Takafumi Yokota - Academia.edu (original) (raw)

Papers by Takafumi Yokota

European Journal of Immunology, Mar 16, 2015

Mammals have evolved to protect their offspring during early fetal development. Elaborated mechan... more Mammals have evolved to protect their offspring during early fetal development. Elaborated mechanisms induce tolerance in the maternal immune system for the fetus. Female hormones, mainly estrogen, play a role in suppressing maternal lymphopoiesis. However, the molecular mechanisms involved in the maternal immune tolerance are largely unknown. Here, we show that estrogen-induced soluble Frizzled-related proteins (sFRPs), and particularly sFRP5, suppress B-lymphopoiesis in vivo in transgenic mice. Mice overexpressing sFRP5 had fewer B-lymphocytes in the peripheral blood and spleen. High levels of sFRP5 inhibited early B-cell differentiation in the bone marrow (BM), resulting in the accumulation of cells with a common lymphoid progenitor (CLP) phenotype. Conversely, sFRP5 deficiency reduced the number of hematopoietic stem cells (HSCs) and primitive lymphoid progenitors in the BM, particularly when estrogen was administered. Furthermore, a significant reduction in CLPs and B-lineage-committed progenitors was observed in the BM of sfrp5-null pregnant females. We concluded that, although high sFRP5 expression inhibits B-lymphopoiesis in vivo, physiologically, it contributes to the preservation of very primitive lymphopoietic progenitors, including HSCs, under high estrogen levels. Thus, sFRP5 regulates early lympho-hematopoiesis in the maternal BM, but the maternal-fetal immune tolerance still involves other molecular mechanisms which remain to be uncovered.

British Journal of Haematology, Dec 1, 1998

Very late antigen (VLA)-4 integrin has been suggested to play an important role in haemopoiesis. ... more Very late antigen (VLA)-4 integrin has been suggested to play an important role in haemopoiesis. However, little is known concerning the roles of the fibronectin (FN)/VLA-4 interaction in the proliferation of human B cells. In this study we investigated the effect of immobilized FN on the proliferation of various B-cell lines, including a newly-established B-cell line, OPM-3, and human tonsillar B cells, that primarily express VLA-4 but not VLA-5. Immobilized FN significantly promoted the proliferation of OPM-3 cells and normal B cells via VLA-4. The cross-linking of beta1 integrins of OPM-3 cells resulted in the phosphorylation of the focal adhesion kinase (FAK) associated 90 kD protein, an increase in FAK-associated kinase activity, and the phosphorylation of Raf-1. Furthermore, the MEK1 inhibitor, PD98059, inhibited the FN-promoted proliferation of OPM-3 cells. These results demonstrate that the FN/VLA-4 interaction transmits the growth signal(s) which may be mediated by Ras pathway in OPM-3 cells, and suggest that OPM-3 cells may be of great value in studying the roles of the FN/VLA-4 interaction in human B-cell growth.

Biochemical and Biophysical Research Communications, 2018

Information of myeloid lineage-related antigen on hematopoietic stem/progenitor cells (HSPCs) is ... more Information of myeloid lineage-related antigen on hematopoietic stem/progenitor cells (HSPCs) is important to clarify the mechanisms regulating hematopoiesis, as well as for the diagnosis and treatment of myeloid malignancies. We previously reported that special AT-rich sequence binding protein 1 (SATB1), a global chromatin organizer, promotes lymphoid differentiation from HSPCs. To search a novel cell surface molecule discriminating early myeloid and lymphoid differentiation, we performed microarray analyses comparing SATB1-overexpressed HSPCs with mock-transduced HSPCs. The results drew our attention to membrane-spanning 4-domains, subfamily A, member 3 (Ms4a3) as the most downregulated molecule in HSPCs with forced overexpression of SATB1. Ms4a3 expression was undetectable in hematopoietic stem cells, but showed a concomitant increase with progressive myeloid differentiation, whereas not only lymphoid but also megakaryocytic-erythrocytic progenitors were entirely devoid of Ms4a3 expression. Further analysis revealed that a subset of CD34 þ CD38 þ CD33 þ progenitor population in human adult bone marrow expressed MS4A3, and those MS4A3 þ progenitors only produced granulocyte/macrophage colonies, losing erythroid colony-and mixed colony-forming capacity. These results suggest that cell surface expression of MS4A3 is useful to distinguish granulocyte/macrophage lineagecommitted progenitors from other lineage-related ones in early human hematopoiesis. In conclusion, MS4A3 is useful to monitor early stage of myeloid differentiation in human hematopoiesis.

Blood, Nov 1, 2004

Several characteristics of the immunoglobulin (Ig) repertoire in fetuses and adults set them apar... more Several characteristics of the immunoglobulin (Ig) repertoire in fetuses and adults set them apart from each other. Functionally, this translates into differences in the affinity and effectiveness of the humoral immune response between adults and the very young. At least 2 possibilities could explain these differences: (1) fetal and adult lymphocyte progenitors differ significantly in their potential to form a diverse repertoire, and (2) factors extrinsic to the immunoglobulin locus are more influential to the character of the repertoire. To address this we used nonobese diabetic-severe combined immunodeficient-␤ 2 microglobulin knockout (NOD/SCID/␤ 2 m ؊/؊) mice reconstituted with human B-cell progenitors to compare the immunoglobulin repertoire potential of human fetal, cord blood, and adult sources. We found nearly identical VH and JH gene segment use and only modest differences in the third complementarity determining region of the immunoglobulin heavy chain (HCDR3). We conclude that the repertoire potential is remarkably similar regardless of the age of the individual from which progenitors are derived. Age-related differences in the immunoglobulin repertoire and variance of B-cell responses to immunization appear to arise from selection rather than from changes in recombination of the immunoglobulin locus itself. From the standpoint of the Ig repertoire, an immune system reconstituted from fetal or neonatal stem cells would likely be as diverse as one generated from adult bone marrow.

Seminars in Immunology, Dec 1, 2002

Advances in cell sorting and GFP knock-in technology have made it possible to identify rare hemat... more Advances in cell sorting and GFP knock-in technology have made it possible to identify rare hematopoietic cells in murine bone marrow that are undergoing lymphocyte fate specification. Steroid hormones also represent important research tools for investigating relationships between different categories of lympho-hematopoietic precursors. By selectively blocking entry into and progression within lymphoid lineages, the hormones probably have a major influence on numbers of lymphocytes that are produced under normal circumstances. These issues are discussed within the context of developmental age-dependent changes that occur in the lymphopoietic process.

Blood, Nov 18, 2011

Abstract 2337 Although hematopoietic stem cells (HSC) are characterized with self-renewal and plu... more Abstract 2337 Although hematopoietic stem cells (HSC) are characterized with self-renewal and pluri-potential, their cell-cycle status and differentiating behavior do fluctuate according to the physiological requirement. In the homeostatic state of adult bone marrow (BM), HSC are likely to be quiescent so that they can evade exhaustion or mutation. However, when BM is injured by irradiation and/or anti-cancer drugs, HSC need to proliferate to restore normal hematopoiesis. Then, after re-establishment of homeostasis, activated HSC return to be quiescent. Molecular crosstalk between HSC and BM microenvironment is thought to elaborately control the status of HSC, but precise mechanisms remain unknown. If the conversion of HSC between dormancy and self-renewal could be accurately monitored, the method should be useful to understand how the HSC status is regulated. Our previous study demonstrated that endothelial cell-selective adhesion molecule (ESAM) is a useful marker for murine HSC throughout life. In the present study, we examined if the ESAM level reflects the HSC status between dormancy and activation. Firstly we monitored ESAM levels of the Lin− Sca1+ c-kit+ (LSK) HSC-enriched fraction in BM after a single 5-FU injection (150 mg/kg) by flow cytometry. From 2 to 9 days after the 5-FU injection, ESAM levels on the LSK fraction remarkably increased. Indeed, the mean fluorescence intensity of ESAM expression on HSC increased by 9.6-fold in 5 days after 5-FU injection. The increase of ESAM expression was more drastic than that of other endothelial-related markers such as CD34 (1.6-fold). After reaching to the maximum peak around day 5–6, ESAM level gradually decreased and returned to the homeostatic level by 12 days after 5-FU. Interestingly, the ESAM up-regulation on HSC was abrogated when inhibitory drugs for NF-kB and topoisomerase-II were given after 5-FU injection. Furthermore, short-term BrdU exposure proved that the ESAMhi cells after 5-FU treatment are actually active in the cell cycle status. Then, the immuno-histochemical analyses were performed to locate the activated HSC in 5-FU treated BM. Since more than 80% of the Lin− ESAMhi Sca1+ cells were found within 20 μm from vascular endothelium, the activated HSC seemed to be intimate with endothelial cells and/or vascular-related cells. Next, we performed functional assessments of the ESAMlow LSK and ESAMhi LSK fractions sorted from 5-FU-treated BM. In methylcellulose cultures, while both fractions contained a number of hematopoietic progenitors, CFU-Mix, primitive multipotent progenitors, were significantly enriched in the ESAMhi fraction (10±0 vs. 48.5±2.1 per 200 ESAMlow or ESAMhi LSK cells, respectively). In the in vivo long-term reconstitution assays, we transplanted 2,000 CD45.1+ ESAMlow or ESAMhi LSK cells with 2 × 105 CD45.2+ competitor BM cells into lethally irradiated CD45.2+ mice. Sixteen weeks after transplantation, the mice transplanted with ESAMhi LSK cells showed significantly higher chimerisms of CD45.1+ cells than those transplanted with ESAMlow LSK, suggesting that long-term HSC are enriched in the ESAMhi fraction. It is noteworthy that the ESAMhi CD45.1+ LSK fraction re-constituted a CD45.1+ LSK population in the CD45.2+ recipient BM, whose ESAM expression levels lowered to the homeostatic level. The results above suggested that ESAM expression level mirrors the activation status of HSC after BM injury. However, it remains unclear if ESAM plays an important role in the hematopoietic recovery. Although we did not observe significant phenotypes except slight anemia in homeostatic ESAM KO mice, we presumed that substantial BM stress might reveal physiological importance of the ESAM expression. At day 5 after injecting 200mg/kg 5-FU, we found that leukocytes and platelet were remarkably decreased in KO mice. Furthermore, the KO mice showed severe anemia (Hb; WT 10.4±1.1 g/dl vs. KO 6.0±1.7 g/dl at day 10), and two of five mice died at day 12. In addition, we observed LSK Flt3− HSC as well as total mononuclear cells more significantly decreased in the KO mice. In summary, our data have shown that ESAM serves as a strong tool to monitor the conversion between dormancy and proliferation of adult BM HSC. In addition, the data from ESAM KO mice have suggested that ESAM is indispensable for normal hematopoietic recovery after BM injury. Further studies should address physiological meanings of the high ESAM level on active HSC. Disclosures: No relevant conflicts of interest to declare.

Current Opinion in Immunology, Apr 1, 2005

Extraordinary progress has been made in charting the maturation of hematopoietic cells. However, ... more Extraordinary progress has been made in charting the maturation of hematopoietic cells. However, these charted processes do not necessarily represent obligate pathways to specialized types of lymphocytes. In fact, there is a degree of plasticity associated with primitive progenitors. Moreover, all lymphocytes of a given kind are not necessarily produced through precisely the same sequence of events. Particularly contentious is the nature of cells that seed the thymus, because different progenitors can generate T cells under experimental circumstances. Non-renewing progenitors with a high density of c-Kit in bone marrow are likely to replenish the thymus under normal circumstances and most closely resemble canonical T cell progenitors.

Bio-protocol, 2014

[Abstract] This protocol is useful to determine the frequencies of lymphohematopoietic progenitor... more [Abstract] This protocol is useful to determine the frequencies of lymphohematopoietic progenitors in tested samples. To effectively support the growth and differentiation of primitive lymphohematopoietic progenitors, complex signals from stromal cells are important. Several stromal cell lines are known to support both lymphoid and myeloid cells simultaneously in mouse. In this protocol, we introduce two stromal co-culture systems for murine lymphohematopoietic progenitors and their application for limiting dilution assays.

