aYAP1-2 contributes to bFGF-induced proliferation In... : Anti-Cancer Drugs (original) (raw)

Introduction

Gastric cancer (GC) poses a serious threat to global human health and is the third most deadly cancer [1,2]. Due to the lack of effective diagnostic measures in the early stages of the disease, most patients are diagnosed at an advanced stage, resulting in a poor prognosis.

The human fibroblast growth factor (FGF) family and its receptor [fibroblast growth factor receptor (FGFR)] control a wide range of biological functions in the human body, playing a role in regulating cell proliferation, survival, migration, and differentiation [3]. In a broad sense, the FGF family also plays an integral role in tissue regeneration, wound repair, embryonic development, and physiological maintenance of organs. The FGF family consists of at least 23 distinct members, which can be roughly grouped according to their affinity for FGFR [3]. At present, five FGFR have been identified, of which four (1–4) are highly conserved single transmembrane tyrosine kinase receptors [4]. Basic fibroblast growth factor (bFGF), also known as FGF-2, is the most well-studied member of the FGF family [5]. It can bind to FGFR1, FGFR2, and FGFR3 receptors, which lead to endogenous phosphorylation of tyrosine residues in cells. These phosphorylated tyrosine residues are involved in promoting the proliferation and invasion of various types of tumor cells, thus affecting the malignity phenotype of tumors [6].

Epithelial-mesenchymal transformation (EMT) is a process in which epithelial tumor cells gradually lose their epithelial properties and acquire their interstitial properties. This process is characterized by changes in the expression of specific markers such as SNAIL and decreased expression of epithelial markers such as E-cadherin [7]. Vimentin, as a marker of mesenchymal cells, has been widely recognized as one of the markers of EMT [8]. E-cadherin is a marker of epithelial cells, and its decreased expression is also one of the markers of EMT [9]. SNAIL is a zinc finger structure transcriptional repressor that controls the process of EMT during tumor development. SNAIL expression is associated with the grade of many tumors and the prognosis of lymph node metastasis, and its increased expression is considered to be the marker of the occurrence of EMT [10,11]. For most tumor types, the development of EMT is a necessary condition for tumor cells to enter the circulating system. This process will increase tumor cell invasiveness and chemotherapy resistance and may form distant metastasis, which has a very adverse effect on prognosis [12,13]. In terms of the malignant degree of tumor cells, the EMT process is manifested as the increase of invasiveness, migration, and proliferation.

YAP1 is one of the main effectors in the middle and lower reaches of the Hippo pathway and interacts with other cancer-promoting pathways. The YAP1 gene can contribute to cancer development in a variety of ways, including promoting malignant phenotypes, the expansion of cancer stem cells, and increasing drug resistance in cancer cells [14]. There are eight subtypes of human YAP1, which can be divided into two groups according to the number of WW domains on the coding genes: Yap1-1 (α, β, γ, and δ) and Yap1-2 (α, β, γ, and δ) [15]. The gene encoding yap1-1 contains one WW domain, while Yap1-2 has two WW domains, different subtypes perform different functions in the cell. We recently demonstrated that, under high cell density, the YAP1-2 protein exhibits stronger interactions with several negative regulators, making it less stable compared to the YAP1-1. YAP1-2 protein is preferentially degraded under high cell density and likely in the setting of dense solid tumor [16]. Our data suggest that YAP1-1 and YAP1-2 isoforms are differentially regulated by the upstream Hippo pathway and may be subject to regulation by diverse stimuli such as cell–cell contact, mechanical cues, as well as EMT.

In our current work, we investigated the role of YAP1 in regulating proliferation in GC cells, with emphasis on the role of Yap1-1 and Yap1-2 in regulating proliferation during FGF-induced EMT. Our results suggest that YAP1 plays an important role in regulating the proliferation of GC cells. However, YAP1-2 showed a stronger effect than YAP1-1 in promoting FGF-induced GC cell proliferation regulation.

