Dadih Supriadi - Academia.edu (original) (raw)
Papers by Dadih Supriadi
Background: Black cumin (Nigella sativa L.) is one of the herbal plants from the Ranunculaceae fa... more Background: Black cumin (Nigella sativa L.) is one of the herbal plants from the Ranunculaceae family and has many properties to treat various chronic diseases. Black cumin seed essential oil is known to have pharmacological activities such as antimicrobial, antifungal, antiviral, anticancer, anti-inflammatory, immunomodulatory, anthelmintic, antidiabetic, antidepressant, antifertility, antioxidant, anti-aging, analgesic, hepatoprotector, cardioprotector, neuroprotector and others. In this review article, reviews of the effectiveness and stability of the nanoemulsion formulation of black cumin seed (Nigella sativa L.) essential oil will be discussed from several research journals. The purpose of this review article is to obtain information about the effectiveness and stability of several formulations of essential oil nanoemulsion preparations from black cumin seeds (Nigella sativa L.). Methods: The literature used is obtained from several scientific journals that have been published at the international and national level through search engines in the form of Scopus, ScienceDirect, Google Scholar, DOAJ, Elsivier, Garuda Portal and Pubmed. Results: Nano-delivery system in the formulation of the black cumin seed (Nigella sativa L.) essential oil nanoemulsion as a whole shows that there is an increase in the stability of the preparation and the effectiveness of the active substance. This increased stability was initiated by the addition of the nanoemulsion carrier and the surfactant used. Conclusion: Nanoemulsions containing black cumin seed essential oil have been shown to increase drug solubility, increase drug bioavailability, stability and effectiveness of drug preparations.
International Journal of Applied Pharmaceutics
Objective: Calcium carbonate is widely used in the pharmaceutical field as excipients and therape... more Objective: Calcium carbonate is widely used in the pharmaceutical field as excipients and therapeutic agents. Calcium carbonate can be obtained from limestone, chalk, marble and dolomite. Other alternative is from eggshell. Calcium carbonate source from eggshell has several advantages including higher calcium carbonate content, fewer contaminants metal limit, and more brittle. Therefore, in this study, calcium carbonate had been isolated from eggshells which was expected to meet the requirements of Indonesian Pharmacopoeia (sixth edition) and having activity as antacid. Methods: Calcium carbonate were isolated from eggshells by mechanically and physically organic separation. The quality of calcium carbonate was examined according to the Indonesian Pharmacopoeia parameters including loss on drying; acid-insoluble substance, magnesium and alkali salt; limit of arsenic, lead, iron, mercury, heavy metal, and barium. Additional physicochemical characterization of calcium carbonate includ...
INDONESIA NATURAL RESEARCH PHARMACEUTICAL JOURNAL, 2021
Pati banyak digunakan dalam formulasi Fast Disintegratating Tablet (FDT) sebagai superdisintegran... more Pati banyak digunakan dalam formulasi Fast Disintegratating Tablet (FDT) sebagai superdisintegran karena biodegradabilitas dan biokompatibilitasnya, namun beberapa kekurangannya seperti kompresibilitas, sifat alir dan daya serap terhadap air yang rendah dapat membatasi aplikasinya seperti mempengaruhi keseragaman bobot, kesulitan dalam mengempa tablet dan waktu hancur tablet lebih lama. Berbagai modifikasi pati baik secara fisika, kimia, enzimatis maupun kombinasi dilakukan untuk meningkatkan efektivitas penggunaan pati. Tujuan review jurnal ini untuk memberikan informasi mengenai pengaruh perlakuan pada pati dari berbagai sumber sebagai superdisitegran terhadap waktu hancur FDT. Review jurnal ini dilakukan dengan metode literatur review. Pengumpulan data dilakukan melalui elektronik database PubMed dan Google cendekia. Pati hasil modifikasi memiliki permukaan granula pati lebih berpori berdasarkan hasil SEM dibandingkan pati alami. FDT menggunakan superdisintegran pati hasil modifi...
Indonesian Journal of Pharmaceutical Science and Technology, 2015
Basil is one of medicinal plants in Indonesia that has been used empirically as antimicrobes, ana... more Basil is one of medicinal plants in Indonesia that has been used empirically as antimicrobes, analgetic, antiinflammatory, antivirus, antitumor, and antioxidants that prevented ischemia. This research aimed to investigate the effect of adding granule ethanol extract of basil leaves (Ocimum americanum) as antioxidant to capture free radicals in fried foods. The antioxidant activity of ethanol extract of basil leaves with DPPH determinated by IC 50 , comparing the antioxidant activity of the granule and the control by determination of quality properties of oil and food after frying using Fourier Transfor Infra Red (FTIR) spectra, and quantitative parameters by determination percentage of free fatty acid (FFA). Results of maceration with ethanol 15.94% w/w, total ash content 9.85%, water soluble ash content 3.98%, acid insoluble ash content 3.98%, water soluble extract 25.89%, ethanol soluble extract 12.76%, water content 6.87%, drying shrinkage 11.19%. Testing the antioxidant activity of the ethanol extract of basil leaves with DPPH gave IC 50 of 80.55 ppm. The result of antioxidant testing by determination percentage of FFA statistically with ANOVA (significance 0.00<5) and comparison of the concentration extract in basil granule with LSD test significantly different. The result indicates that adding ethanol extract of granules basil on fried foods gave antioxidant activity because it can inhibit the increasing of FFA percentage.