Blood, Nov 18, 2011

Abstract 2106 Introduction: Anamorsin (AM, also called CIAPIN-1) is an anti-apoptotic factor, whi... more Abstract 2106 Introduction: Anamorsin (AM, also called CIAPIN-1) is an anti-apoptotic factor, which we originally isolated as a molecule that confers factor-independent survival of hematopoietic cells (J.Exp.Med. 199:581–592, 2004). AM has no structural homology to any known anti-apoptosis molecules such as Bcl-2 and IAP family members. AM-deficient (AM−/−) mice are embryonic lethal at late gestation. Its embryos are anemic and the size of embryos is very small. It is thought that AM plays a crucial role in hematopoiesis, however the precise biological mechanisms of AM remain unclear. Recently, it was reported that the yeast AM homolog, Dre2, was implicated in cytosolic iron-sulfur (Fe/S) cluster assembly (Zhang Y., et al. Mol.Cell.Biol. 28:5569-5582, 2008). The AM carries conserved cysteine motifs (CX2CXC and twin CX2C) at its C termini, which may form iron binding sites. In this study, we have focused on the possibility that AM may be involved in the cellular iron regulation. Methods and Results: At first, in order to analyze molecular and cellular events, we established cell lines from wild-type or AM-deficient embryonic fetal liver (14.5dpc) by using SV40 large T antigen. We isolated 5 wild-type cell lines (AM WTs) and 2 AM-deficient cell lines (AM KOs) respectively. Next, we compared the cell growth and apoptosis in both cell lines and found that the growth rate of AM KOs were slightly lower than that of AM WTs although these cell lines were immortalized. AM KOs showed more significant apoptosis induced by oxidative stress; the percents of Annexin V positive fraction were 12 ± 4 and 36 ± 6 in AM WTs and AM KOs respectively under the condition of 0.1mM H2O2 for 16hr. In addition to oxidative stress, AM KOs were more sensitive to UV irradiation. These differences were cancelled by transduction of AM-expression retrovirus vector in AM KOs. It was reported that Dre2 functions in cytosolic Fe/S protein biogenesis. We examined whether AM might be involved in the maturation of cytosolic Fe/S proteins. Iron regulatory protein 1 (IRP1) is a well-known cytosolic Fe/S protein with dual functions; in the presence of an [4Fe-4S] cluster it functions as a cytosolic aconitase, while IRP1 binds to mRNA stem-loop structures called iron responsive elements (IREs) and confer the mRNA stability when the [4Fe-4S] cluster is missing. In the iron-deficient cells, IRP1 binds to IREs located at the mRNA of iron transferrin receptor (TfR), ferritin and other iron metabolism transcripts, thereby enhancing iron uptake. In this way, it is thought that IRP1 plays important roles in iron homeostasis. We therefore compared the aconitase activity and IRE binding activities of IRP1 between AM WTs and AM KOs and found that AM deficiency resulted in the decrease of cytosolic aconitase activity (approximately 30% compared to AM WTs). In contrast to cytosolic aconitase activity, the mitochondrial aconitase activity showed little change regardless of AM deficiency. In order to analyze whether AM deficiency might increase IRE binding activity of IRP1, cytoplasmic extracts of AM WTs and AM KOs were compared by RNA precipitation assay. In AM KOs, the expression level of IRP1 decreased approximately one third compared to AM WTs. However, the binding activity of IRP1 to biotin-labeled IRE increased in the extract of AM KOs approximately three-fold in comparison to AM WTs. These differences was cancelled by transduction of AM-expression retrovirus vector to AM KOs. All these findings demonstrated the involvement of AM in the maturation of the cytosolic Fe/S protein, IRP1. Furthermore, we examined the expression of TfR, which is known to be modulated by IRP1-mediated posttranscriptional regulation. In the presence of iron chelator, desferrioxamine, the expression of TfR in AM WTs was markedly elevated. On the other hand, in AM KOs, the expression of TfR was hardly elevated. Thus, it was showed that AM deficiency impaired the iron homeostasis and conferred low sensitivity for iron concentration due to the decreased function of IRP1. Conclusion: Our current findings indicate that AM is essential for cytosolic Fe/S cluster biogenesis and iron homeostasis. Now the influence of the AM-mediated iron homeostasis on hematopoiesis is under investigation. Disclosures: No relevant conflicts of interest to declare.

Blood, Nov 19, 2010

Abstract 836 Although hematopoietic stem cells (HSC) are capable for reconstituting all hematopoi... more Abstract 836 Although hematopoietic stem cells (HSC) are capable for reconstituting all hematopoietic lineages in serial transplantation experiments, they undergo substantial age-related changes. Indeed, many studies have suggested that the immune system qualitatively and quantitatively changes along aging, including the selective loss of lymphopoietic potential. Lymphocyte progenitors explosively expand in fetal liver, but after birth their production sifts to bone marrow (BM) and becomes stable. Thereafter, replenishment of the adaptive immune system declines with age. If key inducers priming lymphoid lineage in HSC can be identified, they would be practical for expanding lymphocytes in culture for clinical purposes. Additionally, exogenous manipulation of their expression might boost the immune systems of immuno-compromised and/or elderly people. A primary aim of the present work was to describe molecular signatures of early stages of lymphopoiesis. Our previous studies developed a method to isolate Rag1+ early lymphocyte progenitors (ELP) from the Lineage marker- Sca-1+ c-kitHi (LSK) HSC-enriched fraction using Rag1/GFP reporter mice. We exploited the method and performed microarray analyses to compare gene expression patterns between HSC and ELP. While many molecules specific for the lymphoid lineage including T cell receptor and immunoglobulin heavy chain were highly induced at the ELP stage, some lymphoid-related genes were already expressed in the HSC-enriched fraction. In addition, our search identified many signal transduction kinases of whose function in lymphopoiesis is unknown. We then sought candidate genes governing the early lymphoid program with the goal of discovering molecules involved in the HSC to lymphoid lineage transition. Chromatin modifiers particularly drew our attention because of their ability to control spatial and temporal expression of essential genes. As a result, we identified Special AT-rich Sequence Binding 1 (SATB1) whose expression was faint in HSC and markedly up-regulated in ELP. SATB1, originally identified as a protein binding to the enhancer region of the IgH gene, is recently attracting considerable attention as a global transcription organizer for various genes. Our real-time RT-PCR analyses revealed that Satb1 expression remarkably increases along the differentiation of HSC to lymphoid-primed multipotent progenitors and ELP. In contrast, it was significantly down-regulated in the Lineage marker- Sca-1- c-kitHi myeloid progenitors. Interestingly, our analyses also found approximately 2-fold reduction of Satb1 transcripts in the Rag1/GFP- LSK cells of aged BM. In functional assays, adult BM-derived Flt3-LSK cells were retrovirally transduced with SATB1 and cultured in various conditions. In stromal cell co-cultures that support the growth of B lymphocytes and myeloid cells, the SATB1 transduction gave rise to 50–300 fold more CD19+ CD45R/B220+ Mac1- B lineage cells. In stromal-free cultures containing SCF, Flt3-ligand and IL7, SATB1 transduction also strongly induced B lineage cell production. On the other hand, methylcellulose colony assays showed 2-fold reduction of CFU-GM colony formation from SATB1-transduced cells compared to Mock-transduced cells. Next we examined if the exogenous expression of SATB1 promotes B lymphocyte growth from embryonic stem (ES) cells. SATB1 overexpression effectively promoted B1-B cell growth from mouse ES cells in OP9 co-culture system. Furthermore, we found that exogenous SATB1 expression partly restored the lymphopoietic potential in aged BM HSC that are compromised in lymphopoietic activity. Finally, we performed microarray analyses comparing SATB1- and Mock-transduced Flt3- LSK cells to seek candidate genes involved in the SATB1 function. While neither Pu.1, Ikaros, E2a, nor Notch1 was affected, some lymphoid-related genes, such as Sp4, Maf and Rag1, were increased in SATB1-overexpressed HSC. In conclusion, our results indicate that SATB1 plays critical roles in producing lymphoid lineage from primitive stem/progenitor cells. The findings are providing important information regarding how the earliest step of lymphopoiesis is epigenetically regulated and how modulation of the process might be useful to induce or rejuvenate the immune system. Disclosures: No relevant conflicts of interest to declare.

Blood, Nov 16, 2008

Sir2 (silent information regulator 2) is a member of a gene family (sirtuins) encoding NAD(+)-dep... more Sir2 (silent information regulator 2) is a member of a gene family (sirtuins) encoding NAD(+)-dependent histone deacetylases, which leads to increased DNA stability and prolonged lifespan in Saccharomyces cerevisiae and Caenorhabditis elegans. In mammalians, SIRT1 has also been found to function as a deacetylase for numerous protein targets involved in various cellular pathways, including stress responses, apoptosis, and neural axonal degeneration. However, the effects of SIRT1 on hematopoiesis remains unknown. We previously reported that the SIRT1 inhibitor, nicotinamide(NA), promoted the differentiation of murine hematopoietic stem/progenitor cells, and its activator, Resveratrol, suppressed the differntiation. In this report, we analysed the differentiation of stem/progenitor cells derived from SIRT1 KO mice. Because SIRT1 KO mice can survive less than a week after birth, we performed experiments using c-Kit(+)Lineage(−)Sca-1(+) cells (KSLs) derived from KO mice fetal liver. At first, we cultured KSLs with the cytokine cocktail containing SCF, IL-6, Flt3L, and TPO, which is utilized for the expansion of stem cells. After five day culture, we estimated the population which remains in KSL fraction. As a result, percentage of KSLs from KO fetal liver was less than 5%, while that from WT was about 15%. We also examined the colony formation of KO and WT fetal liver KSL cells using replating assays. At the first plating, total number of colonies developed from KO fetal liver KSLs was smaller than that from WT by 30–40%, and at the third plating, there could be detected no colonies from KO, while 20–30 colonies were observed from WT. Furthermore, we performed serial transplantation assays using WT and KO fetal liver KSLs. Although after primary transplant, we detected no significant difference in repopulation from KO KSLs compared to WT controls, three weeks after secondary transplant, % chimerism from KO KSLs was reduced to 1/2 compared with that from WT KSLs. These results suggested that Sirt1 suppresses the differentiation and promotes self-renew of hematopoietic stem/progenitor cells. To dissect the roles of target molecules of Sirt1 in suppression of differentiation, we first examined the mRNA expressions of some cell cycle-relating molecules in KO and WT fetal liver KSLs. As consequence, p16Ink4A and p19Arf were detected only in KO KSLs. Then we analyzed the roles of molecules which may effect those expressions. First, we examined the effects of MAPkinases inhibitors on the differentiation of KO and WT fetal liver KSLs. During the culture with SCF, IL-6, Flt3L, and TPO, the addition of p38 inhibitor(SB202190), or MEK1 inhibitor(PD98059), or JNK inhibitor did not change the effects of the SIRT1 targeting. Then it was suggested that MAPkinase pathways have little relation with the SIRT1-induced suppression of differentiation. Next we examined the role of p53, which was reported to combine with SIRT1 and to be deacetylated and repressed by SIRT1. KO and WT fetal liver KSLs were cultured with p53 inhibitor (pifithrin?), which partially cancelled the promotion of differntiation in SIRT1 KO KSLs. This result suggested that SIRT1 might inhibit differentiation of KSLs partially by antagonizing p53 activity. Next we examined the role of Foxo3a, a downstream molecule of SIRT1. Enforced expression of constitutive active form of Foxo3a(FKHRL1TM) also cancelled the promotion of differentiation in SIRT1 KO KSLs. As conclusion, we demonstrate that SIRT1 suppresses the differentiation of hematopoietic stem/progenitor cells by antagonizing p53 and enhancing Foxo3a activities, and contributes to maintenance of stem cell properties and stem cell pool.