Materials and methods

Plasmids

To knockdown the endogenous YAP1 expression, we used the pLKO.1 lentivirus expression system (Sigma). The YAP1 shRNA targeting sequence (listed in the 5′ to 3′ direction) is CCCAGTTAAATGTTCACCAAT (#1) and GCCACCAAGCTAGATAAAGAA (#2) [17]. Full-length YAP1-1α and YAP1-2α were generated and subcloned into the lentiviral expression vector pLenti6.3 (Invitrogen, Carlsbad, California, USA), as previously described [16].

Antibodies and reagents

The primary antibodies and their commercial suppliers are YAP1 (cat. 14074S), E-cadherin (cat. 3195S), Vimentin (cat. 10366–1-AP) from Proteintech (Chicago, Illinois, USA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (cat. MB001-100) from Bioworld, goat antirabbit IgG-H&L (Alexa Fluor 488) (cat. ab150077) from Abcam. Recombinant human bFGF was purchased from the Central Laboratory of Wenzhou Medical University. AZD-4547 was purchased from Selleck and 4',6-diamidino-2-phenylindole (DAPI) (D1306) from Thermo Fisher (Waltham, Massachusetts, USA) [17].

Cell culture, transfection, and treatment

GC cell lines SGC-7901, BCG-823, and MGC-803 were purchased from the American Type Culture Collection. The cells were maintained under the recommended culture conditions and transfected as previously described [18]. For bFGF treatment, the cancer cells were treated with 20 ng/ml bFGF for 3 days to induce the EMT process. All experiments were performed three times.

Lentiviral packaging, transduction, and stable cell selection

Lentiviral packaging, host cell transfection, and puromycin selection of stably cells containing plenti-knockout – short hairpin RNA were performed as previously described [18]. For the stable reconstituted expression of specific YAP1 isoforms, lentiviral particles carrying pLenti6.3-Flag-YAP1cDNA encoding either YAP1-1γ or YAP1-2γ were used to transduce SGC7901 (human gastric cancer cell line) cells. The cells were then selected in a culture medium supplemented with blasticidin (5 μg/ml), and the surviving blasticidin-resistant cells were used as stable overexpression cells [17].

RNA isolation, real-time PCR, and YAP1 isoform detection

Total RNA was extracted with RNAiso Plus (TaKaRa, JPN). The PrimeScript RT Reagent Kit (TaKaRa, JPN) was used for cDNA synthesis. Real-time PCR was carried out using the CFX96 Real-Time System (Bio-Rad) and SYBR Premix Ex Taq (TaKaRa, JPN). The gene-specific primers used in this study are as follows: total YAP1 none discriminative of isoforms (forward: 5′-CAAATCCCACTCCCGACAG-3′, reverse: 5′-GTCAGTGTCCCAGGAGAAAC-3′); E-cadherin (forward: 5′-AATGCCGCCATCGCTTAC-3′, reverse: 5′- ACCAGGGTATACGT AGGGAAACTCT-3′); Vimentin (forward: 5′- GAGGATCTGGAA TTCGGATCC-3′, reverse: 5′- ACGCGTCGACTTATTCAAGGT-3′); YAP1-1 (forward: 5′- AGGTTG GGAGATGGCAAAG-3′, reverse: 5′- GATTCTCTGGTTCATGGCT GA-3′); YAP1-2 (forward: 5′- ACAAGCCATGACTCAGGATG − 3′, reverse: 5′- TGTTTCACTGGAGCACTCTG-3′); connective tissue growth factor (CTGF) (forward: 5′-CTT CTGTGACTTCGGCTCC-3′, reverse: 5′-ACGTGCACTGGTACTT GC-3′); CYR61 (forward: 5′-CAAGGAGCTGGGATTCGATG-3′, reverse: 5′-AAAGGGTTGTATAGGATGCGAG-3′); and GAPDH (forward: 5′-ACATCGCTCAGACACCATG-3′, reverse: 5′-TGTAGTTGAG GTCAATGAAGGG-3′). All the values were normalized to GAPDH [17].

