Bayu Pranata - Academia.edu (original) (raw)

Papers by Bayu Pranata

Research paper thumbnail of Reef Fish Species Diversity Using Environmental DNA Metabarcoding in Mansinam and Lemon Island Waters, Manokwari Regency

Jurnal Perikanan Universitas Gadjah Mada

Biodiversity has an essential role in the stability of an ecosystem. A high level of biodiversity... more Biodiversity has an essential role in the stability of an ecosystem. A high level of biodiversity indicates a more stable and stable ecosystem. The decline in the quality of ecosystems such as coral reefs, seagrass beds, and mangrove forests due to anthropogenic factors and global warming threaten biodiversity. This study aims to determine the diversity of reef fish species using an environmental DNA (eDNA) approach in the waters of the Mansinam and Lemon, Manokwari Regency islands. The analysis results detected 158 individual fish comprising 26 species from 10 families (sequence identity 97-100%). The highest species abundance was found in the Pomacentridae Family. The Pomacentridae family is an ornamental fish species in coral reef ecosystems. In addition, several species from the families Serranidae, Caesionidae, Mullidae, Holocentridae, Balistidae, Scaridae, and Labridae were also detected; fish species from these families are catch targets for fishers with economic value. Asses...

Research paper thumbnail of Environmental DNA metabarcoding reveals biodiversity marine fish diversity of a small island at Manokwari District, West Papua, Indonesia

Biodiversitas Journal of Biological Diversity

The uniqueness of small island biodiversity becomes very important to study. Molecular approaches... more The uniqueness of small island biodiversity becomes very important to study. Molecular approaches to collecting biodiversity information are currently quite developed. Manokwari district, which is located at the head of Papua Island, Indonesia, has very diversity of marine resources, especially coral reef fish. Currently, we successfully identified marine fish in the coral reef fish ecosystem of Lemon and Mansinam Island. Environmental DNA on Lemon Island and Mansinam Island was successfully carried out. This small island area is located in Manokwari District, Papua, which has a high biodiversity potential, including fishery resources. The MiFish pipeline is used in this Metabarcoding approach by combining water samples from Lemon Island and Mansinam Island. We filtered 1 liter of marine water and pool together from fourteen sampling sites for genomic DNA extraction. A total of 101,001 reads (88.31%) were assigned to 34 species. From the environmental DNA metabarcoding analysis results, the Pomacentridae (8 species), which are reef fish, dominate in this area. Besides, Acanthuridae, Carangidae, and Lutjanidae were identified in this area, which as coral reef fish associates. The results of this environmental DNA also identified 2 species from the Family Scombridae, namely Gymnosarda unicolor and Thunnus obesus. This information is expected to support the sustainable management of the Lemon Island and Mansinam Island Areas for tourism and conservation activities.

Research paper thumbnail of Feasibility Study of Seaweed Cultivation Locations in the Waters of Menyumfoka Village and Kaki Island, Manokwari Regency

Jurnal Sumberdaya Akuatik Indopasifik, 2022

The feasibility study of the location of seaweed cultivation is very important to be carried out ... more The feasibility study of the location of seaweed cultivation is very important to be carried out in order to ensure the sustainability of the cultivation activities in question. Therefore, this study aims to examine the feasibility of the technical aspects of seaweed cultivation to support the development of seaweed cultivation in the coastal waters of Mengumfoka Village and Kaki Island, Manokwari Regency. The research method is the observation method with survey techniques (in situ and ex situ). The results showed that the two research sites had characteristics of the physical-chemical and biological conditions of the waters that could support seaweed cultivation activities. Location KA1 has a score of 86.2, which means the location is highly suitable, while location KA2 has a score of 75.4 or moderately suitable as a location for seaweed cultivation. In general, KA1 and KA2 locations have the same conditions, but KA2 locations are more open than KA1 locations, so that KA2 location...

Research paper thumbnail of Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene

Biodiversitas Journal of Biological Diversity

Epinephelus) fish have high economic value, and are relatively overfished, yet have not received ... more Epinephelus) fish have high economic value, and are relatively overfished, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).