Journal of Immunology, Jul 1, 2012

Whereas most hematopoietic stem cells (HSC) are quiescent in homeostasis, they actively prolifera... more Whereas most hematopoietic stem cells (HSC) are quiescent in homeostasis, they actively proliferate in response to bone marrow (BM) injury. Signals from the BM microenvironment are thought to promote entry of HSC into the cell cycle. However, it has been cumbersome to assess cycle status of viable HSC and thus explore unique features associated with division. In this study, we show that expression of endothelial cell-selective adhesion molecule (ESAM) can be a powerful indicator of HSC activation. ESAM levels clearly mirrored the shift of HSC between quiescence and activation, and it was prominent in comparison with other HSC-related Ags. ESAM hi HSC were actively dividing, but had surprisingly high long-term reconstituting capacity. Immunohistochemical analyses showed that most ESAM hi HSC were located near vascular endothelium in the BM after 5-fluorouracil treatment. To determine the importance of ESAM in the process of BM recovery, ESAM knockout mice were treated with 5-fluorouracil and their hematopoietic reconstruction was examined. The ESAM deficiency caused severe and prolonged BM suppression, suggesting that ESAM is functionally indispensable for HSC to re-establish homeostatic hematopoiesis. With respect to intracellular regulators, NF-kB and topoisomerase II levels correlated with the ESAM upregulation. Thus, our data demonstrate that the intensity of ESAM expression is useful to trace activated HSC and to understand molecular events involved in stem cell states.

Blood, Dec 6, 2014

Understanding lineage specific markers contributes to investigation into lineage commitment proce... more Understanding lineage specific markers contributes to investigation into lineage commitment processes in hematopoiesis. Particularly in the human study, information about hematopoietic lineage divergence is essential to refine hematopoietic lineage tree. Lineage markers are also potentially useful for therapeutic target, such as CD20 in B-cell lymphoma, and CD33 in acute myeloid leukemia. We have recently reported that special AT-rich sequence-binding protein 1 (SATB1), a global chromatin organizer, promotes lymphocyte production from hematopoietic stem cells (HSCs) (Immunity 38;1105, 2013). Expression level of SATB1 increases with early lymphoid differentiation, whereas it is shut off in committed myeloid progenitors. To search a novel cell surface molecule that marks the point of branching lineage along early myeloid and lymphoid differentiation, we performed microarray analyses comparing SATB1-overexpressed HSCs with mock-transduced HSCs. The results drew our attention to membrane-spanning 4-domains, subfamily A, member 3 (MS4A3). MS4A3, also called hematopoietic cell-specific transmembrane 4 (HTm4), is a member of the MS4A family. CD20, encoded by MS4A1 gene, belongs to the same family. We observed that expression level of MS4A3 in SATB1-overexpressed HSCs was decreased almost one tenth of that of mock HSCs. To confirm the relationship of SATB1 and MS4A3 in human hematopoietic cells, we first used chronic myeloid leukemia cell line K562, which was found to clearly express MS4A3 on their cell surface. While SATB1 expression was undetectable in original K562 cells, the exogenous expression of SATB1 significantly reduced their MS4A3 expression level, suggesting that SATB1 negatively regulates MS4A3 expression in human cells. Next, we analyzed MS4A3 expression pattern in primary human hematopoietic stem/progenitor cells. Bone marrow (BM) cells were obtained from healthy donors or patients with acute myeloid leukemia. The Institutional Review Board of Osaka University School of Medicine approved all of protocols, and written informed consents were obtained from all participants. Mononuclear cells were separated from the BM samples by density gradient centrifugation, and subsequently applied to cell sorting for Lineage marker-negative (Lin-) CD34+ CD38- HSCs, Lin- CD34+ CD38+ IL-3 receptor α (IL-3Rα)+ CD45RA- common myeloid progenitors (CMPs), Lin- CD34+ CD38+ IL3-Rα+ CD45RA+ granulocyte-macrophage progenitors (GMPs) and Lin- CD34+ CD38+ IL-3Rα- CD45RA-megakaryocyte-erythroid progenitors (MEPs). MS4A3 expression levels of the sorted cells were analyzed with real-time RT-PCR. We detected more than 10-fold amount of MS4A3 transcripts in CMPs than HSCs. Furthermore, its expression level continuously increased along myeloid lineage differentiation to GMP. On the other hand, megakaryocyte-erythroid lineage differentiation was not accompanied by MS4A3 expression and the amount of MS4A3 transcripts in MEPs was minimum as in HSCs. Flow cytometry analyses confirmed that HSCs and MEPs do not express MS4A3 on their cell surface whereas the MS4A3 expression on CMPs and GMPs is detectable. Further, the Lin- CD34+ CD38+ CD33+ cells could be fractionated according to the intensity of cell surface MS4A3 expression. To investigate the significance of cell surface MS4A3 expression for functional analyses of myeloid progenitor cells, we performed methylcellulose colony-forming assays. We found that MS4A3+ cells in Lin- CD34+ CD38+ CD33+ fraction only produced granulocyte/macrophage colonies, losing erythroid colony- and mixed colony-forming capacity. These results suggest that cell surface expression of MS4A3 is useful to distinguish granulocyte/macrophage lineage-committed progenitors from other lineage-related ones in early human hematopoiesis. We also analyzed MS4A3 expression in BM cells obtained from patients with acute leukemia. Flow cytometry analyses revealed that leukemia cells of some patients expressed substantial amount of cell surface MS4A3. In conclusion, MS4A3 is useful to monitor early stage of myeloid differentiation in human hematopoiesis. In addition, our findings of MS4A3 expression on myeloid leukemia cells, while no expression on normal HSCs, imply that MS4A3 might be a therapeutic target molecule in myelogenous leukemia. Further studies would clarify the application of MS4A3 to anti-leukemia therapy. Disclosures No relevant conflicts of interest to declare.

Blood, Nov 16, 2012

Abstract 610 Introduction: Iron has crucial roles in many cellular biological processes. Cellular... more Abstract 610 Introduction: Iron has crucial roles in many cellular biological processes. Cellular iron uptake and export must be tightly regulated. Insufficient iron concentrations impair the function of numerous iron proteins, whereas excess free iron can oxidize and damage the contents of cells. Anamorsin (AM, also called CIAPIN-1) is an anti-apoptotic factor, which we originally isolated as a molecule that confers factor-independent survival of hematopoietic cells. AM-deficient mice are embryonic lethal at late gestation due to the defect of definitive hematopoiesis. It is thought that AM plays a crucial role in hematopoiesis, however its precise biological mechanisms remain unclear. Recently, it was reported that the yeast AM homolog, Dre2, was implicated in cytosolic iron-sulfur (Fe/S) cluster assembly (Zhang Y., et al. Mol.Cell.Biol. 28:5569–5582, 2008). The AM carries conserved cysteine motifs (CX2CXC and twin CX2C) at its C termini, which may form iron binding sites. In this study, we have focused on the possibility that AM may be involved in the maturation of Fe/S cluster and the cellular iron homeostasis, especially, the regulation of labile iron pool (LIP) and that AM may affect the accumulation of reactive oxygen species (ROS), leading to impaired erythropoiesis. Methods and Results: To analyze the function of Fe/S protein, we established wild-type cell lines (AMWT) and AM-deficient cell lines (AMKO) from wild-type and AM-deficient fetal liver (14.5dpc) respectively by using SV40 large T antigen. Iron regulatory protein 1 (IRP1) is a well-known Fe/S protein with dual functions. In the presence of Fe/S cluster, IRP1 functions as a cytosolic aconitase. While, in the absence of Fe/S cluster, IRP1 stabilizes the transferrin receptor (TfR) mRNA by binding to the iron responsive element (IRE). We compared the aconitase activity and the IRE binding activity of IRP1 between AMWT and AMKO. The results showed that the cytosolic aconitase activity in AMKO decreased approximately 30% compared to AMWT and the IRE binding activity of IRP1 in AMKO increased 3-fold compared to AMWT. Furthermore, we compared the iron homeostasis. In the presence of iron chelator, desferrioxamine, the expression of TfR in AMWT was markedly elevated, while it was hardly elevated in AMKO. The LIP is a pool of chelatable and redox-active iron, which serves as a crossroad of cell iron metabolism. The measurement of LIP with the metal-sensitive sensor calcein acetoxymethyl ester showed that AMKO had 5-fold higher cellular LIP than AMWT. Moreover we evaluated the accumulation of ROS and the induction of apoptosis by extracellular iron uptake between AMWT and AMKO. The results showed the accumulation of ROS and the induction of apoptosis in AMKO were enhanced about twice as much as in AMWT. These enhancements could be restored by transduction of AM expressing retrovirus vector to AMKO. We also evaluated the effects of AM-deficiency on erythroid differentiation. Fetal liver cells from wild-type or AM-deficient embryos (14.5dpc) were divided into primitive and more matured erythroid populations based on their expression of CD71 and Ter119 by FACS analysis. AM-deficient fetal liver cells had a significant increase in the CD71low TER119low population, containing primitive erythroid progenitors, compared to wild-type (9.4±2.1% vs. 5.2±1.1%, P<0.05). Conversely, the CD71lowTER119highpopulation, comprised of late orthochromatophilic erythroblasts and reticulocytes, decreased in AM-deficient fetal liver cells compared to wild-type cells (2.3±0.8% vs. 7.4±1.3%, P < 0.05). Moreover we studied LIP in wild-type or AM-deficient embryo fetal liver cells. In accordance with the cell lines, the LIP in AM-deficient fetal liver cells increased 3 to 5-fold more than in wild-type fetal liver cells. The accumulation of ROS and the number of apoptotic cells also increased 2 to 5-fold in AM- deficient fetal liver cells compared to wild-type fetal liver cells. Thus, it was showed that AM deficiency impaired the iron homeostasis and conferred low sensitivity for iron concentration, resulting in the increase of LIP, the accumulation of ROS and the induction of apoptosis. Furthermore, dysregulation of cellular iron homeostasis was thought to be the cause of the embryonic lethal due to AM deficiency. Conclusion: Our current findings indicate that AM functions in cytosolic Fe/S cluster biogenesis and iron homeostasis and is essential for…

Blood, Nov 15, 2013

Endothelial cell-selective adhesion molecule (ESAM) is a lifelong marker of hematopoietic stem ce... more Endothelial cell-selective adhesion molecule (ESAM) is a lifelong marker of hematopoietic stem cells (HSCs). Although we previously elucidated the functional importance of ESAM in HSCs in stress-induced hematopoiesis in adults, it is unclear how ESAM affects hematopoietic development during fetal life. To address this issue, we analyzed fetuses from conventional or conditional ESAM-knockout mice. Approximately half of ESAM-null fetuses died after mid-gestation due to anemia. RNA sequencing analyses revealed downregulation of adult-type globins and Alas2, a heme biosynthesis enzyme, in ESAM-null fetal livers. These abnormalities were attributed to malfunction of ESAM-null HSCs, which was demonstrated in culture and transplantation experiments. Although crosslinking ESAM directly influenced gene transcription in HSCs, observations in conditional ESAM-knockout fetuses revealed the critical involvement of ESAM expressed in endothelial cells in fetal lethality. Thus, we showed that ESAM had important roles in developing definitive hematopoiesis. Furthermore, we unveiled the importance of endothelial ESAM in this process.