Immunofluorescence staining and imaging

Cells were grown on glass-bottom cell culture dishes (NEST, China) for immunofluorescence studies. Staining was carried out as previously described with a primary antibody against YAP1 at 1 : 200, and goat antirabbit Alexa Fluor 488 as the secondary antibody at 1 : 1000. DAPI was used for counterstaining. Confocal images were obtained with a Leica SP8 confocal microscope and Suite-Advanced Fluorescent software [17].

Colony formation experiments and MTT

The cells cultured according to the recommended conditions were digested by pancreatic enzymes and resuspended to prepare the cell suspension liquid. Gently and repeatedly blow the cell suspension with a pipette gun to fully disperse the cells, keeping the proportion of individual cells in the entire cell suspension above 95%. A total of 3 ml medium containing 10% fetal bovine serum was added into a 6 cm petri dish, and about 1000 cells were taken and added into the dish. Cell culture was performed for 14 days at 37 °C, 5% CO2. Almost 4% paraformaldehyde was added for cell fixation and fixed at room temperature for 30 min. Stain with fresh crystal violet at room temperature for 15 min. After cleaning with PBS, photos were taken to collect data. To count the number of colonies, ImageJ software was used. The same cell suspension was used in the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, and after counting, 500 cells were laid in 96-well plates in each pore. The results were determined by the optical density at 570 nm. The results were analyzed by Prism software [17].

Statistical analysis

The real-time PCR, MTT assays, and tumor growth curve data are presented as the mean ± SD. P values showing differences were calculated by an unpaired two-tailed _t_-test, and those showing no differences were calculated by a one-tailed _t_-test.

Results

bFGF stimulates gastric cancer cell proliferation

To determine the promotion effect of bFGF on GC proliferation. Three GC cell lines, BGC-823, MGC-803, and SGC-7901, were treated with bFGF induction to observe whether the phenotype markers of EMT were changed at the protein level after treatment. The experimental results showed that under the stimulation of bFGF, the epithelial phenotypic marker E-cadherin of the BGC-823 and SGC-7901 cell lines showed a significant decrease, while the MGC-803 cell line was not different (Fig. 1a). This suggests that bFGF may increase the malignancy of BGC-823 and SGC-7901 cell lines. To demonstrate the effect of bFGF on the proliferation of GC cells, we performed a colony formation experiment. The experimental results show that bFGF-stimulated SGC-7901 cells can produce more colonies, and its FGFR inhibitor AZD-4547 inhibited its colony-forming ability (Fig. 1b). The results of MTT cell proliferation experiments also suggested that bFGF could promote the proliferation ability of SGC-7901 cell line (Fig. 1c). At the mRNA level, the EMT markers of the SGC-7901 cell line after bFGF treatment also changed. After 72 h of bFGF treatment, VIM increased by approximately 1.9 times, and E-cadherin decreased by approximately 0.66 times. At the same time, YAP1 increased by approximately 2 times (Fig. 1d). This result suggests that bFGF’s ability to promote the proliferation of the SGC-7901 cell line may be related to the YAP1 pathway.

Fig. 1:

bFGF stimulation can increase the proliferation capacity of the SGC-7901 wild-type cell line. (a) Western blot experiments verified the changes of EMT markers in gastric cancer cell lines stimulated by bFGF. (b) Colony formation experiments of gastric cancer cell lines with bFGF and FGFR inhibitors. (c) Gastric cancer cell line MTT cell proliferation experiments with bFGF and FGFR inhibitors. (d) QRT-PCR experiments verify changes in EMT markers of gastric cancer cell lines stimulated by bFGF. EMT, epithelial-mesenchymal transition; FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; QRT-PCR, qualitative real-time PCR.