Research paper thumbnail of Phylogeny of the spiny lobster Panulirus versicolor in Cenderawasih Bay, Papua, Indonesia

The aim of our study was to identify the genetic and phylogenetic characteristics of spiny lobste... more The aim of our study was to identify the genetic and phylogenetic characteristics of spiny lobster Panulirus versicolor in Cendrawasih Bay, Indonesia and their relationship with P. versicolor lobsters elsewhere in several Pacific and Indian Oceans domains based on the cytochrome oxidase I (COI) gene. We collected tissue samples from five P. versicolor individuals in Cenderawasih Bay. We detected that there were 5 haplotypes with a diversity value of haplotype (Hd) and nucletides (Pi) respectively Hd = 1.000 and nucleotides Pi = 0.00841. Our data show that some P. versicolor individuals from Cenderawasih Bay were closely related to P. versicolor lobsters in other regions of the Indian Ocean and the western Pacific Ocean. We observed the P. versicolor of Cenderawsih Bay form a monophyletic clade with P. versicolor in other part of the Indian Ocean and the western Pacific Ocean based on the reconstruction of phylogenetic trees. As well as the haplotype distribution showed no sample are...

Research paper thumbnail of Pemijahan Ikan Endemik Pelangi Arfak (Melanotaenia Arfakensis) Secara Alami

Proceedings Series on Physical & Formal Sciences

Arfak rainbowfish (Melanotaenia arfakensis) is one of the endemic fish of West Papua that can be ... more Arfak rainbowfish (Melanotaenia arfakensis) is one of the endemic fish of West Papua that can be found in river and lake systems in the Manokwari Regency. Currently, the status of the arfak rainbowfish is nearly extinct. Therefore, this study aimed to know the hatching rate and survival of arfak rainbowfish larvae that were naturally spawned. The results showed that the hatchability of arfak rainbowfish eggs reached 96.9% in A1 aquarium and 96.4% in A2 aquarium. The survival rate of arfak rainbowfish larvae in the A1 aquarium was 67.5%, while the A2 aquarium was 58.7%. The larval survival rate was relatively low. Therefore, further research is needed to increase the survival rate of arfak rainbowfish larvae.

Research paper thumbnail of Pembesaran Ikan Nila (Oreochromis niloticus) pada Budidaya Sistem Resirkulasi Menggunakan Filtrasi Tanaman Hydrilla verticillata dan Ceratophyllum demersum

JURNAL SUMBERDAYA AKUATIK INDOPASIFIK

Penelitian ini mengkombinasikan tanaman Hydrilla verticillata dengan Ceratophyllum demersum sebag... more Penelitian ini mengkombinasikan tanaman Hydrilla verticillata dengan Ceratophyllum demersum sebagai filter pada budidaya ikan Nila sistem resirkulasi. Tujuan penelitian yaitu untuk mengetahui tingkat pertumbuhan ikan Nila pada budidaya sistem resirkulasi. Filtrasi yang digunakan pada budidaya sistem resirkulasi yaitu tanaman H. verticillata dan C. demersum. Metode penelitian menggunakan rancangan acak lengkap (RAL). Adapun parameter yang diamati berupa kelangsungan hidup ikan, pertumbuhan mutlak, laju pertumbuhan spesifik (SGR), Feed Conversion Ratio (FCR) dan kualitas air. Kelangsungan hidup ikan selamat pemeliharaan yaitu 100%. Pertumbuhan bobot mutlak individu berkisar 8.76 sampai 16.6 gr/minggu. Laju pertumbuhan spesifik ikan Nila berkisar 2.74 sampai 4.49%. Nilai FCR sangat bagus yaitu 1.2 dan rata-rata nilai suhu, pH dan DO masih pada kisaran yang layak untuk pertumbuhan ikan Nila. Selama pemeliharaan hanya dilakukan satu kali pergantian air. Budidaya sistem resirkulasi terseb...

Research paper thumbnail of GENETIC OF Panulirus versicolor LOBSTER IN CENDRAWASIH BAY PAPUA AND LOMBOK WATERS WEST NUSA TENGGARA

JURNAL ENGGANO

The purpose of this study was to determine the level of diversity and genetic relationship of Pan... more The purpose of this study was to determine the level of diversity and genetic relationship of Panulirus versicolor lobsters in Cenderawasih Bay and Lombok waters based on the cytochrome oxidase I (COI) gene. The results showed the level of genetic diversity of the two populations was very high and generally did not differ greatly between populations. We identified 6 haplotypes for P. versicolor lobster populations from Cenderawasih Bay and 7 haplotypes for P. versicolor lobster populations from Lombok waters. Network analysis shows that several P. versicolor lobster individuals from the Cendeawasih Bay and Lombok waters had similar haplotypes. The population of Cenderawasih Bay with Lombok waters was closely related to the average genetic distance value P-distance 0.005 (s.d 0.001) and the results of phylogenetic tree reconstruction showed that the two populations of P. versicolor lobsters form a monophyletic clade (close relatives).