Blood, Dec 3, 2015

Murine hematopoietic stem cells (HSCs) can be isolated with high efficiency as Lineage- Sca-1+ c-... more Murine hematopoietic stem cells (HSCs) can be isolated with high efficiency as Lineage- Sca-1+ c-kitHigh (LSK) CD34-/Low CD150+ CD48- cells. In humans, however, the same method is not useful because of critical differences between murine and human HSC phenotypes. Such discrepancy has hampered the translation of findings in mice into a human preclinical or clinical context. Therefore, the identification of common HSC antigens between the two species would be a significant advance with respect to translational studies of HSC biology. We previously identified endothelial cell-selective adhesion molecule (ESAM) as a novel maker for HSCs in mice (Blood, 2009). We also found that ESAM is functionally important for murine HSCs to reconstitute hematopoiesis after 5-FU treatment (J Immunol, 2012). In the present study, we have extended our research of ESAM to human HSCs and leukemia. We first examined whether ESAM expression showed potential as a marker of human HSCs. In addition to adult BM, the majority of CD34+ CD38- cells in cord blood (CB) and G-CSF mobilized peripheral blood expressed ESAM. The addition of anti-CD90 and CD45RA antibodies divides the adult BM CD34+ CD38- fraction into three subpopulations, namely HSCs, multipotent progenitors (MPPs), and multi-lymphoid progenitors (MLPs). We found that HSCs expressed high levels of ESAM whereas MPPs expressed lower levels and many MLPs lost ESAM expression. Functional assessment for ESAM-/Low and ESAMHigh cells in the CD34+ CD38- fractionconfirmed that high ESAM expression distinguishes progenitors that are more primitive and multipotent. We also identified a subset of CD34+ CD38- cells in adult BM and CB that expressed extremely high levels of ESAM, namely ESAMBright cells. Gene expression profiles of the CD34+ CD38- ESAMHigh and CD34+ CD38- ESAMBright populations showed that the former cells expressed HSC-related genes whereas the latter showed more endothelial-related profiles. Indeed, the CD34+ CD38- ESAMBright cells produced CD31+ endothelial cells, but not CD45+ hematopoietic cells, in co-culture with MS5 stromal cells. These results suggest that the CD34+ CD38- fraction, which is conventionally considered the human HSC fraction, also contains a substantial number of non-hematopoietic progenitors. Thus, the inclusion of ESAM provides a more accurate estimation of HSC numbers. Since some of HSC-related antigens are useful for determining leukemia lineage and have utility as prognostic indicators, we determined whether ESAM might also be a valuable addition to this antigen panel. First, we examined human leukemia cell lines. Tested myeloid leukemia lines including KG-1a, HL60, THP1, U937 and Kasumi were uniformly negative for ESAM expression. Jurkat and MOLT4, lymphoid lineage lines were also negative. On the other hand, HEL, an erythroid leukemia cell line, and CMK, a megakaryocytic leukemia cell line, exhibited high expression of ESAM. Additionally, K562 cells, which originated from CML that subsequently transformed into acute erythro-leukemia, also express ESAM. We then evaluated ESAM expression on primary acute leukemia cells, which were isolated from patients upon diagnosis. Interestingly, while all of ALL cases were virtually negative for ESAM, more than half of AML cases were ESAM-positive. Notably, the ESAM expression pattern on AML cases substantially differs even in the same FAB classification. We inferred that AML cells might change their ESAM expression levels according to cell intrinsic features and/or the surrounding environment in vivo. Therefore, we inoculated ESAM- KG-1a cells into NOD/SCID mice and harvested reconstituted KG-1a (rKG-1a) cells after the inoculation. They were then cultured in vitro and inoculated again into NOD/SCID mice. FACS analyses revealed that, although parental KG-1a cells were ESAM-negative, rKG-1a cells expressed a substantial amount of ESAM. Notably, rKG-1a cells were more aggressive and killed the recipient mice in a shorter period. This observation indicates that leukemia cells change their surface phenotype according to the environment, and that ESAM expression may be related to the acquisition of a more aggressive phenotype. In conclusion, we demonstrate that ESAM is a reliable marker of HSCs in humans as well as in mice. Additionally, ESAM is expressed on some of human acute leukemia cells and might be useful for lineage determination and as prognostic indicator. Disclosures Yokota: SHIONOGI…

Blood, Nov 16, 2005

AML1 (RUNX1) is a family member of heterodimeric transcription factors named core binding factors... more AML1 (RUNX1) is a family member of heterodimeric transcription factors named core binding factors (CBFs). AML1 binds to its target DNA through the RUNT domain and is frequently involved in chromosomal translocations associated with human leukemias. Also, AML1 was found to be mutated in a substantial fraction of myelodysplastic syndrome (MDS) patients. Although most of AML1 mutations identified in AML patients were located in the N-terminal region, the C-terminal mutaions yielding mutant AML lacking the C-terminal domain (AML1dC) were frequently observed in MDS patients. Based on the fact that the haploinsufficiency of AML1, which results from heterozygous missense mutation of the AML1 gene, causes familial platelet disorder (FPD) with predisposition to AML, and that the conditional deletion of the AML1 gene using the Cre-LoxP system in adult mice results in the failure of megakaryopoiesis and subsequent platelet production, we speculate that AML1 might be involved in the thrombopoietin (TPO)/c-Mpl (its receptor) system, which is a major regulator of this process. Also, we examined the mechanism through which AML1dC affects the function of wtAML1. At first, we examined the role of AML1 in the regulation of the c-mpl promoter with luciferase assays. In 293T cells, we found that wild-type AML1 (wtAML1) activated the c-mpl promoter by 3.5 fold. This effect was dose-dependently inhibited by a dominant-negative form of AML1, AML1-MTG8. In addition, we found that AML1dC inhibited the function of wtAML1 with efficiencies similar to AML1-MTG8 (or with lesser efficiencies than AML1-MTG8). Next, we tried to determine the element responsive to AML1 in the c-mpl promoter. Using various mutants of the c-mpl promoter, we found that wtAML1 activates the element between −135 and −116, which contains the typical AML1-binding sequence. Furthermore, we confirmed that wtAML1 bound to this element in electrophoretic mobility shift assays using nuclear extract of 293T cells transfected with wtAML1. Also, in this assay, we found that AML1dC bound to the consensus DNA sequence more strongly than wtAML1 and inhibited the DNA-binding of wtAML1 competitively. Next, we examined the roles of AML1 in the c-Mpl expression in hematopoietic cells by expressing AML1dC in the OP-9 system, in which hematopoietic cells develop from embryonic stem (ES) cells during the coculture with OP-9 cells. In contrast to the results obtained from 293T cells, when AML1dC was inducibly expressed with the Tet-off system, c-Mpl was expressed more intensely in Lin−Sca1+ hematopoietic stem/progenitor cells than mock-transfected Lin−Sca1+ cells, indicating that AML1 is a negative regulator of the c-Mpl expression in hematopoietic stem/progenitor cells. In contrast, the surface expression of c-Mpl in mature megakaryocytes was hardly affected by AMLdC in the OP-9 system. We also examined the effects of AML1 on the c-Mpl expression in normal murine bone marrow Lin−Sca-1+ cells by expressing AML1dC with the retrovirus system. As a result, we again found that AML1dC enhanced the c-Mpl expression in murine Lin−Sca-1+ cells. Together, our results indicate that AML1 regulates the c-Mpl expression both positively and negatively according to cell types (cf, 293T cells, hematopoietic stem/progenitor cells, and megakaroycytes). Particularly, although AML1 was previously reported to positively regulate of the c-Mpl expression in megakaryocytes, it was supposed be a negative regulator in hematopoietic stem/progenitor cells.

Bio-protocol, 2014

1. Mouse spleen cells or ES-derived hematopoietic cells 2. DNA extraction Kit: PerfectPure DNA Cu... more 1. Mouse spleen cells or ES-derived hematopoietic cells 2. DNA extraction Kit: PerfectPure DNA Cultured Cell Kit (5 PRIME, catalog number: 2302000) 3. 10x PCR Buffer with KCl (Life Technologies, Applied biosystems®) 4. MgCl2 (Life Technologies, Applied biosystems®) 5. Taq DNA polymerase (Life Technologies, Applied Biosystems®, catalog number: 4338856) 6. dNTPs (Life Technologies, Applied Biosystems®) 7. Primers (FASMAC) The sequence of primers are as follows. a. DHL(5’), GGAATTCG(AorC)TTTTTGT(CorG)AAGGGATCTACTACTGTG b. Mu0(5’), CCGCATGCCAAGGCTAGCCTGAAAGATTACC c. J3(3’), GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG 8. Agarose (UltraPureTM Agarose) (Life Technologies, InvitrogenTM, catalog number: 16500-100) 9. Ethidium bromide (Wako Pure Chemical Industries, catalog number: 315-90051)

Blood, Dec 3, 2015

Background: Lifelong hematopoiesis is maintained by cell differentiation in which signaling pathw... more Background: Lifelong hematopoiesis is maintained by cell differentiation in which signaling pathways and transcription factors coordinately induce step-wise maturation of hematopoietic stem cells (HSCs) toward downstream effector cells. In addition, the organization of chromatin structure that creates accessible sites of target genes is also essential so as to ensure temporally and spatially adequate control of internal gene expression. Murine HSCs can be isolated with high efficiency using surface molecules including lineage-related markers, c-Kit, Sca-1, Flt3 and SLAM family proteins. However, even the highly enriched HSC fraction is still heterogeneous regarding differentiation potential, and how the HSC diversity reflects the heterogeneity of intrinsic gene-expression in HSCs is as-yet-unknown. We previously identified Special AT-rich Sequence Binding protein 1 (SATB1), a global chromatin regulator, as a lymphoid-related gene in the HSC differentiation (Satoh and Yokota et al. Immunity 2013). Indeed, SATB1 overexpression strongly enhanced both T and B lymphopoietic potential of murine HSCs whereas SATB1 deficiency caused malfunctions of HSCs in the lymphopoietic activity. Furthermore, another report showed that SATB1-deficient HSCs were less quiescent in transplanted recipients and more prone to differentiate preferentially to myeloid-erythroid lineages (Will et al. Nat Immunol 2013). These results suggested that SATB1 is likely indispensable not only for the lymphopoietic potential but also for the integrity of HSCs. Here, to better understand the mechanism how SATB1 influences homeostatic HSC functions in adult bone marrow (BM), we have developed a new mouse model in which SATB1 expression can be precisely monitored along the HSC differentiation. Methods: The Tomato gene, coding a red fluorescent protein, was knock-in to the coding region of endogenous Satb1 gene. The heterozygous SATB1/Tomato knock-in mice in which one Satb1 allele was replaced with the Tomato were used to sort HSCs in adult BM. The sorted cells were evaluated for the differentiation potential with methylcellulose colony assays and co-cultures with MS5 stromal cells. Further, the long-term reconstitution ability was evaluated by transplantation to lethally irradiated mice. To obtain transcriptome information, total RNA was isolated from SATB1/Tomato- and SATB1/Tomato+ HSCs, and then next-generation sequencing was performed. The data were analyzed with the Ingenuity Pathway Analysis software. Results: We defined Lin- Sca1+ c-KitHi (LSK) CD150+ Flt3- cells as HSCs, especially adopting FLT3- to exclude FLT3+ lymphoid-primed multipotent progenitors from our functional analyses. We found that the LSK CD150+ Flt3- fraction contains substantial number of SATB1/Tomato+ cells. While both SATB1/Tomato- and SATB1/Tomato+ HSCs produced numerous CFU-Mix and CFU-GM/G/M colonies, the latter were less potent to produce BFU-E. In co-culture with MS5 stromal cells that support B and myeloid lineages, the output of B lineage cells from SATB1+ HSCs was more robust than that of SATB1- HSCs. Upon transplantation, enhanced B-lineage engraftment was observed in the SATB1+ HSC-transplanted recipients. Interestingly, while the two types of HSCs showed obvious difference in the differentiation potential toward lymphoid or myeloid lineage, both HSCs reconstituted the LSK CD150+ Flt3- fraction that similarly contained SATB1/Tomato- and SATB1/Tomato+ cells. With the RNA-sequencing data of SATB1- and SATB1+ HSCs, biological pathway analyses revealed that the…

Blood, Feb 15, 1999

A unique subclone of a bone marrow-derived stromal cell line, BMS2.4, produces soluble factors th... more A unique subclone of a bone marrow-derived stromal cell line, BMS2.4, produces soluble factors that inhibit proliferation of several types of hematopoietic cell lines. An understanding of these molecules may be informative about negative regulatory circuits that can potentially limit blood cell formation. We used expression cloning to identify interleukin-6 (IL-6) as one factor that suppressed growth of a pre-B-cell variant line, 1A9-M. Moreover, IL-6 induced macrophage-differentiation and apoptosis of 1A9-M cells. During this process, IL-6 downregulated expression of BCL2 in 1A9-M cells and stimulated BCL-XL expression, but had no effect on p53, Bax, or Bak gene expression. Mechanisms for transduction of IL-6-induced signals were then evaluated in IL-6-stimulated 1A9-M cells. Whereas the signal transducer and activator of transcription 3 (Stat3) was phosphorylated and activated, there was no effect on either Stat1 or Stat5. The importance of BCL2 and Stat3 on IL-6-induced macrophage-differentiation and apoptosis was studied with 1A9-M cells expressing human BCL2 or a dominant-negative form of Stat3, respectively. IL-6-induced apoptosis, but not macrophage-differentiation, was blocked by continuously expressed BCL2. A dominant-negative form of Stat3 inhibited both macrophage-differentiation and apoptosis induced by IL-6. However, diminished Stat3 activity did not prevent IL-6-induced downregulation of the BCL2 gene. Therefore, activation of Stat3 is essential for IL-6-induced macrophagedifferentiation and programmed cell death in this model. Whereas overexpression of BCL2 abrogates the apoptotic response, Stat3-independent signals appear to downregulate expression of the BCL2 gene.