ABSTRAK Minuman probiotik adalah minuman fermentasi yang mengandung bakteri asam laktat (BAL) hid... more ABSTRAK Minuman probiotik adalah minuman fermentasi yang mengandung bakteri asam laktat (BAL) hidup dan bermanfaat bagi kesehatan sebagai sumber elektrolit, penawar racun, antioksidan, dan antibakteri. Pola hidup masyarakat Indonesia yang cenderung mengkonsumsi makanan tinggi lemak dan rendah serat menyebabkan munculnya berbagai masalah pencernaan. Minuman probiotik merupakan salah satu alternatif untuk menjaga kesehatan saluran cerna. Dari beberapa penelitian sebelumnya telah diketahui bahwa kandungan fenol dari air kelapa memiliki aktivitas antibakteri, antijamur, dan antioksidan. Pada penelitian ini akan dilakukan proses fermentasi air kelapa menggunakan BAL. Proses tersebut diharapkan dapat meningkatkan aktivitas air kelapa sebagai minuman probiotik yang memenuhi Standar Nasional Indonesia (SNI). Metode penelitian meliputi penyiapan starter bakteri, penyiapan media air kelapa, fermentasi, formulasi, dan evaluasi. Starter yang digunakan dalam penelitian ini adalah kultur Lactobac...
Jurnal Sains Farmasi & Klinis
Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengk... more Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 1...
Indian Journal of Pharmaceutical and Biological Research
Infectious diseases are caused by bacteria and fungi in developing countries are still high. One ... more Infectious diseases are caused by bacteria and fungi in developing countries are still high. One of the microorganisms that cause infections are Escherichia coli. E. coli can lead to infection of the digestive tract. Improper use of antibiotics can lead to resistance. This can be minimized by making use of traditional medicine. One of the traditional medicine that the mangosteen fruit. Secondary metabolites can be isolated by utilizing endophytic bacteria. Endophytic bacteria are bacteria that live inside plant tissues and capable of producing the active compounds which are antibiotics, antimalarial and antifungal. The methodology carried out: preparation of materials and determination, isolation of endophytic bacteria, screening endophytic bacteria producing antibacterial, morphological and biochemical identification, endophytic bacteria fermentation, the manufacture of standard curve, the compound fermented inspection (inspection: phenols, saponins, flavonoids, alkaloids and terpe...
Background: Black cumin (Nigella sativa L.) is one of the herbal plants from the Ranunculaceae fa... more Background: Black cumin (Nigella sativa L.) is one of the herbal plants from the Ranunculaceae family and has many properties to treat various chronic diseases. Black cumin seed essential oil is known to have pharmacological activities such as antimicrobial, antifungal, antiviral, anticancer, anti-inflammatory, immunomodulatory, anthelmintic, antidiabetic, antidepressant, antifertility, antioxidant, anti-aging, analgesic, hepatoprotector, cardioprotector, neuroprotector and others. In this review article, reviews of the effectiveness and stability of the nanoemulsion formulation of black cumin seed (Nigella sativa L.) essential oil will be discussed from several research journals. The purpose of this review article is to obtain information about the effectiveness and stability of several formulations of essential oil nanoemulsion preparations from black cumin seeds (Nigella sativa L.). Methods: The literature used is obtained from several scientific journals that have been published at the international and national level through search engines in the form of Scopus, ScienceDirect, Google Scholar, DOAJ, Elsivier, Garuda Portal and Pubmed. Results: Nano-delivery system in the formulation of the black cumin seed (Nigella sativa L.) essential oil nanoemulsion as a whole shows that there is an increase in the stability of the preparation and the effectiveness of the active substance. This increased stability was initiated by the addition of the nanoemulsion carrier and the surfactant used. Conclusion: Nanoemulsions containing black cumin seed essential oil have been shown to increase drug solubility, increase drug bioavailability, stability and effectiveness of drug preparations.
International Journal of Applied Pharmaceutics
Objective: Calcium carbonate is widely used in the pharmaceutical field as excipients and therape... more Objective: Calcium carbonate is widely used in the pharmaceutical field as excipients and therapeutic agents. Calcium carbonate can be obtained from limestone, chalk, marble and dolomite. Other alternative is from eggshell. Calcium carbonate source from eggshell has several advantages including higher calcium carbonate content, fewer contaminants metal limit, and more brittle. Therefore, in this study, calcium carbonate had been isolated from eggshells which was expected to meet the requirements of Indonesian Pharmacopoeia (sixth edition) and having activity as antacid. Methods: Calcium carbonate were isolated from eggshells by mechanically and physically organic separation. The quality of calcium carbonate was examined according to the Indonesian Pharmacopoeia parameters including loss on drying; acid-insoluble substance, magnesium and alkali salt; limit of arsenic, lead, iron, mercury, heavy metal, and barium. Additional physicochemical characterization of calcium carbonate includ...
