Developmental expression of Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod Haliotis asinina (original) (raw)

Introduction

Heat shock proteins (Hsps) are best known for their rapid response to thermal stress and their essential role in the development of thermotolerance (Lindquist 1986; Morimoto et al. 1994). However, there is evidence that Hsps also interface with a diverse set of fundamental developmental pathways because of their ability to recognise and bind unstable motifs of structurally divergent proteins that arise during normal development or stress (Rutherford and Lindquist 1998; Queitsch et al. 2002). Hsp70 prevents inappropriate interactions between protein side chains through binding hydrophobic amino acid motifs, common to both newly synthesised, and heat-denatured proteins (Morishima 2005). Hsp90 recognises and unfolds proteins with abnormal tertiary structures, increasing the probability that they will attain their native states. Hsp90’s clients include receptors, tyrosine kinases, cell cycle regulators, structural proteins, members of the apoptotic pathway and transcription factors (Pratt and Toft 1997; Zhao et al. 2005). However, during heat shock, all proteins are destabilised and Hsp90 activity is unbiased. The heat shock transcription factor (HSF) drives the expression of a broad range of heat responsive genes, including Hsp70 and Hsp90, during stress and also during normal development (Westwood et al. 1991).

While Hsps are essential to cellular function at all stages of development, they also have complex developmental expression patterns. Hsps are primarily upregulated during rapid cellular division, complex movements, differentiation and signalling, and this is reflected in their developmental expression domains (Csermely et al. 1998; Morishima 2005; Angelier et al. 1996; Zimmerman and Cohill 1991). For example, Hsp70 becomes nucleated in the involuting marginal zone during gastrulation in Xenopus (Herberts et al. 1993) and is upregulated in ingressing micromeres during sea urchin embryogenesis (Sconzo et al. 1997). As gastrulation involves both complex movements and a change in cell affinities, Hsps may be involved at a number of points in the regulation, coordination and implementation of these events. Hsps have also been implicated in the formation of the neural tube in mouse and chick (D’Sousa and Brown 1998; Loones et al. 2000; Vega-Núñez et al. 1999; Rubio et al. 2002) and during somitogenesis and muscle formation in fish, chick and mouse (Sass et al. 1996; Vanmuylder et al. 2002; Vega-Núñez et al. 1999). The germ line expresses Hsps and HSF throughout development in Drosophila (Ding et al. 1993), Caenorhabditis elegans (Inoue et al. 2003) and mouse (Vanmuylder et al. 2002), and their continued expression is important to adult fertility.

While a number of studies have examined the developmental roles of Hsps in the deuterostomes and ecdysozoans, little attention has been paid to any lophotrochozoan taxa, despite extensive research into the impact of stress on adult molluscs, and the roles of Hsps in their survival and biogeography (reviewed in Hofmann 2005). We have cloned Hsp90, Hsp70 and HSF from the vetigastropod H. asinina and examined their expression during embryogenesis and larval development. H. asinina undergoes spiral cleavage to form a trochophore larva (Fig. 1a). The first tissue to be determined in most trochozoans is the prototroch, which is derived from micromeres of different lineages of the 16-cell embryo; these are the trochoblasts (Nielsen 2004). The ciliated prototroch is a defining feature of the trochophore larva and divides the body into anterior pre-trochal and posterior post-trochal regions. The pre-trochal ectoderm is fated to form the tissues anterior to the dorsal lip of the mouth in the head region, such as the eyes, cerebral ganglia and cephalic tentacles, and the post-trochal region forms the remainder of the body. The post-trochal ventral ectoderm that is located posterior to the stomodaeum contributes to the formation of the foot (Fig. 1b) (Raven 1966). The dorsally located shell gland secretes the larval shell and gives rise to the mantle in the veliger larva. The mantle tissue proliferates to form a hood that encloses the pallial cavity, which houses the gills, nephridiopores and anus (Fig. 1c). The endodermal visceral mass will differentiate to form the gut at metamorphosis (Fig. 1b,c). Here we show that the expression of Hsp90, Hsp70 and HSF is highly dynamic during H. asinina embryogenesis and larval development and correlates closely with the morphogenesis of a number of these larval structures.

Fig. 1

Fig. 1

The alternative text for this image may have been generated using AI.