European Journal of Immunology, Mar 16, 2015

Mammals have evolved to protect their offspring during early fetal development. Elaborated mechan... more Mammals have evolved to protect their offspring during early fetal development. Elaborated mechanisms induce tolerance in the maternal immune system for the fetus. Female hormones, mainly estrogen, play a role in suppressing maternal lymphopoiesis. However, the molecular mechanisms involved in the maternal immune tolerance are largely unknown. Here, we show that estrogen-induced soluble Frizzled-related proteins (sFRPs), and particularly sFRP5, suppress B-lymphopoiesis in vivo in transgenic mice. Mice overexpressing sFRP5 had fewer B-lymphocytes in the peripheral blood and spleen. High levels of sFRP5 inhibited early B-cell differentiation in the bone marrow (BM), resulting in the accumulation of cells with a common lymphoid progenitor (CLP) phenotype. Conversely, sFRP5 deficiency reduced the number of hematopoietic stem cells (HSCs) and primitive lymphoid progenitors in the BM, particularly when estrogen was administered. Furthermore, a significant reduction in CLPs and B-lineage-committed progenitors was observed in the BM of sfrp5-null pregnant females. We concluded that, although high sFRP5 expression inhibits B-lymphopoiesis in vivo, physiologically, it contributes to the preservation of very primitive lymphopoietic progenitors, including HSCs, under high estrogen levels. Thus, sFRP5 regulates early lympho-hematopoiesis in the maternal BM, but the maternal-fetal immune tolerance still involves other molecular mechanisms which remain to be uncovered.

British Journal of Haematology, Dec 1, 1998

Very late antigen (VLA)-4 integrin has been suggested to play an important role in haemopoiesis. ... more Very late antigen (VLA)-4 integrin has been suggested to play an important role in haemopoiesis. However, little is known concerning the roles of the fibronectin (FN)/VLA-4 interaction in the proliferation of human B cells. In this study we investigated the effect of immobilized FN on the proliferation of various B-cell lines, including a newly-established B-cell line, OPM-3, and human tonsillar B cells, that primarily express VLA-4 but not VLA-5. Immobilized FN significantly promoted the proliferation of OPM-3 cells and normal B cells via VLA-4. The cross-linking of beta1 integrins of OPM-3 cells resulted in the phosphorylation of the focal adhesion kinase (FAK) associated 90 kD protein, an increase in FAK-associated kinase activity, and the phosphorylation of Raf-1. Furthermore, the MEK1 inhibitor, PD98059, inhibited the FN-promoted proliferation of OPM-3 cells. These results demonstrate that the FN/VLA-4 interaction transmits the growth signal(s) which may be mediated by Ras pathway in OPM-3 cells, and suggest that OPM-3 cells may be of great value in studying the roles of the FN/VLA-4 interaction in human B-cell growth.

Biochemical and Biophysical Research Communications, 2018

Information of myeloid lineage-related antigen on hematopoietic stem/progenitor cells (HSPCs) is ... more Information of myeloid lineage-related antigen on hematopoietic stem/progenitor cells (HSPCs) is important to clarify the mechanisms regulating hematopoiesis, as well as for the diagnosis and treatment of myeloid malignancies. We previously reported that special AT-rich sequence binding protein 1 (SATB1), a global chromatin organizer, promotes lymphoid differentiation from HSPCs. To search a novel cell surface molecule discriminating early myeloid and lymphoid differentiation, we performed microarray analyses comparing SATB1-overexpressed HSPCs with mock-transduced HSPCs. The results drew our attention to membrane-spanning 4-domains, subfamily A, member 3 (Ms4a3) as the most downregulated molecule in HSPCs with forced overexpression of SATB1. Ms4a3 expression was undetectable in hematopoietic stem cells, but showed a concomitant increase with progressive myeloid differentiation, whereas not only lymphoid but also megakaryocytic-erythrocytic progenitors were entirely devoid of Ms4a3 expression. Further analysis revealed that a subset of CD34 þ CD38 þ CD33 þ progenitor population in human adult bone marrow expressed MS4A3, and those MS4A3 þ progenitors only produced granulocyte/macrophage colonies, losing erythroid colony-and mixed colony-forming capacity. These results suggest that cell surface expression of MS4A3 is useful to distinguish granulocyte/macrophage lineagecommitted progenitors from other lineage-related ones in early human hematopoiesis. In conclusion, MS4A3 is useful to monitor early stage of myeloid differentiation in human hematopoiesis.

Blood, Nov 1, 2004

Several characteristics of the immunoglobulin (Ig) repertoire in fetuses and adults set them apar... more Several characteristics of the immunoglobulin (Ig) repertoire in fetuses and adults set them apart from each other. Functionally, this translates into differences in the affinity and effectiveness of the humoral immune response between adults and the very young. At least 2 possibilities could explain these differences: (1) fetal and adult lymphocyte progenitors differ significantly in their potential to form a diverse repertoire, and (2) factors extrinsic to the immunoglobulin locus are more influential to the character of the repertoire. To address this we used nonobese diabetic-severe combined immunodeficient-␤ 2 microglobulin knockout (NOD/SCID/␤ 2 m ؊/؊) mice reconstituted with human B-cell progenitors to compare the immunoglobulin repertoire potential of human fetal, cord blood, and adult sources. We found nearly identical VH and JH gene segment use and only modest differences in the third complementarity determining region of the immunoglobulin heavy chain (HCDR3). We conclude that the repertoire potential is remarkably similar regardless of the age of the individual from which progenitors are derived. Age-related differences in the immunoglobulin repertoire and variance of B-cell responses to immunization appear to arise from selection rather than from changes in recombination of the immunoglobulin locus itself. From the standpoint of the Ig repertoire, an immune system reconstituted from fetal or neonatal stem cells would likely be as diverse as one generated from adult bone marrow.

Seminars in Immunology, Dec 1, 2002

Advances in cell sorting and GFP knock-in technology have made it possible to identify rare hemat... more Advances in cell sorting and GFP knock-in technology have made it possible to identify rare hematopoietic cells in murine bone marrow that are undergoing lymphocyte fate specification. Steroid hormones also represent important research tools for investigating relationships between different categories of lympho-hematopoietic precursors. By selectively blocking entry into and progression within lymphoid lineages, the hormones probably have a major influence on numbers of lymphocytes that are produced under normal circumstances. These issues are discussed within the context of developmental age-dependent changes that occur in the lymphopoietic process.

Blood, Nov 18, 2011

Abstract 2337 Although hematopoietic stem cells (HSC) are characterized with self-renewal and plu... more Abstract 2337 Although hematopoietic stem cells (HSC) are characterized with self-renewal and pluri-potential, their cell-cycle status and differentiating behavior do fluctuate according to the physiological requirement. In the homeostatic state of adult bone marrow (BM), HSC are likely to be quiescent so that they can evade exhaustion or mutation. However, when BM is injured by irradiation and/or anti-cancer drugs, HSC need to proliferate to restore normal hematopoiesis. Then, after re-establishment of homeostasis, activated HSC return to be quiescent. Molecular crosstalk between HSC and BM microenvironment is thought to elaborately control the status of HSC, but precise mechanisms remain unknown. If the conversion of HSC between dormancy and self-renewal could be accurately monitored, the method should be useful to understand how the HSC status is regulated. Our previous study demonstrated that endothelial cell-selective adhesion molecule (ESAM) is a useful marker for murine HSC throughout life. In the present study, we examined if the ESAM level reflects the HSC status between dormancy and activation. Firstly we monitored ESAM levels of the Lin− Sca1+ c-kit+ (LSK) HSC-enriched fraction in BM after a single 5-FU injection (150 mg/kg) by flow cytometry. From 2 to 9 days after the 5-FU injection, ESAM levels on the LSK fraction remarkably increased. Indeed, the mean fluorescence intensity of ESAM expression on HSC increased by 9.6-fold in 5 days after 5-FU injection. The increase of ESAM expression was more drastic than that of other endothelial-related markers such as CD34 (1.6-fold). After reaching to the maximum peak around day 5–6, ESAM level gradually decreased and returned to the homeostatic level by 12 days after 5-FU. Interestingly, the ESAM up-regulation on HSC was abrogated when inhibitory drugs for NF-kB and topoisomerase-II were given after 5-FU injection. Furthermore, short-term BrdU exposure proved that the ESAMhi cells after 5-FU treatment are actually active in the cell cycle status. Then, the immuno-histochemical analyses were performed to locate the activated HSC in 5-FU treated BM. Since more than 80% of the Lin− ESAMhi Sca1+ cells were found within 20 μm from vascular endothelium, the activated HSC seemed to be intimate with endothelial cells and/or vascular-related cells. Next, we performed functional assessments of the ESAMlow LSK and ESAMhi LSK fractions sorted from 5-FU-treated BM. In methylcellulose cultures, while both fractions contained a number of hematopoietic progenitors, CFU-Mix, primitive multipotent progenitors, were significantly enriched in the ESAMhi fraction (10±0 vs. 48.5±2.1 per 200 ESAMlow or ESAMhi LSK cells, respectively). In the in vivo long-term reconstitution assays, we transplanted 2,000 CD45.1+ ESAMlow or ESAMhi LSK cells with 2 × 105 CD45.2+ competitor BM cells into lethally irradiated CD45.2+ mice. Sixteen weeks after transplantation, the mice transplanted with ESAMhi LSK cells showed significantly higher chimerisms of CD45.1+ cells than those transplanted with ESAMlow LSK, suggesting that long-term HSC are enriched in the ESAMhi fraction. It is noteworthy that the ESAMhi CD45.1+ LSK fraction re-constituted a CD45.1+ LSK population in the CD45.2+ recipient BM, whose ESAM expression levels lowered to the homeostatic level. The results above suggested that ESAM expression level mirrors the activation status of HSC after BM injury. However, it remains unclear if ESAM plays an important role in the hematopoietic recovery. Although we did not observe significant phenotypes except slight anemia in homeostatic ESAM KO mice, we presumed that substantial BM stress might reveal physiological importance of the ESAM expression. At day 5 after injecting 200mg/kg 5-FU, we found that leukocytes and platelet were remarkably decreased in KO mice. Furthermore, the KO mice showed severe anemia (Hb; WT 10.4±1.1 g/dl vs. KO 6.0±1.7 g/dl at day 10), and two of five mice died at day 12. In addition, we observed LSK Flt3− HSC as well as total mononuclear cells more significantly decreased in the KO mice. In summary, our data have shown that ESAM serves as a strong tool to monitor the conversion between dormancy and proliferation of adult BM HSC. In addition, the data from ESAM KO mice have suggested that ESAM is indispensable for normal hematopoietic recovery after BM injury. Further studies should address physiological meanings of the high ESAM level on active HSC. Disclosures: No relevant conflicts of interest to declare.

Current Opinion in Immunology, Apr 1, 2005

Extraordinary progress has been made in charting the maturation of hematopoietic cells. However, ... more Extraordinary progress has been made in charting the maturation of hematopoietic cells. However, these charted processes do not necessarily represent obligate pathways to specialized types of lymphocytes. In fact, there is a degree of plasticity associated with primitive progenitors. Moreover, all lymphocytes of a given kind are not necessarily produced through precisely the same sequence of events. Particularly contentious is the nature of cells that seed the thymus, because different progenitors can generate T cells under experimental circumstances. Non-renewing progenitors with a high density of c-Kit in bone marrow are likely to replenish the thymus under normal circumstances and most closely resemble canonical T cell progenitors.

Bio-protocol, 2014

[Abstract] This protocol is useful to determine the frequencies of lymphohematopoietic progenitor... more [Abstract] This protocol is useful to determine the frequencies of lymphohematopoietic progenitors in tested samples. To effectively support the growth and differentiation of primitive lymphohematopoietic progenitors, complex signals from stromal cells are important. Several stromal cell lines are known to support both lymphoid and myeloid cells simultaneously in mouse. In this protocol, we introduce two stromal co-culture systems for murine lymphohematopoietic progenitors and their application for limiting dilution assays.

