anu singh - Profile on Academia.edu (original) (raw)
Papers by anu singh
DNA Functionalized Direct Electro-Deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi
Bioelectrochemistry, 2015
Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochem... more Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25°C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.
Pharmaceutical research, 1999
Acromegaly is a symptomatically disabling condition, resulting from a growth hormone (GH) secreti... more Acromegaly is a symptomatically disabling condition, resulting from a growth hormone (GH) secreting pituitary tumor. The somatostatin analog RC- 160 is known to potently inhibit hypersecretion of GH, from pituitary adenomas. However, the therapeutic potential of RC-160, is limited by its short serum half life. To overcome this limitation, fatty acids with carbon chain lengths ranging from 4 to 18 were conjugated to RC-160. The GH-inhibitory activity of these lipopeptides, as well as their binding profile to somatostatin receptors, on the rat pituitary adenoma cell line GH3 was studied in vitro. The relative stability of lipophilized RC-160 towards degradation by crude papaya protease was also determined. The long chain lipopeptides, like myristoyl-RC-160 (carbon chain length = 14) were found to exhibit greater receptor affinity and GH-inhibitory activity, as compared to their counterparts of lower chain lengths. However, the receptor affinity and GH-inhibitory activity of stearoyl-R...
Ethnopharmacological relevance: Eclipta alba is traditionally known to potentiate hair growth pro... more Ethnopharmacological relevance: Eclipta alba is traditionally known to potentiate hair growth promotion. Aim of the study: The study was aimed to investigate the efficacy of methanol extract of Eclipta alba as hair growth promoter. Materials and methods: Pigmented C57/BL6 mice, preselected for their telogen phase of hair growth were used. In these species, the truncal epidermis lacks melanin-producing melanocytes and melanin production is strictly coupled to anagen phase of hair growth. The extract was applied topically to assess telogen to anagen transition. Immunohistochemical investigation was performed to analyze antigen specificity. Animals in anagen phase of hair growth were positive for FGF-7 and Shh and negative for BMP4, whereas the animals in telogen phase were positive only for BMP4 antigen. Results: The methanol extract of whole plant when tested for hair growth promoting potential, exhibited dose dependent activity in C57BL6 mice. The activity was assessed by studying the melanogenesis in resected skin, follicle count in the subcutis, skin thickness and surrogate markers in vehicle control and extract treated animals. Conclusion: These findings suggest that methanol extract of Eclipta alba may have potential as a hair growth promoter.
517 POSTER Preclinical development of novel betulinic acid derivatives as potent anticancer and antiangiogenic agents for systemic administration
European Journal of Cancer Supplements, 2006
Lecture Notes in Computer Science, 2009
A prominent source of complexity in the verification of ad hoc network (AHN) protocols is the fac... more A prominent source of complexity in the verification of ad hoc network (AHN) protocols is the fact that the number of network topologies grows exponentially with the square of the number of nodes. To combat this instance explosion problem, we present a query-based verification framework for AHN protocols that utilizes symbolic reachability analysis. Specifically we consider AHN nodes of the form P : I, where P is a process and I is an interface: a set of groups, where each group represents a multicast port. Two processes can communicate if their interfaces share a common group. To achieve a symbolic representation of network topologies, we treat process interfaces as variables and introduce a constraint language for representing topologies. Terms of the language are simply conjunctions of connection and disconnection constraints of the form conn(Ji, Jj) and dconn(Ji, Jj ), where Ji and Jj are interface variables. Our symbolic reachability algorithm explores the symbolic state space of an AHN in breadth-first order, accumulating topology constraints as multicast-transmit and multicast-receive transitions are encountered. We demonstrate the practical utility of our framework by applying it to the problem of detecting unresolved collisions in the LMAC protocol for sensor networks.
A methodology for in-network evaluation of integrated logical-statistical models
Proceedings of the 6th ACM conference on Embedded network sensor systems - SenSys '08, 2008
Page 1. A Methodology for In-Network Evaluation of Integrated Logical-Statistical Models Anu Sing... more Page 1. A Methodology for In-Network Evaluation of Integrated Logical-Statistical Models Anu Singh CR Ramakrishnan IV Ramakrishnan David S. Warren Jennifer L. Wong Department of Computer Science Stony Brook University ...