bFGF promotes the proliferation lines is associated with YAP1

To investigate whether the increased proliferation capacity of GC cell lines under the action of bFGF is related to YAP1. We specifically knocked out the expression of the YAP1 gene on the SCG-7901 GC cell line using cas-9 technology to obtain the SGC-7901-KO-YAP1 cell line. Because human YAP1 is divided into two major subtypes of YAP1-1 and YAP1-2 according to the number of WW domains, different YAP1 subtype proteins in the human body perform different functions. To further explore which subtypes play a major role in this process, we reconstructed YAP1-1α and YAP1-2α overexpressing cells on the SGC-7901-KO-YAP1 cell line using the lentivirus overexpression technology system. To verify whether the cell line was successfully constructed, we used western blotting to verify the results. Compared with the wild type, the expression of YAP1 in the KO-YAP1 cell line was almost negligible, and the expression of YAP1-1 and YAP1-2 was high compared to wild type (Fig. 2a). We verified the cell line construction using our own qualitative real-time-PCR (QRT-PCR) primers designed to specifically recognize the number of WW domains for mRNA expression levels (Fig. 2b). So far, we have obtained three tool cell lines. Using KO-YAP1 cell line to perform colony formation experiments under bFGF stimulation, the results suggest that the colony-forming ability of SGC-7901 cell line was significantly decreased after YAP1 was knocked out, and bFGF could not stimulate and increase its proliferation ability (Fig. 2c). At the same time, the results of MTT proliferation experiments suggested that the proliferative capacity of SGC-7901 was reduced compared to the wild-type cell line after the knockout of YAP1 (Fig. 2d).

Fig. 2:

Cell line construction and KO-YAP1 cell line cell proliferation ability experiment. (a) Western blot experiments verified that the YAP1 gene was knocked out and a YAP1 subtype overexpression cell line was constructed on the knockout cell line. (b).QRT-PCR experiments verified the construction of YAP1 subtype cell lines at the mRNA level. (c) KO-YAP1 cell line and its colony formation experiments under bFGF stimulation. (d) KO-YAP1 cell line and its MTT cell proliferation experiment under the action of bFGF. bFGF, basic fibroblast growth factor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; QRT-PCR, qualitative real-time PCR

bFGF affects cell proliferation by affecting YAP1-2

The purpose of this study was to investigate which YAP1 subtype was involved in improving the proliferation ability of the SCG-7901 cell line induced by bFGF. We performed cellular immunofluorescence experiments. The experimental results indicate that in the absence of bFGF stimulation, the wild-type GC cell line expresses YAP1 protein mainly in the cytoplasm. Under the effect of bFGF, the expression of YAP1 protein increased in the nucleus, and the expression of cytoplasm decreased (Fig. 3a). This phenomenon suggests that after bFGF acts on GC cells, YAP1 protein expression may increase and enter the nucleus to play a role. To find out exactly which YAP1 subtype of protein plays a role in this process. We use YAP1-1 and YAP1-2 cell lines to perform immunofluorescence experiments under bFGF stimulation. The results showed that YAP1-1 expression was not increased in the nucleus after bFGF stimulation. However, YAP1-2 was increased in the nucleus under the action of bFGF, which was consistent with the expression of wild-type cells (Fig. 3b). This result suggests that bFGF mainly affects cell proliferation by inducing YAP1-2 to enter the nucleus. CRY61 and CTGF are downstream genes of YAP1. QRT-PCR results showed that the expressions of CRY61 and CTGF genes were upregulated in both YAP1-1 and YAP1-2 cells under the influence of bFGF, with YAP1-2 being more upregulated. YAP1-2 showed significant EMT-related gene regulation (Fig. 3c). At the same time, the results of MTT cell proliferation experiments also suggested that the proliferation ability of the YAP1-2 cell line was stronger than that of YAP1-1 without bFGF stimulation(Fig. 3d). This difference became more pronounced after bFGF stimulation.

Fig. 3:

bFGF mainly affects the entry of YAP1-2a into the nucleus. (a) Immunofluorescent cell sublocalization experiment of SGC-7901 wild-type cell line under bFGF stimulation. (b) YAP1-1a and YAP1-2a cell lines under bFGF stimulation of immunofluorescent cell sublocalization experiments. (c) YAP1-1a and YAP1-2a cell lines were stimulated with bFGF to stimulate MTT cell proliferation. bFGF, basic fibroblast growth factor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