Research paper thumbnail of Characteristics of whale sharks (Rhincodon typus) in Teluk Cenderawasih National Park, Indonesia

The 4th International Whale Shark Conference

Research paper thumbnail of Photo ID-based assessment of the whale shark (Rhincodon typus) population in Kwatisore, Wondama Bay, West Papua, Indonesia

The 4th International Whale Shark Conference

Research paper thumbnail of Aspek Biologi dan Pemetaan Daerah Penangkapan Lobster (Panulirus spp) di Perairan Kampung Akudiomi Distrik Yaur Kabupaten Nabire

JURNAL SUMBERDAYA AKUATIK INDOPASIFIK

Penelitian ini dilakukan pada bulan Maret sampai April 2014 di kampung Akudiomi yang dikenal seba... more Penelitian ini dilakukan pada bulan Maret sampai April 2014 di kampung Akudiomi yang dikenal sebagai perairan Kwatisore Kabupaten Nabire Provinsi Papua. Tujuan dari penelitian ini, untuk mengetahui komposisi jenis, mengukur panjang-berat, meng-iventarisasi nelayan lokal dan memetakan daerah penangkapan lobster. Metode yang digunakan adalah metode deskriptif dengan teknik observasi, pengambilan sampling dan wawancara. Pemetaan dan identifikasi hubungan parameter oseanografi perairan (suhu, salinitas, kedalaman dan pH) di daerah penangkapan lobster untuk mengetahui pengaruhnya terhadap ketersediaan sumberdaya lobster. Hasil identifikasi diperoleh 3 jenis lobster yang tertangkap oleh nelayan di perairan kampung Akudiomi yaitu P. versicolor berjumlah 111 ekor, P. longipes dan Thenus spp masing-masing berjumlah 1 ekor. Pendugaan pola pertumbuhan lobster dilakukan hanya pada P. versicolor yang merupakan spesies dominan tertangkap oleh nelayan. Panjang karapas P. versicolor berkisar 8-13 c...

Research paper thumbnail of Reef Fish Species Diversity Using Environmental DNA Metabarcoding in Mansinam and Lemon Island Waters, Manokwari Regency

Jurnal Perikanan Universitas Gadjah Mada

Biodiversity has an essential role in the stability of an ecosystem. A high level of biodiversity... more Biodiversity has an essential role in the stability of an ecosystem. A high level of biodiversity indicates a more stable and stable ecosystem. The decline in the quality of ecosystems such as coral reefs, seagrass beds, and mangrove forests due to anthropogenic factors and global warming threaten biodiversity. This study aims to determine the diversity of reef fish species using an environmental DNA (eDNA) approach in the waters of the Mansinam and Lemon, Manokwari Regency islands. The analysis results detected 158 individual fish comprising 26 species from 10 families (sequence identity 97-100%). The highest species abundance was found in the Pomacentridae Family. The Pomacentridae family is an ornamental fish species in coral reef ecosystems. In addition, several species from the families Serranidae, Caesionidae, Mullidae, Holocentridae, Balistidae, Scaridae, and Labridae were also detected; fish species from these families are catch targets for fishers with economic value. Asses...

Research paper thumbnail of Environmental DNA metabarcoding reveals biodiversity marine fish diversity of a small island at Manokwari District, West Papua, Indonesia

Biodiversitas Journal of Biological Diversity

The uniqueness of small island biodiversity becomes very important to study. Molecular approaches... more The uniqueness of small island biodiversity becomes very important to study. Molecular approaches to collecting biodiversity information are currently quite developed. Manokwari district, which is located at the head of Papua Island, Indonesia, has very diversity of marine resources, especially coral reef fish. Currently, we successfully identified marine fish in the coral reef fish ecosystem of Lemon and Mansinam Island. Environmental DNA on Lemon Island and Mansinam Island was successfully carried out. This small island area is located in Manokwari District, Papua, which has a high biodiversity potential, including fishery resources. The MiFish pipeline is used in this Metabarcoding approach by combining water samples from Lemon Island and Mansinam Island. We filtered 1 liter of marine water and pool together from fourteen sampling sites for genomic DNA extraction. A total of 101,001 reads (88.31%) were assigned to 34 species. From the environmental DNA metabarcoding analysis results, the Pomacentridae (8 species), which are reef fish, dominate in this area. Besides, Acanthuridae, Carangidae, and Lutjanidae were identified in this area, which as coral reef fish associates. The results of this environmental DNA also identified 2 species from the Family Scombridae, namely Gymnosarda unicolor and Thunnus obesus. This information is expected to support the sustainable management of the Lemon Island and Mansinam Island Areas for tourism and conservation activities.