Surface Plasmon Resonance Based Label-Free Detection of Salmonella using DNA Self Assembly
Applied Biochemistry and Biotechnology, 2014
Typhoid is re-emerging as a biggest health threat to third world countries. One of the major chal... more Typhoid is re-emerging as a biggest health threat to third world countries. One of the major challenge is false negative diagnosis using existing immunodiagnostic methods due to overlapping symptoms of other infections (like brucellosis, malaria, hepatitis) that mimic this enteric fever (typhoid). Surface plasmon resonance (SPR) based DNA hybridisation biosensor has been fabricated by generating self-assembled monolayer of 5'-thiolated single-stranded DNA (ssDNA) probe onto gold surface. Highly specific DNA probe has been selected from conserved Vi capsular antigen gene of Salmonella enterica serovars typhi. This DNA biosensor has been investigated for label-free real-time monitoring of Salmonella. Interestingly, 0.019 ng mL(-1) (2 fM) is the lowest detected concentration in PBS with association (k a) and dissociation (k d) rate constants to be k a (M(-1) s(-1)) = 6.68 × 10(4) ± 2.3 and k d (s(-1)) = 5.6 × 10(-3) ± 0.01, respectively. This biosensor was successfully demonstrated to distinguish complementary, non-complementary and one-base mismatch sequences and reusability up to 40 hybridisation cycles at room temperature. Successful results were obtained for hybridisation studies of genomic DNA isolated from spiked urine sample. Performance characteristics of this biosensing device suggested further scope to fine-tune such DNA-based assays to be implied for clinical, food and environmental applications.
Innovations in Systems and Software Engineering, 2011
We use the Uppaal model checker for Timed Automata to verify the Timing-Sync time-synchronization... more We use the Uppaal model checker for Timed Automata to verify the Timing-Sync time-synchronization protocol for sensor networks (TPSN), the clocksynchronization algorithm of Lenzen, Locher and Wattenhofer for general distributed systems (LLW), and the clock-thread technique of the Software Monitoring with Controllable Overhead algorithm (SMCO). Clocksynchronization algorithms such as TPSN, LLW, and SMCO must be able to perform arithmetic on clock values in order to calculate clock drift and network propagation delays. They must also be able to read the value of a local clock and assign it to another local clock. Such operations are not directly supported by the theory of Timed Automata.
Proceedings of the 2007 ACM workshop on Formal methods in security engineering - FMSE '07, 2007
As security policies get larger and more complex, analysis tools that help users understand and v... more As security policies get larger and more complex, analysis tools that help users understand and validate security policies are becoming more important. This paper explores the use of deductive spreadsheets for security policy analysis. Deductive spreadsheets combine the power of deductive rules (for specifying policies and analyses) with the usability of spreadsheets. This approach is introduced with a simple example of analyzing information flow allowed by RBAC policies and then applied in two case studies: analysis of computer system configurations and analysis of Security-Enhanced Linux access control policies.
Lecture Notes in Computer Science, 2008
We present the ω-calculus, a process calculus for formally modeling and reasoning about Mobile Ad... more We present the ω-calculus, a process calculus for formally modeling and reasoning about Mobile Ad Hoc Wireless Networks (MANETs) and their protocols.
Journal of Biological Methods, 2014
Bone marrow derived dendritic cells (BMDCs) are routinely employed in cell based assays to evalua... more Bone marrow derived dendritic cells (BMDCs) are routinely employed in cell based assays to evaluate immunomodulatory and anti-inflammatory activities. Hence, simplified, stepwise, defined and standardized methods are required for isolation of bone marrow cells from mice, propagating them in presence of growth factors and obtaining high and reproducible yields of BMDCs. Here, we describe a detailed, stepwise protocol with pictorial representation to isolate bone marrow from mouse femur and development of dendritic cells. Mouse bone marrow cells are cultured in presence of granulocyte-macrophage colony stimulating factor (GM-CSF) for 6 days to generate BMDCs.
Applied Biochemistry and Biotechnology, 2014
A label-free electrochemical bianalyte immunosensor has been designed for simultaneous detection ... more A label-free electrochemical bianalyte immunosensor has been designed for simultaneous detection of lung cancer biomarkers (anti-MAGE A2 and anti-MAGE A11) using carbon nanotubes-chitosan (CNT-CHI) composite. To achieve this, acid-functionalized singlewalled CNTs were used to prepare CNT-CHI gel and electrodes were fabricated by drop casting method onto graphite surface. Lung cancer biomarkers specific antigens (Ag), i.e., MAGE A2 and MAGE A11, were covalently immobilized onto CNT-CHI/graphite electrode separately for fabrication process. Fabricated immunoelectrodes (MAGE A2/CNT-CHI/graphite and MAGE A11/CNT-CHI/graphite) were characterized at each modification step by cyclic voltammetry (CV), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM). Both immunoelectrodes showed successful detection of respective analytes (anti-MAGE A2 and anti-MAGE A11) from 5 fg mL −1 to 50 ng mL −1 using differential pulse voltammetry (DPV). Both Ag/CNT-CHI/graphite immunoelectrodes (using MAGE A2 and MAGE A11) were independently capable of distinguishing specific and nonspecific analytes like CD59, D-dimers, etc. Response studies of both immunoelectrodes revealed successful demonstration of simultaneous detection of anti-MAGE A2 and A11 independently in a single experimental run when exposed to a mixture of various analyte concentrations in different combinations irrespective of the presence of other analyte present in the same vessel.