Animal experiment verification

The effect of different subtypes of YAP1 protein on the proliferation of GC cell lines was verified at the animal level. We used an experimental method of subcutaneous transplantation animal model for verification. The experimental results suggest that after knocking out the YAP1 gene, compared with the wild-type group, the tumor in the KO-YAP1 group is smaller, and bFGF cannot stimulate the tumor. The size changes, which is consistent with the results of cell experiments. But it is surprising that in animal experiments, the tumors in the YAP1-1 group were larger than those in the YAP1-2 group, and under the stimulation of bFGF, both the YAP1-1 group and the YAP1-2 group could get larger Xenograft (Fig. 4a). This result may be caused by small sample size or changes in individual animal differences. Of course, there may also be different mechanisms that affect the experimental results when experimenting in vivo. This requires further investigation by our research team.

Fig. 4:

The effect of bFGF on the size of intra-abdominal implanted tumors formed by SGC-7901 cells in mice. (a) Drug induced cells are implanted in mice to form transplanted tumors. (b) Statistics on the size of intra-abdominal implanted tumors in each group of mice. (c) Comparison of the size of intra-abdominal implanted tumors in each group. bFGF, basic fibroblast growth factor.

Discussion

We recently reported the first systemic characterization and comparison of YAP1 isoforms with regard to their mRNA/protein expression, nuclear localization, transcription activation, and functional properties [16]. Consistent with the free expression of mRNA and protein of YAP1-1 and YAP-2 subtypes in pancreatic cancer cells, low expression of YAP1-2 protein was observed in GC cells. This may be due to stronger interactions between Yap1-2 and some negative regulators, such as large tumor suppressor kinase 1/2, as we have previously demonstrated in a high cell density environment [16], but the biological and functional differences between YAP1 isomers, especially their potentially unique responses to various regulatory signals, remain largely unexplored.

FGFR1, FGFR2, and FGFR3 are the targets of bFGF on the cell surface in vivo. By binding with bFGF, they are involved in promoting the proliferation and invasion ability of tumor cells, thus influencing the malignancy phenotype of tumors [6]. EMT is necessary for tumor cells to develop distant metastasis or increase their proliferative ability, and after obtaining the mesenchymal characteristics, tumor cells can enter the blood system and increase their malignant degree [10,11]. There are eight subtypes of the human YAP1 gene, which can be divided into two categories: Yap1-1 (α, β, γ, and δ) and Yap1-2 (α, β, γ, and δ) according to the number of WW domains contained in their coding genes. Current studies on tumor therapy for YAP1 generally do not distinguish different subtypes, and our findings suggest that not all YAP1 subtypes play a role in tumor cell proliferation and EMT. In the case of bFGF stimulation, YAP1-2 is mainly increased in the nucleus expression. The experiment in this article only involves the alpha subtype (which is relatively stable compared with other subtypes), and whether the other three subtypes can get the same data results in the experimental study still needs to be verified by further experiments. At the same time, our experimental results found that under the stimulation of bFGF, there was no significant change in the EMT markers of YAP1-1 cell lines, but the QRT-PCR results showed that the downstream signals of YAP1, CTGF, and CYR61, were still activated. So the specific role of bFGF-activated YAP1-1 signal in tumor cells needs further discussion and experimental research. The present work elucidates the important role of the YAP1 subtype in the proliferation of GC cells induced by bFGF. Although YAP1-2 showed a stronger response to bFGF stimulation, the basal level was higher due to YAP1-1. Therefore, immunofluorescence alone cannot fully explain the stronger effect of YAP1-2 than YAP1-1 in promoting the proliferation of cancer cells under bFGF treatment. We suggest that the enhancement of YAP1-2 on proliferation might be related to the effect of bFGF on the transcriptional activity of YAP1-2, which is stronger than the effect of YAP1-1 on downstream target genes. The presence of the extra WW domain may confer additional protein binding specificity/affinity enabling YAP1-2 to selectively bind distinct/particular nuclear proteins that may be critical for various cellular activities, including promotion of cell malignancy. Specific signaling pathways and corresponding therapeutic measures as well as patient-related survival outcomes still require long-term research.