Blood, Nov 18, 2011

Abstract 2106 Introduction: Anamorsin (AM, also called CIAPIN-1) is an anti-apoptotic factor, whi... more Abstract 2106 Introduction: Anamorsin (AM, also called CIAPIN-1) is an anti-apoptotic factor, which we originally isolated as a molecule that confers factor-independent survival of hematopoietic cells (J.Exp.Med. 199:581–592, 2004). AM has no structural homology to any known anti-apoptosis molecules such as Bcl-2 and IAP family members. AM-deficient (AM−/−) mice are embryonic lethal at late gestation. Its embryos are anemic and the size of embryos is very small. It is thought that AM plays a crucial role in hematopoiesis, however the precise biological mechanisms of AM remain unclear. Recently, it was reported that the yeast AM homolog, Dre2, was implicated in cytosolic iron-sulfur (Fe/S) cluster assembly (Zhang Y., et al. Mol.Cell.Biol. 28:5569-5582, 2008). The AM carries conserved cysteine motifs (CX2CXC and twin CX2C) at its C termini, which may form iron binding sites. In this study, we have focused on the possibility that AM may be involved in the cellular iron regulation. Methods and Results: At first, in order to analyze molecular and cellular events, we established cell lines from wild-type or AM-deficient embryonic fetal liver (14.5dpc) by using SV40 large T antigen. We isolated 5 wild-type cell lines (AM WTs) and 2 AM-deficient cell lines (AM KOs) respectively. Next, we compared the cell growth and apoptosis in both cell lines and found that the growth rate of AM KOs were slightly lower than that of AM WTs although these cell lines were immortalized. AM KOs showed more significant apoptosis induced by oxidative stress; the percents of Annexin V positive fraction were 12 ± 4 and 36 ± 6 in AM WTs and AM KOs respectively under the condition of 0.1mM H2O2 for 16hr. In addition to oxidative stress, AM KOs were more sensitive to UV irradiation. These differences were cancelled by transduction of AM-expression retrovirus vector in AM KOs. It was reported that Dre2 functions in cytosolic Fe/S protein biogenesis. We examined whether AM might be involved in the maturation of cytosolic Fe/S proteins. Iron regulatory protein 1 (IRP1) is a well-known cytosolic Fe/S protein with dual functions; in the presence of an [4Fe-4S] cluster it functions as a cytosolic aconitase, while IRP1 binds to mRNA stem-loop structures called iron responsive elements (IREs) and confer the mRNA stability when the [4Fe-4S] cluster is missing. In the iron-deficient cells, IRP1 binds to IREs located at the mRNA of iron transferrin receptor (TfR), ferritin and other iron metabolism transcripts, thereby enhancing iron uptake. In this way, it is thought that IRP1 plays important roles in iron homeostasis. We therefore compared the aconitase activity and IRE binding activities of IRP1 between AM WTs and AM KOs and found that AM deficiency resulted in the decrease of cytosolic aconitase activity (approximately 30% compared to AM WTs). In contrast to cytosolic aconitase activity, the mitochondrial aconitase activity showed little change regardless of AM deficiency. In order to analyze whether AM deficiency might increase IRE binding activity of IRP1, cytoplasmic extracts of AM WTs and AM KOs were compared by RNA precipitation assay. In AM KOs, the expression level of IRP1 decreased approximately one third compared to AM WTs. However, the binding activity of IRP1 to biotin-labeled IRE increased in the extract of AM KOs approximately three-fold in comparison to AM WTs. These differences was cancelled by transduction of AM-expression retrovirus vector to AM KOs. All these findings demonstrated the involvement of AM in the maturation of the cytosolic Fe/S protein, IRP1. Furthermore, we examined the expression of TfR, which is known to be modulated by IRP1-mediated posttranscriptional regulation. In the presence of iron chelator, desferrioxamine, the expression of TfR in AM WTs was markedly elevated. On the other hand, in AM KOs, the expression of TfR was hardly elevated. Thus, it was showed that AM deficiency impaired the iron homeostasis and conferred low sensitivity for iron concentration due to the decreased function of IRP1. Conclusion: Our current findings indicate that AM is essential for cytosolic Fe/S cluster biogenesis and iron homeostasis. Now the influence of the AM-mediated iron homeostasis on hematopoiesis is under investigation. Disclosures: No relevant conflicts of interest to declare.

Blood, Nov 19, 2010

Abstract 836 Although hematopoietic stem cells (HSC) are capable for reconstituting all hematopoi... more Abstract 836 Although hematopoietic stem cells (HSC) are capable for reconstituting all hematopoietic lineages in serial transplantation experiments, they undergo substantial age-related changes. Indeed, many studies have suggested that the immune system qualitatively and quantitatively changes along aging, including the selective loss of lymphopoietic potential. Lymphocyte progenitors explosively expand in fetal liver, but after birth their production sifts to bone marrow (BM) and becomes stable. Thereafter, replenishment of the adaptive immune system declines with age. If key inducers priming lymphoid lineage in HSC can be identified, they would be practical for expanding lymphocytes in culture for clinical purposes. Additionally, exogenous manipulation of their expression might boost the immune systems of immuno-compromised and/or elderly people. A primary aim of the present work was to describe molecular signatures of early stages of lymphopoiesis. Our previous studies developed a method to isolate Rag1+ early lymphocyte progenitors (ELP) from the Lineage marker- Sca-1+ c-kitHi (LSK) HSC-enriched fraction using Rag1/GFP reporter mice. We exploited the method and performed microarray analyses to compare gene expression patterns between HSC and ELP. While many molecules specific for the lymphoid lineage including T cell receptor and immunoglobulin heavy chain were highly induced at the ELP stage, some lymphoid-related genes were already expressed in the HSC-enriched fraction. In addition, our search identified many signal transduction kinases of whose function in lymphopoiesis is unknown. We then sought candidate genes governing the early lymphoid program with the goal of discovering molecules involved in the HSC to lymphoid lineage transition. Chromatin modifiers particularly drew our attention because of their ability to control spatial and temporal expression of essential genes. As a result, we identified Special AT-rich Sequence Binding 1 (SATB1) whose expression was faint in HSC and markedly up-regulated in ELP. SATB1, originally identified as a protein binding to the enhancer region of the IgH gene, is recently attracting considerable attention as a global transcription organizer for various genes. Our real-time RT-PCR analyses revealed that Satb1 expression remarkably increases along the differentiation of HSC to lymphoid-primed multipotent progenitors and ELP. In contrast, it was significantly down-regulated in the Lineage marker- Sca-1- c-kitHi myeloid progenitors. Interestingly, our analyses also found approximately 2-fold reduction of Satb1 transcripts in the Rag1/GFP- LSK cells of aged BM. In functional assays, adult BM-derived Flt3-LSK cells were retrovirally transduced with SATB1 and cultured in various conditions. In stromal cell co-cultures that support the growth of B lymphocytes and myeloid cells, the SATB1 transduction gave rise to 50–300 fold more CD19+ CD45R/B220+ Mac1- B lineage cells. In stromal-free cultures containing SCF, Flt3-ligand and IL7, SATB1 transduction also strongly induced B lineage cell production. On the other hand, methylcellulose colony assays showed 2-fold reduction of CFU-GM colony formation from SATB1-transduced cells compared to Mock-transduced cells. Next we examined if the exogenous expression of SATB1 promotes B lymphocyte growth from embryonic stem (ES) cells. SATB1 overexpression effectively promoted B1-B cell growth from mouse ES cells in OP9 co-culture system. Furthermore, we found that exogenous SATB1 expression partly restored the lymphopoietic potential in aged BM HSC that are compromised in lymphopoietic activity. Finally, we performed microarray analyses comparing SATB1- and Mock-transduced Flt3- LSK cells to seek candidate genes involved in the SATB1 function. While neither Pu.1, Ikaros, E2a, nor Notch1 was affected, some lymphoid-related genes, such as Sp4, Maf and Rag1, were increased in SATB1-overexpressed HSC. In conclusion, our results indicate that SATB1 plays critical roles in producing lymphoid lineage from primitive stem/progenitor cells. The findings are providing important information regarding how the earliest step of lymphopoiesis is epigenetically regulated and how modulation of the process might be useful to induce or rejuvenate the immune system. Disclosures: No relevant conflicts of interest to declare.

Blood, Nov 16, 2008

Sir2 (silent information regulator 2) is a member of a gene family (sirtuins) encoding NAD(+)-dep... more Sir2 (silent information regulator 2) is a member of a gene family (sirtuins) encoding NAD(+)-dependent histone deacetylases, which leads to increased DNA stability and prolonged lifespan in Saccharomyces cerevisiae and Caenorhabditis elegans. In mammalians, SIRT1 has also been found to function as a deacetylase for numerous protein targets involved in various cellular pathways, including stress responses, apoptosis, and neural axonal degeneration. However, the effects of SIRT1 on hematopoiesis remains unknown. We previously reported that the SIRT1 inhibitor, nicotinamide(NA), promoted the differentiation of murine hematopoietic stem/progenitor cells, and its activator, Resveratrol, suppressed the differntiation. In this report, we analysed the differentiation of stem/progenitor cells derived from SIRT1 KO mice. Because SIRT1 KO mice can survive less than a week after birth, we performed experiments using c-Kit(+)Lineage(−)Sca-1(+) cells (KSLs) derived from KO mice fetal liver. At first, we cultured KSLs with the cytokine cocktail containing SCF, IL-6, Flt3L, and TPO, which is utilized for the expansion of stem cells. After five day culture, we estimated the population which remains in KSL fraction. As a result, percentage of KSLs from KO fetal liver was less than 5%, while that from WT was about 15%. We also examined the colony formation of KO and WT fetal liver KSL cells using replating assays. At the first plating, total number of colonies developed from KO fetal liver KSLs was smaller than that from WT by 30–40%, and at the third plating, there could be detected no colonies from KO, while 20–30 colonies were observed from WT. Furthermore, we performed serial transplantation assays using WT and KO fetal liver KSLs. Although after primary transplant, we detected no significant difference in repopulation from KO KSLs compared to WT controls, three weeks after secondary transplant, % chimerism from KO KSLs was reduced to 1/2 compared with that from WT KSLs. These results suggested that Sirt1 suppresses the differentiation and promotes self-renew of hematopoietic stem/progenitor cells. To dissect the roles of target molecules of Sirt1 in suppression of differentiation, we first examined the mRNA expressions of some cell cycle-relating molecules in KO and WT fetal liver KSLs. As consequence, p16Ink4A and p19Arf were detected only in KO KSLs. Then we analyzed the roles of molecules which may effect those expressions. First, we examined the effects of MAPkinases inhibitors on the differentiation of KO and WT fetal liver KSLs. During the culture with SCF, IL-6, Flt3L, and TPO, the addition of p38 inhibitor(SB202190), or MEK1 inhibitor(PD98059), or JNK inhibitor did not change the effects of the SIRT1 targeting. Then it was suggested that MAPkinase pathways have little relation with the SIRT1-induced suppression of differentiation. Next we examined the role of p53, which was reported to combine with SIRT1 and to be deacetylated and repressed by SIRT1. KO and WT fetal liver KSLs were cultured with p53 inhibitor (pifithrin?), which partially cancelled the promotion of differntiation in SIRT1 KO KSLs. This result suggested that SIRT1 might inhibit differentiation of KSLs partially by antagonizing p53 activity. Next we examined the role of Foxo3a, a downstream molecule of SIRT1. Enforced expression of constitutive active form of Foxo3a(FKHRL1TM) also cancelled the promotion of differentiation in SIRT1 KO KSLs. As conclusion, we demonstrate that SIRT1 suppresses the differentiation of hematopoietic stem/progenitor cells by antagonizing p53 and enhancing Foxo3a activities, and contributes to maintenance of stem cell properties and stem cell pool.

Journal of Immunology, Jul 1, 2012

Whereas most hematopoietic stem cells (HSC) are quiescent in homeostasis, they actively prolifera... more Whereas most hematopoietic stem cells (HSC) are quiescent in homeostasis, they actively proliferate in response to bone marrow (BM) injury. Signals from the BM microenvironment are thought to promote entry of HSC into the cell cycle. However, it has been cumbersome to assess cycle status of viable HSC and thus explore unique features associated with division. In this study, we show that expression of endothelial cell-selective adhesion molecule (ESAM) can be a powerful indicator of HSC activation. ESAM levels clearly mirrored the shift of HSC between quiescence and activation, and it was prominent in comparison with other HSC-related Ags. ESAM hi HSC were actively dividing, but had surprisingly high long-term reconstituting capacity. Immunohistochemical analyses showed that most ESAM hi HSC were located near vascular endothelium in the BM after 5-fluorouracil treatment. To determine the importance of ESAM in the process of BM recovery, ESAM knockout mice were treated with 5-fluorouracil and their hematopoietic reconstruction was examined. The ESAM deficiency caused severe and prolonged BM suppression, suggesting that ESAM is functionally indispensable for HSC to re-establish homeostatic hematopoiesis. With respect to intracellular regulators, NF-kB and topoisomerase II levels correlated with the ESAM upregulation. Thus, our data demonstrate that the intensity of ESAM expression is useful to trace activated HSC and to understand molecular events involved in stem cell states.