INDONESIA NATURAL RESEARCH PHARMACEUTICAL JOURNAL, 2021
Pati banyak digunakan dalam formulasi Fast Disintegratating Tablet (FDT) sebagai superdisintegran... more Pati banyak digunakan dalam formulasi Fast Disintegratating Tablet (FDT) sebagai superdisintegran karena biodegradabilitas dan biokompatibilitasnya, namun beberapa kekurangannya seperti kompresibilitas, sifat alir dan daya serap terhadap air yang rendah dapat membatasi aplikasinya seperti mempengaruhi keseragaman bobot, kesulitan dalam mengempa tablet dan waktu hancur tablet lebih lama. Berbagai modifikasi pati baik secara fisika, kimia, enzimatis maupun kombinasi dilakukan untuk meningkatkan efektivitas penggunaan pati. Tujuan review jurnal ini untuk memberikan informasi mengenai pengaruh perlakuan pada pati dari berbagai sumber sebagai superdisitegran terhadap waktu hancur FDT. Review jurnal ini dilakukan dengan metode literatur review. Pengumpulan data dilakukan melalui elektronik database PubMed dan Google cendekia. Pati hasil modifikasi memiliki permukaan granula pati lebih berpori berdasarkan hasil SEM dibandingkan pati alami. FDT menggunakan superdisintegran pati hasil modifi...
Indonesian Journal of Pharmaceutical Science and Technology, 2015
Basil is one of medicinal plants in Indonesia that has been used empirically as antimicrobes, ana... more Basil is one of medicinal plants in Indonesia that has been used empirically as antimicrobes, analgetic, antiinflammatory, antivirus, antitumor, and antioxidants that prevented ischemia. This research aimed to investigate the effect of adding granule ethanol extract of basil leaves (Ocimum americanum) as antioxidant to capture free radicals in fried foods. The antioxidant activity of ethanol extract of basil leaves with DPPH determinated by IC 50 , comparing the antioxidant activity of the granule and the control by determination of quality properties of oil and food after frying using Fourier Transfor Infra Red (FTIR) spectra, and quantitative parameters by determination percentage of free fatty acid (FFA). Results of maceration with ethanol 15.94% w/w, total ash content 9.85%, water soluble ash content 3.98%, acid insoluble ash content 3.98%, water soluble extract 25.89%, ethanol soluble extract 12.76%, water content 6.87%, drying shrinkage 11.19%. Testing the antioxidant activity of the ethanol extract of basil leaves with DPPH gave IC 50 of 80.55 ppm. The result of antioxidant testing by determination percentage of FFA statistically with ANOVA (significance 0.00<5) and comparison of the concentration extract in basil granule with LSD test significantly different. The result indicates that adding ethanol extract of granules basil on fried foods gave antioxidant activity because it can inhibit the increasing of FFA percentage.
ABSTRAK Minuman probiotik adalah minuman fermentasi yang mengandung bakteri asam laktat (BAL) hid... more ABSTRAK Minuman probiotik adalah minuman fermentasi yang mengandung bakteri asam laktat (BAL) hidup dan bermanfaat bagi kesehatan sebagai sumber elektrolit, penawar racun, antioksidan, dan antibakteri. Pola hidup masyarakat Indonesia yang cenderung mengkonsumsi makanan tinggi lemak dan rendah serat menyebabkan munculnya berbagai masalah pencernaan. Minuman probiotik merupakan salah satu alternatif untuk menjaga kesehatan saluran cerna. Dari beberapa penelitian sebelumnya telah diketahui bahwa kandungan fenol dari air kelapa memiliki aktivitas antibakteri, antijamur, dan antioksidan. Pada penelitian ini akan dilakukan proses fermentasi air kelapa menggunakan BAL. Proses tersebut diharapkan dapat meningkatkan aktivitas air kelapa sebagai minuman probiotik yang memenuhi Standar Nasional Indonesia (SNI). Metode penelitian meliputi penyiapan starter bakteri, penyiapan media air kelapa, fermentasi, formulasi, dan evaluasi. Starter yang digunakan dalam penelitian ini adalah kultur Lactobac...
Jurnal Sains Farmasi & Klinis
Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengk... more Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 1...
Indian Journal of Pharmaceutical and Biological Research
Infectious diseases are caused by bacteria and fungi in developing countries are still high. One ... more Infectious diseases are caused by bacteria and fungi in developing countries are still high. One of the microorganisms that cause infections are Escherichia coli. E. coli can lead to infection of the digestive tract. Improper use of antibiotics can lead to resistance. This can be minimized by making use of traditional medicine. One of the traditional medicine that the mangosteen fruit. Secondary metabolites can be isolated by utilizing endophytic bacteria. Endophytic bacteria are bacteria that live inside plant tissues and capable of producing the active compounds which are antibiotics, antimalarial and antifungal. The methodology carried out: preparation of materials and determination, isolation of endophytic bacteria, screening endophytic bacteria producing antibacterial, morphological and biochemical identification, endophytic bacteria fermentation, the manufacture of standard curve, the compound fermented inspection (inspection: phenols, saponins, flavonoids, alkaloids and terpe...