Molecular Techniques
Chemical Analysis of Food: Techniques and Applications, 2012
International Journal of Peptide Research and Therapeutics, 2006
We describe the synthesis and anticancer activities of octapeptide analogs of somatostatin incorp... more We describe the synthesis and anticancer activities of octapeptide analogs of somatostatin incorporating a,a-dialkylated amino acids. The designed analogs of somatostatin are: D-Phe 1 -Cys 2 -Tyr 3 -D-Trp 4 -Orn 5 -Xxx 6 -Pen 7 -Thr 8 -NH 2 where Xxx=a-Aminoisobutyric acid (Aib), Diethyl glycine (Deg), 1-Aminocyclopentane carboxylic acid (Ac5c), and, D-Phe 1 -Cys 2 -Tyr 3 -D-Trp 4 -Lys 5 -Ac5c 6 -Pen 7 -Thr 8 -NH 2 (disulphide bond between Cys 2 and Pen 7 in all analogs). The conformational studies two of the designed analogs were carried out by NMR techniques and the experimental results suggest a b-turn structure for one of the designed analog. In vivo tumor regression study of two designed analogs on human primary colon tumor xenografts in nude mice demonstrates the anticancer potential of the synthesized analogs.
Toxicology and Applied Pharmacology, 1997
ergic activity of cocaine. A more satisfactory clinical ap-Cocaine Detoxification by Human Plasma... more ergic activity of cocaine. A more satisfactory clinical ap-Cocaine Detoxification by Human Plasma Butyrylcholinesterproach might be to reduce the toxicity of cocaine by accelerase. Lynch, T. J., Mattes, C. E., Singh, A., Bradley, R. M., Brady, ating its metabolic inactivation. The biological activities of R. O., and Dretchen, K. L. (1997). Toxicol. Appl. Pharmacol. 145, cocaine, as well as certain muscle relaxants (e.g., succinyl-363-371.
Combined external beam radiotherapy and Pd-103 brachytherapy boost improves biochemical failure free survival in patients with clinically localized prostate cancer: Results of a matched pair analysis
The Prostate, 2005
Dose escalation has resulted in improved biochemical control in patients with clinically localize... more Dose escalation has resulted in improved biochemical control in patients with clinically localized prostate cancer treated with conformal external beam radiation (EBRT). Conformal dose distributions may also be achieved with brachytherapy. Therefore, biochemical control was evaluated for patients treated with combined external radiation therapy and low dose rate brachytherapy (EBRT + LDR). A matched pair analysis was performed to compare biochemical control of patients treated with EBRT + LDR to patients treated with EBRT alone. The study endpoints were biochemical control and late toxicities. The 5-year biochemical failure free survival (BFFS) was 86% for patients treated with EBRT + LDR and 72% for patients treated with EBRT (P = 0.03). Both treatments were associated with comparable incidences of late genitourinary (GU) side effects (18-19%). Late rectal toxicity was decreased by 15% in patients treated with EBRT + LDR (P = 0.0003). These results support EBRT followed by brachytherapy boost as a safe and effective method for dose escalation in the treatment of prostate cancer.