Blood, Dec 6, 2014

Understanding lineage specific markers contributes to investigation into lineage commitment proce... more Understanding lineage specific markers contributes to investigation into lineage commitment processes in hematopoiesis. Particularly in the human study, information about hematopoietic lineage divergence is essential to refine hematopoietic lineage tree. Lineage markers are also potentially useful for therapeutic target, such as CD20 in B-cell lymphoma, and CD33 in acute myeloid leukemia. We have recently reported that special AT-rich sequence-binding protein 1 (SATB1), a global chromatin organizer, promotes lymphocyte production from hematopoietic stem cells (HSCs) (Immunity 38;1105, 2013). Expression level of SATB1 increases with early lymphoid differentiation, whereas it is shut off in committed myeloid progenitors. To search a novel cell surface molecule that marks the point of branching lineage along early myeloid and lymphoid differentiation, we performed microarray analyses comparing SATB1-overexpressed HSCs with mock-transduced HSCs. The results drew our attention to membrane-spanning 4-domains, subfamily A, member 3 (MS4A3). MS4A3, also called hematopoietic cell-specific transmembrane 4 (HTm4), is a member of the MS4A family. CD20, encoded by MS4A1 gene, belongs to the same family. We observed that expression level of MS4A3 in SATB1-overexpressed HSCs was decreased almost one tenth of that of mock HSCs. To confirm the relationship of SATB1 and MS4A3 in human hematopoietic cells, we first used chronic myeloid leukemia cell line K562, which was found to clearly express MS4A3 on their cell surface. While SATB1 expression was undetectable in original K562 cells, the exogenous expression of SATB1 significantly reduced their MS4A3 expression level, suggesting that SATB1 negatively regulates MS4A3 expression in human cells. Next, we analyzed MS4A3 expression pattern in primary human hematopoietic stem/progenitor cells. Bone marrow (BM) cells were obtained from healthy donors or patients with acute myeloid leukemia. The Institutional Review Board of Osaka University School of Medicine approved all of protocols, and written informed consents were obtained from all participants. Mononuclear cells were separated from the BM samples by density gradient centrifugation, and subsequently applied to cell sorting for Lineage marker-negative (Lin-) CD34+ CD38- HSCs, Lin- CD34+ CD38+ IL-3 receptor α (IL-3Rα)+ CD45RA- common myeloid progenitors (CMPs), Lin- CD34+ CD38+ IL3-Rα+ CD45RA+ granulocyte-macrophage progenitors (GMPs) and Lin- CD34+ CD38+ IL-3Rα- CD45RA-megakaryocyte-erythroid progenitors (MEPs). MS4A3 expression levels of the sorted cells were analyzed with real-time RT-PCR. We detected more than 10-fold amount of MS4A3 transcripts in CMPs than HSCs. Furthermore, its expression level continuously increased along myeloid lineage differentiation to GMP. On the other hand, megakaryocyte-erythroid lineage differentiation was not accompanied by MS4A3 expression and the amount of MS4A3 transcripts in MEPs was minimum as in HSCs. Flow cytometry analyses confirmed that HSCs and MEPs do not express MS4A3 on their cell surface whereas the MS4A3 expression on CMPs and GMPs is detectable. Further, the Lin- CD34+ CD38+ CD33+ cells could be fractionated according to the intensity of cell surface MS4A3 expression. To investigate the significance of cell surface MS4A3 expression for functional analyses of myeloid progenitor cells, we performed methylcellulose colony-forming assays. We found that MS4A3+ cells in Lin- CD34+ CD38+ CD33+ fraction only produced granulocyte/macrophage colonies, losing erythroid colony- and mixed colony-forming capacity. These results suggest that cell surface expression of MS4A3 is useful to distinguish granulocyte/macrophage lineage-committed progenitors from other lineage-related ones in early human hematopoiesis. We also analyzed MS4A3 expression in BM cells obtained from patients with acute leukemia. Flow cytometry analyses revealed that leukemia cells of some patients expressed substantial amount of cell surface MS4A3. In conclusion, MS4A3 is useful to monitor early stage of myeloid differentiation in human hematopoiesis. In addition, our findings of MS4A3 expression on myeloid leukemia cells, while no expression on normal HSCs, imply that MS4A3 might be a therapeutic target molecule in myelogenous leukemia. Further studies would clarify the application of MS4A3 to anti-leukemia therapy. Disclosures No relevant conflicts of interest to declare.

Blood, Nov 16, 2012

Abstract 610 Introduction: Iron has crucial roles in many cellular biological processes. Cellular... more Abstract 610 Introduction: Iron has crucial roles in many cellular biological processes. Cellular iron uptake and export must be tightly regulated. Insufficient iron concentrations impair the function of numerous iron proteins, whereas excess free iron can oxidize and damage the contents of cells. Anamorsin (AM, also called CIAPIN-1) is an anti-apoptotic factor, which we originally isolated as a molecule that confers factor-independent survival of hematopoietic cells. AM-deficient mice are embryonic lethal at late gestation due to the defect of definitive hematopoiesis. It is thought that AM plays a crucial role in hematopoiesis, however its precise biological mechanisms remain unclear. Recently, it was reported that the yeast AM homolog, Dre2, was implicated in cytosolic iron-sulfur (Fe/S) cluster assembly (Zhang Y., et al. Mol.Cell.Biol. 28:5569–5582, 2008). The AM carries conserved cysteine motifs (CX2CXC and twin CX2C) at its C termini, which may form iron binding sites. In this study, we have focused on the possibility that AM may be involved in the maturation of Fe/S cluster and the cellular iron homeostasis, especially, the regulation of labile iron pool (LIP) and that AM may affect the accumulation of reactive oxygen species (ROS), leading to impaired erythropoiesis. Methods and Results: To analyze the function of Fe/S protein, we established wild-type cell lines (AMWT) and AM-deficient cell lines (AMKO) from wild-type and AM-deficient fetal liver (14.5dpc) respectively by using SV40 large T antigen. Iron regulatory protein 1 (IRP1) is a well-known Fe/S protein with dual functions. In the presence of Fe/S cluster, IRP1 functions as a cytosolic aconitase. While, in the absence of Fe/S cluster, IRP1 stabilizes the transferrin receptor (TfR) mRNA by binding to the iron responsive element (IRE). We compared the aconitase activity and the IRE binding activity of IRP1 between AMWT and AMKO. The results showed that the cytosolic aconitase activity in AMKO decreased approximately 30% compared to AMWT and the IRE binding activity of IRP1 in AMKO increased 3-fold compared to AMWT. Furthermore, we compared the iron homeostasis. In the presence of iron chelator, desferrioxamine, the expression of TfR in AMWT was markedly elevated, while it was hardly elevated in AMKO. The LIP is a pool of chelatable and redox-active iron, which serves as a crossroad of cell iron metabolism. The measurement of LIP with the metal-sensitive sensor calcein acetoxymethyl ester showed that AMKO had 5-fold higher cellular LIP than AMWT. Moreover we evaluated the accumulation of ROS and the induction of apoptosis by extracellular iron uptake between AMWT and AMKO. The results showed the accumulation of ROS and the induction of apoptosis in AMKO were enhanced about twice as much as in AMWT. These enhancements could be restored by transduction of AM expressing retrovirus vector to AMKO. We also evaluated the effects of AM-deficiency on erythroid differentiation. Fetal liver cells from wild-type or AM-deficient embryos (14.5dpc) were divided into primitive and more matured erythroid populations based on their expression of CD71 and Ter119 by FACS analysis. AM-deficient fetal liver cells had a significant increase in the CD71low TER119low population, containing primitive erythroid progenitors, compared to wild-type (9.4±2.1% vs. 5.2±1.1%, P<0.05). Conversely, the CD71lowTER119highpopulation, comprised of late orthochromatophilic erythroblasts and reticulocytes, decreased in AM-deficient fetal liver cells compared to wild-type cells (2.3±0.8% vs. 7.4±1.3%, P < 0.05). Moreover we studied LIP in wild-type or AM-deficient embryo fetal liver cells. In accordance with the cell lines, the LIP in AM-deficient fetal liver cells increased 3 to 5-fold more than in wild-type fetal liver cells. The accumulation of ROS and the number of apoptotic cells also increased 2 to 5-fold in AM- deficient fetal liver cells compared to wild-type fetal liver cells. Thus, it was showed that AM deficiency impaired the iron homeostasis and conferred low sensitivity for iron concentration, resulting in the increase of LIP, the accumulation of ROS and the induction of apoptosis. Furthermore, dysregulation of cellular iron homeostasis was thought to be the cause of the embryonic lethal due to AM deficiency. Conclusion: Our current findings indicate that AM functions in cytosolic Fe/S cluster biogenesis and iron homeostasis and is essential for…

Blood, Nov 15, 2013

Endothelial cell-selective adhesion molecule (ESAM) is a lifelong marker of hematopoietic stem ce... more Endothelial cell-selective adhesion molecule (ESAM) is a lifelong marker of hematopoietic stem cells (HSCs). Although we previously elucidated the functional importance of ESAM in HSCs in stress-induced hematopoiesis in adults, it is unclear how ESAM affects hematopoietic development during fetal life. To address this issue, we analyzed fetuses from conventional or conditional ESAM-knockout mice. Approximately half of ESAM-null fetuses died after mid-gestation due to anemia. RNA sequencing analyses revealed downregulation of adult-type globins and Alas2, a heme biosynthesis enzyme, in ESAM-null fetal livers. These abnormalities were attributed to malfunction of ESAM-null HSCs, which was demonstrated in culture and transplantation experiments. Although crosslinking ESAM directly influenced gene transcription in HSCs, observations in conditional ESAM-knockout fetuses revealed the critical involvement of ESAM expressed in endothelial cells in fetal lethality. Thus, we showed that ESAM had important roles in developing definitive hematopoiesis. Furthermore, we unveiled the importance of endothelial ESAM in this process.

