30 nt oligonu-(CS-A and CS-B, respectively) are proficient in GGR but cleotide fragment containing the photoproduct. This exshow a defect in TCR. While mutations in the CSA and cision reaction occurs by positioned hydrolysis of the CSB genes account for over 90% of CS patients, mutaphosphodiester bonds at precise distances 5Ј and 3Ј to tions in the XPB, XPD, and XPG genes also underlie a the lesion, exclusively on the damaged DNA strand. small number of CS cases (XP-B/CS, XP-D/CS, and XP-G/ Once the damage-containing fragment is excised, the CS, respectively) (Friedberg et al., 1995; Bootsma et al., gap generated in the DNA duplex is repaired by DNA 1998). Of these gene products, CSB, XPB, XPD, and XPG appear to play a role in general transcription (reviewed in synthesis using the opposite, normal DNA strand as a Selby and Sancar, 1997; Lee et al., 2002), suggesting template (Friedberg et al., 1995; Svejstrup, 2002). It has that transcriptional defects are the underlying cause of been shown that NER can operate via two pathways: growth and developmental defects in CS. Moreover, CSB, XPB, XPD, and XPG appear to be involved in TCR *Correspondence: yoshihiro_nakatani@dfci.harvard.edu of oxidative lesions such as thymine glycol and 8-oxogu-6 These authors contributed equally to this work. anine. TCR of oxidative damage in a transcribed se-7 Present address: Cancer Research UK, Clare Hall Laboratories, South Mimms, Herts EN6 3LD, United Kingdom. quence has been shown to be defective in CS-B, XP-B/ Cell 358 independent DNA excision repair pathways in human cells. Mutat. Res. 274, 57-64. N-terminally FLAG-HA-epitope-tagged wild-type or mutant (D151N) CSN was stably expressed in HeLa cells and purified as described Cooper, P.K., Nouspikel, T., Clarkson, S.G., and Leadon, S.A. (1997). (Ikura et al., 2000; Ogawa et al., 2002). The substrates for NEDD8-Defective transcription-coupled repair of oxidative base damage and ubiquitin-deconjugating activities were prepared as follows. in Cockayne syndrome patients from XP group G. Science 275, NEDD8-Cul 4A-containing DDB2 complex was immunopurified from 990-993. the solubilized chromatin fraction of e-DDB2-expressing HeLa cells Cope, G.A., Suh, G.S., Aravind, L., Schwarz, S.E., Zipursky, S.L., 30 min after UV irradiation as described above. Ubiquitinated Cul4A Koonin, E.V., and Deshaies, R.J. (2002). Role of predicted metallowas obtained by in vitro ubiquitination of the partial DDB2 complex protease motif of Jab1/Csn5 in cleavage of NEDD8 from CUL1. lacking CSN as described above. After the ubiquitination reaction, Science 298, 608-611. the complex was purified by immunoprecipitation with M2 anti-Elsasser, S., Gali, R.R., Schwickart, M., Larsen, C.N., Leggett, D.S., Flag antibody-conjugated agarose and used as a substrate. These Muller, B., Feng, M.T., Tubing, F., Dittmar, G.A., and Finley, D. (2002). substrates were incubated with 50 ng of the wild-type and mutant Proteasome subunit Rpn1 binds ubiquitin-like protein domains. Nat. CSN in 10 l of CSK buffer (10 mM Pipes-KOH [pH 6.8], 100 mM Cell Biol. 4, 725-730. NaCl, 300 mM sucrose, and 3 mM MgCl 2 ) at 30ЊC for 30 min. After Friedberg, E.C., Walker, G.C., and Siede, W. (1995). DNA Repair and incubation, modification of Cul4A was analyzed by immunoblotting Mutagenesis (Washington, D.C.: American Society of Microbiology). with Cul4A antibody. Friedberg, E.C., Wagner, R., and Radman, M. (2002). Specialized CSN5 Knockdown DNA polymerases, cellular survival, and the genesis of mutations. The following siRNA precursors were expressed into BJ1 fibroblasts Science 296, 1627-1630. (BD Biosciences Clontech) via pSUPER.retro (Brummelkamp et al., Glickman, M.H., Rubin, D.M., Coux, O., Wefes, I., Pfeifer, G., Cjeka, 2002). These transcripts are predicted to be folded into a 19 bp Z., Baumeister, W., Fried, V.A., and Finley, D. (1998). A subcomplex stem-loop structure and processed to functional siRNA. Note that of the proteasome regulatory particle required for ubiquitin-conjuthe target 19 nt sequences are underlined. Transduced subpopulagate degradation and related to the COP9-signalosome and eIF3. tions were selected with 3 g/ml puromycin. CSN5 siRNA-1: 5ЈGCU Cell 94, 615-623. CAGAGUAUCGAUGAAAUUCAAGAGAUUUCAUCGAUACUCUGAG Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu. CUU 3Ј CSN5 siRNA-2: 5ЈCAUGCAGGAAGCUCAGAGUUUCAAGA Rev. Biochem. 67, 425-479. GAACUCUGAGCUUCCUGCAUGUU 3Ј. Ikura, T., Ogryzko, V.V., Grigoriev, M., Groisman, R., Wang, J., Horikoshi, M., Scully, R., Qin, J., and Nakatani, Y. (2000). Involvement Antibodies of the TIP60 histone acetylase complex in DNA repair and apoptosis. Antibody employed are as follows: anti-CSA (Santa Cruz Biotechnol-Cell 102, 463-473. ogy, Inc.), anti-CSN1 to CSN8 (Affiniti), anti-multiubiquitin (FK2) (MBL), anti-DDB1 and -DDB2 (