Stroke, 2000
Background and Purpose-The purpose of our study was to determine the functional and neuroanatomic... more Background and Purpose-The purpose of our study was to determine the functional and neuroanatomic correlates of poststroke depressive symptoms. Methods-Patients with consecutive admissions to a regional stroke center for new-onset unilateral hemispheric stroke who met World Health Organization and National Institute of Neurological and Communicative Disorders and Stroke criteria were eligible for inclusion in a longitudinal study. Acutely, patients underwent CT scanning, and at 3 months and 1 year after stroke, depressive symptoms were assessed by using both the Montgomery-Asberg Depression Rating Scale and the Zung Self-Rating Depression Scale. The Functional Independence Measure (FIM) served as an indication of functional outcome and was obtained at 1 month, 3 months, and 1 year after stroke, along with other demographic information. The Talairach and Tournoux stereotactic atlas was used for the primary determination of CT lesion localization. Lesion proximity to the anterior frontal pole was also measured. Results-Eighty-one patients participated in the longitudinal study. Stepwise linear regression analyses generated a highly significant model (F 3,76 ϭ9.8, R 2 ϭ28%, PϽ0.0005), with lower 1-month total FIM scores, living at home, and damage to the inferior frontal region predicting higher depression scores at 3 months. Similarly, lower 3-month total FIM scores correlated with higher 3-month depression scores, and lower 1-year total FIM scores correlated with higher 1-year depression scores. Conclusions-Functional measures correlated with poststroke depression across time and, together with neuroanatomic measures, predicted depressive symptoms longitudinally. Although inferior frontal lesion location, irrespective of side, appeared to play a role as a risk factor in this study, the degree of functional dependence after stroke imparted the greatest risk. (Stroke. 2000;31:637-644.)
Substance P analogs containing α,α-dialkylated amino acids with potent anticancer activity
Journal of Peptide Science, 2007
Abstract Six analogs (peptides 16) of the potent substance P (SP) derivative known as '... more Abstract Six analogs (peptides 16) of the potent substance P (SP) derivative known as 'Antagonist D'were synthesized by substituting constrained amino acids Aib or Acp (cycloleucine, 1-amino cyclopentane carboxylic acid) at different positions in the ...
Journal of Medicinal Chemistry, 2007
A new series of 2,3-diaryl-4/5-hydroxy-cyclopent-2-en-1-one analogues replacing the cis double bo... more A new series of 2,3-diaryl-4/5-hydroxy-cyclopent-2-en-1-one analogues replacing the cis double bond of combretastatin A-4 (CA-4) by 4/5-hydroxy cyclopentenone moieties was designed and synthesized. The analogues displayed potent cytotoxic activity (IC 50 < 1 µg/mL) against a panel of human cancer cell lines and endothelial cells. The most potent analogues 11 and 42 belonging to the 5-hydroxy cyclopentenone class were further evaluated for their mechanism of action. Both of the analogues led to cell cycle arrest at G2/M phase and induced apoptosis in endothelial cells. Antitubulin property of 42 was superior to 11 and comparable to CA-4. The compound 42 had better aqueous solubility, metabolic stability, and pharmacokinetic profile than CA-4 and also demonstrated significant tumor regression in the human colon xenograft model. Our data suggests that cis-restricted analogues of CA-4 are a new class of molecules that have the potential to be developed as novel agents for the treatment of cancer. * To whom correspondence should be addressed. Phone: (91) 020-25902284 (R.D.W.); (91) 0120-4378505 (A.T.S.); (91) 0120-4378610 (M.J.). Fax: (91) 020-25902629 (R.D.W.); (91) 0120-4376902 (A.T.S. and M.J.).
Journal of Ethnopharmacology, 2008
Terminalia arjuna has been marked as a potential cardioprotective agent since vedic period. The p... more Terminalia arjuna has been marked as a potential cardioprotective agent since vedic period. The present study was aimed to investigate the effects of butanolic fraction of Terminalia arjuna bark (TA-05) on Doxorubicin (Dox)-induced cardiotoxicity. Male wistar rats were used as in vivo model for the study. TA-05 was administered orally to Wistar rats at different doses (0.42 mg/kg, 0.85 mg/kg, 1.7 mg/kg, 3.4 mg/kg and 6.8 mg/kg) for 6 days/week for 4 weeks. Thereafter, all the animals except saline and TA-05-treated controls were administered 20 mg/kg Dox intraperitonially. There was a significant decrease in myocardial superoxide dismutase (38.94%) and reduced glutathione (23.84%) in animals treated with Dox. Concurrently marked increase in serum creatine kinase-MB (CKMB) activity (48.11%) as well as increase in extent of lipid peroxidation (2.55-fold) was reported. Co-treatment of TA-05 and Dox resulted in an increase in the cardiac antioxidant enzymes, decrease in serum CKMB levels and reduction in lipid peroxidation as compared to Dox-treated animals. Electron microscopic studies in Dox-treated animals revealed mitochondrial swelling, Z-band disarray, focal dilatation of smooth endoplasmic reticulum (SER) and lipid inclusions, whereas the concurrent administration of TA-05 led to a lesser degree of Dox-induced histological alterations. These findings suggest that butanolic fraction of Terminalia arjuna bark has protective effects against Dox-induced cardiotoxicity and may have potential as a cardioprotective agent.