Acknowledgements

Thanks for all classmates and mentors for their help and guidance. Thanks for all authors for their assistance in the data collection phase.

T.-F.J.: methodology (lead); project administration (lead); formal analysis (lead). H.C.: writing – original draft (lead). D.-K.X. and Y.-X.W.: methodology (supporting).

The data sets used and analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of interest

There are no conflicts of interest.

References

1. Hartgrink HH, Jansen EPM, van Grieken NCT, van de Velde CJH. Gastric cancer. Lancet 2009; 374:477–490.

2. Kanda M, Kodera Y. Recent advances in the molecular diagnostics of gastric cancer. World J Gastroenterol 2015; 21:9838–9852.

3. Turner N, Grose R. Fibroblast growth factor signalling: from development to cancer. Nat Rev Cancer 2010; 10:116–129.

4. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 2005; 16:139–149.

5. Akl MR, Nagpal P, Ayoub NM, Tai B, Prabhu SA, Capac CM, et al. Molecular and clinical significance of fibroblast growth factor 2 (FGF2/bFGF) in malignancies of solid and hematological cancers for personalized therapies. Oncotarget 2016; 7:44735–44762.

6. Okada-Ban M, Thiery JP, Jouanneau J. Fibroblast growth factor-2. Int J Biochem Cell Biol 2000; 32:263–267.

7. Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Dev Cell 2008; 14:818–829.

8. Satelli A, Li S. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci 2011; 68:3033–3046.

9. Zhao B, Ye X, Yu J, Li LI, Li W, Li S, et al. TEAD mediates YAP-dependent gene induction and growth control. Genes Dev 2008; 22:1962–1971.

10. Bonnomet A, Brysse A, Tachsidis A, Waltham M, Thompson EW, Polette M, Gilles C. Epithelial-to-mesenchymal transitions and circulating tumor cells. J Mammary Gland Biol Neoplasia 2010; 15:261–273.

11. Liu W, Vivian CJ, Brinker AE, Hampton KR, Lianidou E, Welch DR. Microenvironmental influences on metastasis suppressor expression and function during a metastatic cell’s journey. Cancer Microenviron 2014; 7:117–131.

12. Gaffney CJ, Oka T, Mazack V, Hilman D, Gat U, Muramatsu T, et al. Identification, basic characterization and evolutionary analysis of differentially spliced mRNA isoforms of human YAP1 gene. Gene 2012; 509:215–222.

13. Zhang K, Yang G, Wu W, Zhang J, Xia X, Jiang T, et al. Decreased expression of caveolin-1 and E-cadherin correlates with the clinicopathologic features of gastric cancer and the EMT process. Recent Pat Anticancer Drug Discov 2016; 11:236–244.

14. Wang Y, Shi J, Chai K, Ying X, Zhou BP. The role of snail in EMT and tumorigenesis. Curr Cancer Drug Targets 2013; 13:963–972.

15. Qin Y, Zhao D, Zhou H-G, Wang X-H, Zhong W-L, Chen S, et al. Apigenin inhibits NF-kappaB and snail signaling, EMT and metastasis in human hepatocellular carcinoma. Oncotarget 2016; 7:41421–41431.

16. Guo Q, Quan M, Dong J, Bai J, Wang J, Han R, et al. The WW domains dictate isoform-specific regulation of YAP1 stability and pancreatic cancer cell malignancy. Theranostics 2020; 10:4422–4436.

17. Guo Q, Quan M-Y, Xu Le, Cai Y, Cai J-T, Li X, et al. Enhanced nuclear localization of YAP1-2 contributes to EGF-induced EMT in NSCLC. J Cell Mol Med 2022; 26:1013–1023.

18. Zhang JS, Herreros-Villanueva M, Koenig A, Deng Z, de Narvajas AA-M, Gomez TS, et al. Differential activity of GSK-3 isoforms regulates NF-kappaB and TRAIL- or TNF alpha induced apoptosis in pancreatic cancer cells. Cell Death Dis 2014; 5:e1142.

Keywords:

b-fibroblast growth factor; epithelial-mesenchymal transition; gastric cancer; YAP1