Research paper thumbnail of Feasibility Study of Seaweed Cultivation Locations in the Waters of Menyumfoka Village and Kaki Island, Manokwari Regency

Jurnal Sumberdaya Akuatik Indopasifik, 2022

The feasibility study of the location of seaweed cultivation is very important to be carried out ... more The feasibility study of the location of seaweed cultivation is very important to be carried out in order to ensure the sustainability of the cultivation activities in question. Therefore, this study aims to examine the feasibility of the technical aspects of seaweed cultivation to support the development of seaweed cultivation in the coastal waters of Mengumfoka Village and Kaki Island, Manokwari Regency. The research method is the observation method with survey techniques (in situ and ex situ). The results showed that the two research sites had characteristics of the physical-chemical and biological conditions of the waters that could support seaweed cultivation activities. Location KA1 has a score of 86.2, which means the location is highly suitable, while location KA2 has a score of 75.4 or moderately suitable as a location for seaweed cultivation. In general, KA1 and KA2 locations have the same conditions, but KA2 locations are more open than KA1 locations, so that KA2 location...

Research paper thumbnail of Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene

Biodiversitas Journal of Biological Diversity

Epinephelus) fish have high economic value, and are relatively overfished, yet have not received ... more Epinephelus) fish have high economic value, and are relatively overfished, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).

Research paper thumbnail of Phylogeny of the spiny lobster Panulirus versicolor in Cenderawasih Bay, Papua, Indonesia

The aim of our study was to identify the genetic and phylogenetic characteristics of spiny lobste... more The aim of our study was to identify the genetic and phylogenetic characteristics of spiny lobster Panulirus versicolor in Cendrawasih Bay, Indonesia and their relationship with P. versicolor lobsters elsewhere in several Pacific and Indian Oceans domains based on the cytochrome oxidase I (COI) gene. We collected tissue samples from five P. versicolor individuals in Cenderawasih Bay. We detected that there were 5 haplotypes with a diversity value of haplotype (Hd) and nucletides (Pi) respectively Hd = 1.000 and nucleotides Pi = 0.00841. Our data show that some P. versicolor individuals from Cenderawasih Bay were closely related to P. versicolor lobsters in other regions of the Indian Ocean and the western Pacific Ocean. We observed the P. versicolor of Cenderawsih Bay form a monophyletic clade with P. versicolor in other part of the Indian Ocean and the western Pacific Ocean based on the reconstruction of phylogenetic trees. As well as the haplotype distribution showed no sample are...

Research paper thumbnail of Pemijahan Ikan Endemik Pelangi Arfak (Melanotaenia Arfakensis) Secara Alami

Proceedings Series on Physical & Formal Sciences

Arfak rainbowfish (Melanotaenia arfakensis) is one of the endemic fish of West Papua that can be ... more Arfak rainbowfish (Melanotaenia arfakensis) is one of the endemic fish of West Papua that can be found in river and lake systems in the Manokwari Regency. Currently, the status of the arfak rainbowfish is nearly extinct. Therefore, this study aimed to know the hatching rate and survival of arfak rainbowfish larvae that were naturally spawned. The results showed that the hatchability of arfak rainbowfish eggs reached 96.9% in A1 aquarium and 96.4% in A2 aquarium. The survival rate of arfak rainbowfish larvae in the A1 aquarium was 67.5%, while the A2 aquarium was 58.7%. The larval survival rate was relatively low. Therefore, further research is needed to increase the survival rate of arfak rainbowfish larvae.