DNA Functionalized Direct Electro-Deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi
Bioelectrochemistry, 2015
Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochem... more Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;amine modified single stranded DNA (ssDNA, NH2-(C6)-5&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;CGTGCGCGACGCCCGCCGCC3&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;) was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25°C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;GGCGGCGGGCGTCGCGCACG 3&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;) through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids &amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;CSBF&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39; (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.
Pharmaceutical research, 1999
Acromegaly is a symptomatically disabling condition, resulting from a growth hormone (GH) secreti... more Acromegaly is a symptomatically disabling condition, resulting from a growth hormone (GH) secreting pituitary tumor. The somatostatin analog RC- 160 is known to potently inhibit hypersecretion of GH, from pituitary adenomas. However, the therapeutic potential of RC-160, is limited by its short serum half life. To overcome this limitation, fatty acids with carbon chain lengths ranging from 4 to 18 were conjugated to RC-160. The GH-inhibitory activity of these lipopeptides, as well as their binding profile to somatostatin receptors, on the rat pituitary adenoma cell line GH3 was studied in vitro. The relative stability of lipophilized RC-160 towards degradation by crude papaya protease was also determined. The long chain lipopeptides, like myristoyl-RC-160 (carbon chain length = 14) were found to exhibit greater receptor affinity and GH-inhibitory activity, as compared to their counterparts of lower chain lengths. However, the receptor affinity and GH-inhibitory activity of stearoyl-R...
Ethnopharmacological relevance: Eclipta alba is traditionally known to potentiate hair growth pro... more Ethnopharmacological relevance: Eclipta alba is traditionally known to potentiate hair growth promotion. Aim of the study: The study was aimed to investigate the efficacy of methanol extract of Eclipta alba as hair growth promoter. Materials and methods: Pigmented C57/BL6 mice, preselected for their telogen phase of hair growth were used. In these species, the truncal epidermis lacks melanin-producing melanocytes and melanin production is strictly coupled to anagen phase of hair growth. The extract was applied topically to assess telogen to anagen transition. Immunohistochemical investigation was performed to analyze antigen specificity. Animals in anagen phase of hair growth were positive for FGF-7 and Shh and negative for BMP4, whereas the animals in telogen phase were positive only for BMP4 antigen. Results: The methanol extract of whole plant when tested for hair growth promoting potential, exhibited dose dependent activity in C57BL6 mice. The activity was assessed by studying the melanogenesis in resected skin, follicle count in the subcutis, skin thickness and surrogate markers in vehicle control and extract treated animals. Conclusion: These findings suggest that methanol extract of Eclipta alba may have potential as a hair growth promoter.
517 POSTER Preclinical development of novel betulinic acid derivatives as potent anticancer and antiangiogenic agents for systemic administration
European Journal of Cancer Supplements, 2006
Lecture Notes in Computer Science, 2009
A prominent source of complexity in the verification of ad hoc network (AHN) protocols is the fac... more A prominent source of complexity in the verification of ad hoc network (AHN) protocols is the fact that the number of network topologies grows exponentially with the square of the number of nodes. To combat this instance explosion problem, we present a query-based verification framework for AHN protocols that utilizes symbolic reachability analysis. Specifically we consider AHN nodes of the form P : I, where P is a process and I is an interface: a set of groups, where each group represents a multicast port. Two processes can communicate if their interfaces share a common group. To achieve a symbolic representation of network topologies, we treat process interfaces as variables and introduce a constraint language for representing topologies. Terms of the language are simply conjunctions of connection and disconnection constraints of the form conn(Ji, Jj) and dconn(Ji, Jj ), where Ji and Jj are interface variables. Our symbolic reachability algorithm explores the symbolic state space of an AHN in breadth-first order, accumulating topology constraints as multicast-transmit and multicast-receive transitions are encountered. We demonstrate the practical utility of our framework by applying it to the problem of detecting unresolved collisions in the LMAC protocol for sensor networks.
A methodology for in-network evaluation of integrated logical-statistical models
Proceedings of the 6th ACM conference on Embedded network sensor systems - SenSys '08, 2008
Page 1. A Methodology for In-Network Evaluation of Integrated Logical-Statistical Models Anu Sing... more Page 1. A Methodology for In-Network Evaluation of Integrated Logical-Statistical Models Anu Singh CR Ramakrishnan IV Ramakrishnan David S. Warren Jennifer L. Wong Department of Computer Science Stony Brook University ...