BMC Genomics, 2010

Background: Proteins may evolve through the recruitment and modification of discrete domains, and... more Background: Proteins may evolve through the recruitment and modification of discrete domains, and in many cases, protein action can be dissected at the domain level. PDZ domains are found in many important structural and signaling complexes, and are generally thought to interact with their protein partners through a C-terminal consensus sequence. We undertook a comprehensive search for protein partners of all individual PDZ domains in C. elegans to characterize their function and mode of interaction. Results: Coupling high-throughput yeast two-hybrid screens with extensive validation by co-affinity purification, we defined a domain-orientated interactome map. This integrates PDZ domain proteins in numerous cell-signaling pathways and shows that PDZ domain proteins are implicated in an unexpectedly wide range of cellular processes. Importantly, we uncovered a high frequency of non-canonical interactions, not involving the C-terminus of the protein partner, which were directly confirmed in most cases. We completed our study with the generation of a yeast array representing the entire set of PDZ domains from C. elegans and provide a proof-of-principle for its application to the discovery of PDZ domain targets for any protein or peptide of interest. Conclusions: We provide an extensive domain-centered dataset, together with a clone resource, that will help future functional study of PDZ domains. Through this unbiased approach, we revealed frequent non-canonical interactions between PDZ domains and their protein partners that will require a re-evaluation of this domain's molecular function.

Oncogene, 1999

The p16-cyclin D-pRB-E2F pathway is frequently deregulated in human tumors. This critical regulat... more The p16-cyclin D-pRB-E2F pathway is frequently deregulated in human tumors. This critical regulatory pathway controls the G1/S transition of the mammalian cell cycle by positive and negative regulation of E2Fresponsive genes required for DNA replication. To assess the value of the transcription factors E2Fs as targets for antiproliferative strategies, we have initiated a program aiming to develop inhibitors targeting speci®cally these proteins in vitro and in vivo. The cellular activity of E2F is the result of the heterodimeric association of two families of proteins, E2Fs and DPs, which then bind DNA. Here, we use a two hybrid approach to isolate from combinatorial libraries peptide aptamers that speci®cally interact with E2Fs DNA binding and dimerization domains. One of these is a potent inhibitor of E2F binding activity in vitro and in mammalian ®broblasts, blocks cells in G1, and the free variable region from this aptamer has the same eect. Our experiments argue that the variable region of this aptamer is structured, and that it functions by binding E2F with a motif that resembles a DP heterodimerization region, and blocking E2F's association with DP. These results show that cell proliferation can be inhibited using genetically-selected synthetic peptides that speci®cally target protein-protein interaction motifs within cell cycle regulators. These results also emphasize the critical role of the E2F pathway for cell proliferation and might allow the design of novel antiproliferative agents targeting the cyclin/CDK-pRB-E2F pathway.