Research paper thumbnail of Pembesaran Ikan Nila (Oreochromis niloticus) pada Budidaya Sistem Resirkulasi Menggunakan Filtrasi Tanaman Hydrilla verticillata dan Ceratophyllum demersum

JURNAL SUMBERDAYA AKUATIK INDOPASIFIK

Penelitian ini mengkombinasikan tanaman Hydrilla verticillata dengan Ceratophyllum demersum sebag... more Penelitian ini mengkombinasikan tanaman Hydrilla verticillata dengan Ceratophyllum demersum sebagai filter pada budidaya ikan Nila sistem resirkulasi. Tujuan penelitian yaitu untuk mengetahui tingkat pertumbuhan ikan Nila pada budidaya sistem resirkulasi. Filtrasi yang digunakan pada budidaya sistem resirkulasi yaitu tanaman H. verticillata dan C. demersum. Metode penelitian menggunakan rancangan acak lengkap (RAL). Adapun parameter yang diamati berupa kelangsungan hidup ikan, pertumbuhan mutlak, laju pertumbuhan spesifik (SGR), Feed Conversion Ratio (FCR) dan kualitas air. Kelangsungan hidup ikan selamat pemeliharaan yaitu 100%. Pertumbuhan bobot mutlak individu berkisar 8.76 sampai 16.6 gr/minggu. Laju pertumbuhan spesifik ikan Nila berkisar 2.74 sampai 4.49%. Nilai FCR sangat bagus yaitu 1.2 dan rata-rata nilai suhu, pH dan DO masih pada kisaran yang layak untuk pertumbuhan ikan Nila. Selama pemeliharaan hanya dilakukan satu kali pergantian air. Budidaya sistem resirkulasi terseb...

Research paper thumbnail of GENETIC OF Panulirus versicolor LOBSTER IN CENDRAWASIH BAY PAPUA AND LOMBOK WATERS WEST NUSA TENGGARA

JURNAL ENGGANO

The purpose of this study was to determine the level of diversity and genetic relationship of Pan... more The purpose of this study was to determine the level of diversity and genetic relationship of Panulirus versicolor lobsters in Cenderawasih Bay and Lombok waters based on the cytochrome oxidase I (COI) gene. The results showed the level of genetic diversity of the two populations was very high and generally did not differ greatly between populations. We identified 6 haplotypes for P. versicolor lobster populations from Cenderawasih Bay and 7 haplotypes for P. versicolor lobster populations from Lombok waters. Network analysis shows that several P. versicolor lobster individuals from the Cendeawasih Bay and Lombok waters had similar haplotypes. The population of Cenderawasih Bay with Lombok waters was closely related to the average genetic distance value P-distance 0.005 (s.d 0.001) and the results of phylogenetic tree reconstruction showed that the two populations of P. versicolor lobsters form a monophyletic clade (close relatives).

Research paper thumbnail of Characteristics of whale sharks (Rhincodon typus) in Teluk Cenderawasih National Park, Indonesia

The 4th International Whale Shark Conference

Research paper thumbnail of Photo ID-based assessment of the whale shark (Rhincodon typus) population in Kwatisore, Wondama Bay, West Papua, Indonesia

The 4th International Whale Shark Conference

Research paper thumbnail of Aspek Biologi dan Pemetaan Daerah Penangkapan Lobster (Panulirus spp) di Perairan Kampung Akudiomi Distrik Yaur Kabupaten Nabire

JURNAL SUMBERDAYA AKUATIK INDOPASIFIK

Penelitian ini dilakukan pada bulan Maret sampai April 2014 di kampung Akudiomi yang dikenal seba... more Penelitian ini dilakukan pada bulan Maret sampai April 2014 di kampung Akudiomi yang dikenal sebagai perairan Kwatisore Kabupaten Nabire Provinsi Papua. Tujuan dari penelitian ini, untuk mengetahui komposisi jenis, mengukur panjang-berat, meng-iventarisasi nelayan lokal dan memetakan daerah penangkapan lobster. Metode yang digunakan adalah metode deskriptif dengan teknik observasi, pengambilan sampling dan wawancara. Pemetaan dan identifikasi hubungan parameter oseanografi perairan (suhu, salinitas, kedalaman dan pH) di daerah penangkapan lobster untuk mengetahui pengaruhnya terhadap ketersediaan sumberdaya lobster. Hasil identifikasi diperoleh 3 jenis lobster yang tertangkap oleh nelayan di perairan kampung Akudiomi yaitu P. versicolor berjumlah 111 ekor, P. longipes dan Thenus spp masing-masing berjumlah 1 ekor. Pendugaan pola pertumbuhan lobster dilakukan hanya pada P. versicolor yang merupakan spesies dominan tertangkap oleh nelayan. Panjang karapas P. versicolor berkisar 8-13 c...