Surface Plasmon Resonance Based Label-Free Detection of Salmonella using DNA Self Assembly
Applied Biochemistry and Biotechnology, 2014
Typhoid is re-emerging as a biggest health threat to third world countries. One of the major chal... more Typhoid is re-emerging as a biggest health threat to third world countries. One of the major challenge is false negative diagnosis using existing immunodiagnostic methods due to overlapping symptoms of other infections (like brucellosis, malaria, hepatitis) that mimic this enteric fever (typhoid). Surface plasmon resonance (SPR) based DNA hybridisation biosensor has been fabricated by generating self-assembled monolayer of 5&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;-thiolated single-stranded DNA (ssDNA) probe onto gold surface. Highly specific DNA probe has been selected from conserved Vi capsular antigen gene of Salmonella enterica serovars typhi. This DNA biosensor has been investigated for label-free real-time monitoring of Salmonella. Interestingly, 0.019 ng mL(-1) (2 fM) is the lowest detected concentration in PBS with association (k a) and dissociation (k d) rate constants to be k a (M(-1) s(-1)) = 6.68 × 10(4) ± 2.3 and k d (s(-1)) = 5.6 × 10(-3) ± 0.01, respectively. This biosensor was successfully demonstrated to distinguish complementary, non-complementary and one-base mismatch sequences and reusability up to 40 hybridisation cycles at room temperature. Successful results were obtained for hybridisation studies of genomic DNA isolated from spiked urine sample. Performance characteristics of this biosensing device suggested further scope to fine-tune such DNA-based assays to be implied for clinical, food and environmental applications.
Innovations in Systems and Software Engineering, 2011
We use the Uppaal model checker for Timed Automata to verify the Timing-Sync time-synchronization... more We use the Uppaal model checker for Timed Automata to verify the Timing-Sync time-synchronization protocol for sensor networks (TPSN), the clocksynchronization algorithm of Lenzen, Locher and Wattenhofer for general distributed systems (LLW), and the clock-thread technique of the Software Monitoring with Controllable Overhead algorithm (SMCO). Clocksynchronization algorithms such as TPSN, LLW, and SMCO must be able to perform arithmetic on clock values in order to calculate clock drift and network propagation delays. They must also be able to read the value of a local clock and assign it to another local clock. Such operations are not directly supported by the theory of Timed Automata.
Proceedings of the 2007 ACM workshop on Formal methods in security engineering - FMSE '07, 2007
As security policies get larger and more complex, analysis tools that help users understand and v... more As security policies get larger and more complex, analysis tools that help users understand and validate security policies are becoming more important. This paper explores the use of deductive spreadsheets for security policy analysis. Deductive spreadsheets combine the power of deductive rules (for specifying policies and analyses) with the usability of spreadsheets. This approach is introduced with a simple example of analyzing information flow allowed by RBAC policies and then applied in two case studies: analysis of computer system configurations and analysis of Security-Enhanced Linux access control policies.
Lecture Notes in Computer Science, 2008
We present the ω-calculus, a process calculus for formally modeling and reasoning about Mobile Ad... more We present the ω-calculus, a process calculus for formally modeling and reasoning about Mobile Ad Hoc Wireless Networks (MANETs) and their protocols.
Journal of Biological Methods, 2014
Bone marrow derived dendritic cells (BMDCs) are routinely employed in cell based assays to evalua... more Bone marrow derived dendritic cells (BMDCs) are routinely employed in cell based assays to evaluate immunomodulatory and anti-inflammatory activities. Hence, simplified, stepwise, defined and standardized methods are required for isolation of bone marrow cells from mice, propagating them in presence of growth factors and obtaining high and reproducible yields of BMDCs. Here, we describe a detailed, stepwise protocol with pictorial representation to isolate bone marrow from mouse femur and development of dendritic cells. Mouse bone marrow cells are cultured in presence of granulocyte-macrophage colony stimulating factor (GM-CSF) for 6 days to generate BMDCs.
Applied Biochemistry and Biotechnology, 2014
A label-free electrochemical bianalyte immunosensor has been designed for simultaneous detection ... more A label-free electrochemical bianalyte immunosensor has been designed for simultaneous detection of lung cancer biomarkers (anti-MAGE A2 and anti-MAGE A11) using carbon nanotubes-chitosan (CNT-CHI) composite. To achieve this, acid-functionalized singlewalled CNTs were used to prepare CNT-CHI gel and electrodes were fabricated by drop casting method onto graphite surface. Lung cancer biomarkers specific antigens (Ag), i.e., MAGE A2 and MAGE A11, were covalently immobilized onto CNT-CHI/graphite electrode separately for fabrication process. Fabricated immunoelectrodes (MAGE A2/CNT-CHI/graphite and MAGE A11/CNT-CHI/graphite) were characterized at each modification step by cyclic voltammetry (CV), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM). Both immunoelectrodes showed successful detection of respective analytes (anti-MAGE A2 and anti-MAGE A11) from 5 fg mL −1 to 50 ng mL −1 using differential pulse voltammetry (DPV). Both Ag/CNT-CHI/graphite immunoelectrodes (using MAGE A2 and MAGE A11) were independently capable of distinguishing specific and nonspecific analytes like CD59, D-dimers, etc. Response studies of both immunoelectrodes revealed successful demonstration of simultaneous detection of anti-MAGE A2 and A11 independently in a single experimental run when exposed to a mixture of various analyte concentrations in different combinations irrespective of the presence of other analyte present in the same vessel.