Blood, Dec 3, 2015

Murine hematopoietic stem cells (HSCs) can be isolated with high efficiency as Lineage- Sca-1+ c-... more Murine hematopoietic stem cells (HSCs) can be isolated with high efficiency as Lineage- Sca-1+ c-kitHigh (LSK) CD34-/Low CD150+ CD48- cells. In humans, however, the same method is not useful because of critical differences between murine and human HSC phenotypes. Such discrepancy has hampered the translation of findings in mice into a human preclinical or clinical context. Therefore, the identification of common HSC antigens between the two species would be a significant advance with respect to translational studies of HSC biology. We previously identified endothelial cell-selective adhesion molecule (ESAM) as a novel maker for HSCs in mice (Blood, 2009). We also found that ESAM is functionally important for murine HSCs to reconstitute hematopoiesis after 5-FU treatment (J Immunol, 2012). In the present study, we have extended our research of ESAM to human HSCs and leukemia. We first examined whether ESAM expression showed potential as a marker of human HSCs. In addition to adult BM, the majority of CD34+ CD38- cells in cord blood (CB) and G-CSF mobilized peripheral blood expressed ESAM. The addition of anti-CD90 and CD45RA antibodies divides the adult BM CD34+ CD38- fraction into three subpopulations, namely HSCs, multipotent progenitors (MPPs), and multi-lymphoid progenitors (MLPs). We found that HSCs expressed high levels of ESAM whereas MPPs expressed lower levels and many MLPs lost ESAM expression. Functional assessment for ESAM-/Low and ESAMHigh cells in the CD34+ CD38- fractionconfirmed that high ESAM expression distinguishes progenitors that are more primitive and multipotent. We also identified a subset of CD34+ CD38- cells in adult BM and CB that expressed extremely high levels of ESAM, namely ESAMBright cells. Gene expression profiles of the CD34+ CD38- ESAMHigh and CD34+ CD38- ESAMBright populations showed that the former cells expressed HSC-related genes whereas the latter showed more endothelial-related profiles. Indeed, the CD34+ CD38- ESAMBright cells produced CD31+ endothelial cells, but not CD45+ hematopoietic cells, in co-culture with MS5 stromal cells. These results suggest that the CD34+ CD38- fraction, which is conventionally considered the human HSC fraction, also contains a substantial number of non-hematopoietic progenitors. Thus, the inclusion of ESAM provides a more accurate estimation of HSC numbers. Since some of HSC-related antigens are useful for determining leukemia lineage and have utility as prognostic indicators, we determined whether ESAM might also be a valuable addition to this antigen panel. First, we examined human leukemia cell lines. Tested myeloid leukemia lines including KG-1a, HL60, THP1, U937 and Kasumi were uniformly negative for ESAM expression. Jurkat and MOLT4, lymphoid lineage lines were also negative. On the other hand, HEL, an erythroid leukemia cell line, and CMK, a megakaryocytic leukemia cell line, exhibited high expression of ESAM. Additionally, K562 cells, which originated from CML that subsequently transformed into acute erythro-leukemia, also express ESAM. We then evaluated ESAM expression on primary acute leukemia cells, which were isolated from patients upon diagnosis. Interestingly, while all of ALL cases were virtually negative for ESAM, more than half of AML cases were ESAM-positive. Notably, the ESAM expression pattern on AML cases substantially differs even in the same FAB classification. We inferred that AML cells might change their ESAM expression levels according to cell intrinsic features and/or the surrounding environment in vivo. Therefore, we inoculated ESAM- KG-1a cells into NOD/SCID mice and harvested reconstituted KG-1a (rKG-1a) cells after the inoculation. They were then cultured in vitro and inoculated again into NOD/SCID mice. FACS analyses revealed that, although parental KG-1a cells were ESAM-negative, rKG-1a cells expressed a substantial amount of ESAM. Notably, rKG-1a cells were more aggressive and killed the recipient mice in a shorter period. This observation indicates that leukemia cells change their surface phenotype according to the environment, and that ESAM expression may be related to the acquisition of a more aggressive phenotype. In conclusion, we demonstrate that ESAM is a reliable marker of HSCs in humans as well as in mice. Additionally, ESAM is expressed on some of human acute leukemia cells and might be useful for lineage determination and as prognostic indicator. Disclosures Yokota: SHIONOGI…

Blood, Nov 16, 2005

AML1 (RUNX1) is a family member of heterodimeric transcription factors named core binding factors... more AML1 (RUNX1) is a family member of heterodimeric transcription factors named core binding factors (CBFs). AML1 binds to its target DNA through the RUNT domain and is frequently involved in chromosomal translocations associated with human leukemias. Also, AML1 was found to be mutated in a substantial fraction of myelodysplastic syndrome (MDS) patients. Although most of AML1 mutations identified in AML patients were located in the N-terminal region, the C-terminal mutaions yielding mutant AML lacking the C-terminal domain (AML1dC) were frequently observed in MDS patients. Based on the fact that the haploinsufficiency of AML1, which results from heterozygous missense mutation of the AML1 gene, causes familial platelet disorder (FPD) with predisposition to AML, and that the conditional deletion of the AML1 gene using the Cre-LoxP system in adult mice results in the failure of megakaryopoiesis and subsequent platelet production, we speculate that AML1 might be involved in the thrombopoietin (TPO)/c-Mpl (its receptor) system, which is a major regulator of this process. Also, we examined the mechanism through which AML1dC affects the function of wtAML1. At first, we examined the role of AML1 in the regulation of the c-mpl promoter with luciferase assays. In 293T cells, we found that wild-type AML1 (wtAML1) activated the c-mpl promoter by 3.5 fold. This effect was dose-dependently inhibited by a dominant-negative form of AML1, AML1-MTG8. In addition, we found that AML1dC inhibited the function of wtAML1 with efficiencies similar to AML1-MTG8 (or with lesser efficiencies than AML1-MTG8). Next, we tried to determine the element responsive to AML1 in the c-mpl promoter. Using various mutants of the c-mpl promoter, we found that wtAML1 activates the element between −135 and −116, which contains the typical AML1-binding sequence. Furthermore, we confirmed that wtAML1 bound to this element in electrophoretic mobility shift assays using nuclear extract of 293T cells transfected with wtAML1. Also, in this assay, we found that AML1dC bound to the consensus DNA sequence more strongly than wtAML1 and inhibited the DNA-binding of wtAML1 competitively. Next, we examined the roles of AML1 in the c-Mpl expression in hematopoietic cells by expressing AML1dC in the OP-9 system, in which hematopoietic cells develop from embryonic stem (ES) cells during the coculture with OP-9 cells. In contrast to the results obtained from 293T cells, when AML1dC was inducibly expressed with the Tet-off system, c-Mpl was expressed more intensely in Lin−Sca1+ hematopoietic stem/progenitor cells than mock-transfected Lin−Sca1+ cells, indicating that AML1 is a negative regulator of the c-Mpl expression in hematopoietic stem/progenitor cells. In contrast, the surface expression of c-Mpl in mature megakaryocytes was hardly affected by AMLdC in the OP-9 system. We also examined the effects of AML1 on the c-Mpl expression in normal murine bone marrow Lin−Sca-1+ cells by expressing AML1dC with the retrovirus system. As a result, we again found that AML1dC enhanced the c-Mpl expression in murine Lin−Sca-1+ cells. Together, our results indicate that AML1 regulates the c-Mpl expression both positively and negatively according to cell types (cf, 293T cells, hematopoietic stem/progenitor cells, and megakaroycytes). Particularly, although AML1 was previously reported to positively regulate of the c-Mpl expression in megakaryocytes, it was supposed be a negative regulator in hematopoietic stem/progenitor cells.

Bio-protocol, 2014

1. Mouse spleen cells or ES-derived hematopoietic cells 2. DNA extraction Kit: PerfectPure DNA Cu... more 1. Mouse spleen cells or ES-derived hematopoietic cells 2. DNA extraction Kit: PerfectPure DNA Cultured Cell Kit (5 PRIME, catalog number: 2302000) 3. 10x PCR Buffer with KCl (Life Technologies, Applied biosystems®) 4. MgCl2 (Life Technologies, Applied biosystems®) 5. Taq DNA polymerase (Life Technologies, Applied Biosystems®, catalog number: 4338856) 6. dNTPs (Life Technologies, Applied Biosystems®) 7. Primers (FASMAC) The sequence of primers are as follows. a. DHL(5’), GGAATTCG(AorC)TTTTTGT(CorG)AAGGGATCTACTACTGTG b. Mu0(5’), CCGCATGCCAAGGCTAGCCTGAAAGATTACC c. J3(3’), GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG 8. Agarose (UltraPureTM Agarose) (Life Technologies, InvitrogenTM, catalog number: 16500-100) 9. Ethidium bromide (Wako Pure Chemical Industries, catalog number: 315-90051)

Blood, Dec 3, 2015

Background: Lifelong hematopoiesis is maintained by cell differentiation in which signaling pathw... more Background: Lifelong hematopoiesis is maintained by cell differentiation in which signaling pathways and transcription factors coordinately induce step-wise maturation of hematopoietic stem cells (HSCs) toward downstream effector cells. In addition, the organization of chromatin structure that creates accessible sites of target genes is also essential so as to ensure temporally and spatially adequate control of internal gene expression. Murine HSCs can be isolated with high efficiency using surface molecules including lineage-related markers, c-Kit, Sca-1, Flt3 and SLAM family proteins. However, even the highly enriched HSC fraction is still heterogeneous regarding differentiation potential, and how the HSC diversity reflects the heterogeneity of intrinsic gene-expression in HSCs is as-yet-unknown. We previously identified Special AT-rich Sequence Binding protein 1 (SATB1), a global chromatin regulator, as a lymphoid-related gene in the HSC differentiation (Satoh and Yokota et al. Immunity 2013). Indeed, SATB1 overexpression strongly enhanced both T and B lymphopoietic potential of murine HSCs whereas SATB1 deficiency caused malfunctions of HSCs in the lymphopoietic activity. Furthermore, another report showed that SATB1-deficient HSCs were less quiescent in transplanted recipients and more prone to differentiate preferentially to myeloid-erythroid lineages (Will et al. Nat Immunol 2013). These results suggested that SATB1 is likely indispensable not only for the lymphopoietic potential but also for the integrity of HSCs. Here, to better understand the mechanism how SATB1 influences homeostatic HSC functions in adult bone marrow (BM), we have developed a new mouse model in which SATB1 expression can be precisely monitored along the HSC differentiation. Methods: The Tomato gene, coding a red fluorescent protein, was knock-in to the coding region of endogenous Satb1 gene. The heterozygous SATB1/Tomato knock-in mice in which one Satb1 allele was replaced with the Tomato were used to sort HSCs in adult BM. The sorted cells were evaluated for the differentiation potential with methylcellulose colony assays and co-cultures with MS5 stromal cells. Further, the long-term reconstitution ability was evaluated by transplantation to lethally irradiated mice. To obtain transcriptome information, total RNA was isolated from SATB1/Tomato- and SATB1/Tomato+ HSCs, and then next-generation sequencing was performed. The data were analyzed with the Ingenuity Pathway Analysis software. Results: We defined Lin- Sca1+ c-KitHi (LSK) CD150+ Flt3- cells as HSCs, especially adopting FLT3- to exclude FLT3+ lymphoid-primed multipotent progenitors from our functional analyses. We found that the LSK CD150+ Flt3- fraction contains substantial number of SATB1/Tomato+ cells. While both SATB1/Tomato- and SATB1/Tomato+ HSCs produced numerous CFU-Mix and CFU-GM/G/M colonies, the latter were less potent to produce BFU-E. In co-culture with MS5 stromal cells that support B and myeloid lineages, the output of B lineage cells from SATB1+ HSCs was more robust than that of SATB1- HSCs. Upon transplantation, enhanced B-lineage engraftment was observed in the SATB1+ HSC-transplanted recipients. Interestingly, while the two types of HSCs showed obvious difference in the differentiation potential toward lymphoid or myeloid lineage, both HSCs reconstituted the LSK CD150+ Flt3- fraction that similarly contained SATB1/Tomato- and SATB1/Tomato+ cells. With the RNA-sequencing data of SATB1- and SATB1+ HSCs, biological pathway analyses revealed that the…

Blood, Feb 15, 1999

A unique subclone of a bone marrow-derived stromal cell line, BMS2.4, produces soluble factors th... more A unique subclone of a bone marrow-derived stromal cell line, BMS2.4, produces soluble factors that inhibit proliferation of several types of hematopoietic cell lines. An understanding of these molecules may be informative about negative regulatory circuits that can potentially limit blood cell formation. We used expression cloning to identify interleukin-6 (IL-6) as one factor that suppressed growth of a pre-B-cell variant line, 1A9-M. Moreover, IL-6 induced macrophage-differentiation and apoptosis of 1A9-M cells. During this process, IL-6 downregulated expression of BCL2 in 1A9-M cells and stimulated BCL-XL expression, but had no effect on p53, Bax, or Bak gene expression. Mechanisms for transduction of IL-6-induced signals were then evaluated in IL-6-stimulated 1A9-M cells. Whereas the signal transducer and activator of transcription 3 (Stat3) was phosphorylated and activated, there was no effect on either Stat1 or Stat5. The importance of BCL2 and Stat3 on IL-6-induced macrophage-differentiation and apoptosis was studied with 1A9-M cells expressing human BCL2 or a dominant-negative form of Stat3, respectively. IL-6-induced apoptosis, but not macrophage-differentiation, was blocked by continuously expressed BCL2. A dominant-negative form of Stat3 inhibited both macrophage-differentiation and apoptosis induced by IL-6. However, diminished Stat3 activity did not prevent IL-6-induced downregulation of the BCL2 gene. Therefore, activation of Stat3 is essential for IL-6-induced macrophagedifferentiation and programmed cell death in this model. Whereas overexpression of BCL2 abrogates the apoptotic response, Stat3-independent signals appear to downregulate expression of the BCL2 gene.