Molecular Techniques
Chemical Analysis of Food: Techniques and Applications, 2012
International Journal of Peptide Research and Therapeutics, 2006
We describe the synthesis and anticancer activities of octapeptide analogs of somatostatin incorp... more We describe the synthesis and anticancer activities of octapeptide analogs of somatostatin incorporating a,a-dialkylated amino acids. The designed analogs of somatostatin are: D-Phe 1 -Cys 2 -Tyr 3 -D-Trp 4 -Orn 5 -Xxx 6 -Pen 7 -Thr 8 -NH 2 where Xxx=a-Aminoisobutyric acid (Aib), Diethyl glycine (Deg), 1-Aminocyclopentane carboxylic acid (Ac5c), and, D-Phe 1 -Cys 2 -Tyr 3 -D-Trp 4 -Lys 5 -Ac5c 6 -Pen 7 -Thr 8 -NH 2 (disulphide bond between Cys 2 and Pen 7 in all analogs). The conformational studies two of the designed analogs were carried out by NMR techniques and the experimental results suggest a b-turn structure for one of the designed analog. In vivo tumor regression study of two designed analogs on human primary colon tumor xenografts in nude mice demonstrates the anticancer potential of the synthesized analogs.
Toxicology and Applied Pharmacology, 1997
ergic activity of cocaine. A more satisfactory clinical ap-Cocaine Detoxification by Human Plasma... more ergic activity of cocaine. A more satisfactory clinical ap-Cocaine Detoxification by Human Plasma Butyrylcholinesterproach might be to reduce the toxicity of cocaine by accelerase. Lynch, T. J., Mattes, C. E., Singh, A., Bradley, R. M., Brady, ating its metabolic inactivation. The biological activities of R. O., and Dretchen, K. L. (1997). Toxicol. Appl. Pharmacol. 145, cocaine, as well as certain muscle relaxants (e.g., succinyl-363-371.
Combined external beam radiotherapy and Pd-103 brachytherapy boost improves biochemical failure free survival in patients with clinically localized prostate cancer: Results of a matched pair analysis
The Prostate, 2005
Dose escalation has resulted in improved biochemical control in patients with clinically localize... more Dose escalation has resulted in improved biochemical control in patients with clinically localized prostate cancer treated with conformal external beam radiation (EBRT). Conformal dose distributions may also be achieved with brachytherapy. Therefore, biochemical control was evaluated for patients treated with combined external radiation therapy and low dose rate brachytherapy (EBRT + LDR). A matched pair analysis was performed to compare biochemical control of patients treated with EBRT + LDR to patients treated with EBRT alone. The study endpoints were biochemical control and late toxicities. The 5-year biochemical failure free survival (BFFS) was 86% for patients treated with EBRT + LDR and 72% for patients treated with EBRT (P = 0.03). Both treatments were associated with comparable incidences of late genitourinary (GU) side effects (18-19%). Late rectal toxicity was decreased by 15% in patients treated with EBRT + LDR (P = 0.0003). These results support EBRT followed by brachytherapy boost as a safe and effective method for dose escalation in the treatment of prostate cancer.
Stroke, 2000
Background and Purpose-The purpose of our study was to determine the functional and neuroanatomic... more Background and Purpose-The purpose of our study was to determine the functional and neuroanatomic correlates of poststroke depressive symptoms. Methods-Patients with consecutive admissions to a regional stroke center for new-onset unilateral hemispheric stroke who met World Health Organization and National Institute of Neurological and Communicative Disorders and Stroke criteria were eligible for inclusion in a longitudinal study. Acutely, patients underwent CT scanning, and at 3 months and 1 year after stroke, depressive symptoms were assessed by using both the Montgomery-Asberg Depression Rating Scale and the Zung Self-Rating Depression Scale. The Functional Independence Measure (FIM) served as an indication of functional outcome and was obtained at 1 month, 3 months, and 1 year after stroke, along with other demographic information. The Talairach and Tournoux stereotactic atlas was used for the primary determination of CT lesion localization. Lesion proximity to the anterior frontal pole was also measured. Results-Eighty-one patients participated in the longitudinal study. Stepwise linear regression analyses generated a highly significant model (F 3,76 ϭ9.8, R 2 ϭ28%, PϽ0.0005), with lower 1-month total FIM scores, living at home, and damage to the inferior frontal region predicting higher depression scores at 3 months. Similarly, lower 3-month total FIM scores correlated with higher 3-month depression scores, and lower 1-year total FIM scores correlated with higher 1-year depression scores. Conclusions-Functional measures correlated with poststroke depression across time and, together with neuroanatomic measures, predicted depressive symptoms longitudinally. Although inferior frontal lesion location, irrespective of side, appeared to play a role as a risk factor in this study, the degree of functional dependence after stroke imparted the greatest risk. (Stroke. 2000;31:637-644.)
Substance P analogs containing α,α-dialkylated amino acids with potent anticancer activity
Journal of Peptide Science, 2007
Abstract Six analogs (peptides 16) of the potent substance P (SP) derivative known as '... more Abstract Six analogs (peptides 16) of the potent substance P (SP) derivative known as 'Antagonist D'were synthesized by substituting constrained amino acids Aib or Acp (cycloleucine, 1-amino cyclopentane carboxylic acid) at different positions in the ...
Journal of Medicinal Chemistry, 2007
A new series of 2,3-diaryl-4/5-hydroxy-cyclopent-2-en-1-one analogues replacing the cis double bo... more A new series of 2,3-diaryl-4/5-hydroxy-cyclopent-2-en-1-one analogues replacing the cis double bond of combretastatin A-4 (CA-4) by 4/5-hydroxy cyclopentenone moieties was designed and synthesized. The analogues displayed potent cytotoxic activity (IC 50 < 1 µg/mL) against a panel of human cancer cell lines and endothelial cells. The most potent analogues 11 and 42 belonging to the 5-hydroxy cyclopentenone class were further evaluated for their mechanism of action. Both of the analogues led to cell cycle arrest at G2/M phase and induced apoptosis in endothelial cells. Antitubulin property of 42 was superior to 11 and comparable to CA-4. The compound 42 had better aqueous solubility, metabolic stability, and pharmacokinetic profile than CA-4 and also demonstrated significant tumor regression in the human colon xenograft model. Our data suggests that cis-restricted analogues of CA-4 are a new class of molecules that have the potential to be developed as novel agents for the treatment of cancer. * To whom correspondence should be addressed. Phone: (91) 020-25902284 (R.D.W.); (91) 0120-4378505 (A.T.S.); (91) 0120-4378610 (M.J.). Fax: (91) 020-25902629 (R.D.W.); (91) 0120-4376902 (A.T.S. and M.J.).
Journal of Ethnopharmacology, 2008
Terminalia arjuna has been marked as a potential cardioprotective agent since vedic period. The p... more Terminalia arjuna has been marked as a potential cardioprotective agent since vedic period. The present study was aimed to investigate the effects of butanolic fraction of Terminalia arjuna bark (TA-05) on Doxorubicin (Dox)-induced cardiotoxicity. Male wistar rats were used as in vivo model for the study. TA-05 was administered orally to Wistar rats at different doses (0.42 mg/kg, 0.85 mg/kg, 1.7 mg/kg, 3.4 mg/kg and 6.8 mg/kg) for 6 days/week for 4 weeks. Thereafter, all the animals except saline and TA-05-treated controls were administered 20 mg/kg Dox intraperitonially. There was a significant decrease in myocardial superoxide dismutase (38.94%) and reduced glutathione (23.84%) in animals treated with Dox. Concurrently marked increase in serum creatine kinase-MB (CKMB) activity (48.11%) as well as increase in extent of lipid peroxidation (2.55-fold) was reported. Co-treatment of TA-05 and Dox resulted in an increase in the cardiac antioxidant enzymes, decrease in serum CKMB levels and reduction in lipid peroxidation as compared to Dox-treated animals. Electron microscopic studies in Dox-treated animals revealed mitochondrial swelling, Z-band disarray, focal dilatation of smooth endoplasmic reticulum (SER) and lipid inclusions, whereas the concurrent administration of TA-05 led to a lesser degree of Dox-induced histological alterations. These findings suggest that butanolic fraction of Terminalia arjuna bark has protective effects against Dox-induced cardiotoxicity and may have potential as a cardioprotective agent.