Full size image

Schematic representation of the larval stages of H. asinina development. a–c Lateral orientation with anterior facing the top. a Trochophore (9 hpf). b Pre-torsional veliger (15 hpf). c Veliger (40 hpf). Ct cephalic tentacle, e eye, f foot, m mantle, o operculum, p prototroch, pc pallial cavity, pe pre-trochal ectoderm, sg shell gland, v velum, vm visceral mass, asterisk stomodaeum. Dotted lines outline the boundaries of the pre-trochal ectoderm, the shell gland, the foot, the mantle and the internal boundaries of pallial cavity

Materials and methods

Rearing of H. asinina larvae

H. asinina were collected from Heron Island Reef on the Great Barrier Reef, Australia (23°27′S, 151°55′E). They were allowed to spawn according to their natural cycle on the full and new moons, in a season that spans November to April (Jebreen et al. 2000; Counihan et al. 2001). Eggs were fertilised as detailed in Counihan et al. (2001) and reared at 25°C as detailed in Jackson et al. (2005).

Cloning Hsp70, Hsp90 and HSF

RNA was extracted from H. asinina larvae and used to synthesise cDNA. A partial Hsp90 cDNA was identified by differential display cloning (Jackson et al. 2005) and partial Hsp70 and HSF sequences were isolated using degenerate oligonucleotide primers that annealed to conserved regions of the genes (HSF-1 CCNGCNTTYTYNRCNAARYTNTGG, HSF-2 YTGYTGYTKNGCRTGYTTYTG, HSF-3 TTYAARCAYAAYAAYATGGC, HSF-4 RAANCCRTACAT RTTNARYTG, Hsp70-1 CATTCTTCGCCAAGTTGTGAA, Hsp70-2 RTCRAANGTNACYTCDATYTGNGG). PCR products were cloned as described in Degnan and Morse (1993) and sequenced using Big Dye 3.1 chemistry. Full-length sequences of Hsp90 and HSF were obtained through RACE amplification of a H. asinina cDNA library (Jackson and Degnan 2006), using gene-specific primers (_HasHsp90_3 AGAACTGAACAAGACCAAACC, _HasHsp90_4 TCCTCCCAGTCATTTGTCAAG, _HasHSF_3 AGAACTGAACAAGACCAAACC, _HasHSF_4 GCTGTCTGATGAAGCT GGCAATA). HasHSF and HasHsp90 sequences were aligned in Sequencher 4.5. Consensus sequences and amino acid translations were exported from Sequencher 4.5. The resulting sequences were compared to GenBank nonredundant protein databases using the BlastX algorithm. The abalone Hsps were then compared to Hsp and HSF sequences from other organisms obtained through GenBank (Supplemental Table S1). Sequences of Lottia scutum Hsp90 and HSF were assembled and translated using Sequencher 4.5 from traces derived from the Lottia genome database. Alignments were performed using ClustalX, using all available sequences for Hsp70 and Hsp90, and the DNA binding domain and first oligomerisation domain of HSF, as the remaining sequence was too divergent to be aligned. The relatedness of sequences was analysed using PAUP (Swofford 1998), utilising all available sequences for Hsp90 and Hsp70, and the DNA binding domain of HSF. The Hsp90B, BiP and ScHSF sequences were defined as outgroups to Hsp90, Hsp70 and HSF, respectively. Neighbour joining trees were constructed through estimation of molecular distances based on mean character difference (assuming distance). The confidence of each node was assessed by 1,000 bootstrap pseudoreplications using a full heuristic search.

In situ hybridisation

DIG-labelled antisense and sense (negative control) RNA probes were transcribed from linearised pBKS+ plasmids according to the manufacturer’s instructions (Roche). The HasHsp90 probe was transcribed from a 1,286-base pair (bp) insert corresponding to positions 996–2,282, in the open reading frame (ORF) (Supplemental Fig. S1), the HasHsp70 probe was transcribed from a 854-bp insert composed of the entire cloned fragment from the ORF (Supplemental Fig. S2), and a HasHSF probe was transcribed from a 634-bp insert corresponding to positions 125–759 in the ORF (Supplemental Fig. S3). Fixation, storage, preparation and whole mount in situ hybridisation (WMISH) of H. asinina larvae was performed as described in Giusti et al. (2000), except that the HasHsp70 and HasHsp90 hybridisations and washes were performed at 50°C. HasHSF hybridisations and washes were at 47°C. The sectioned specimens were dehydrated with ethanol, infiltrated with Epon 812 in a Pelco Bio Wave microwave according to the manufacturer’s instructions. Sample blocks were polymerised in an oven overnight at 60°C and cut at 4.5 μm and mounted on glass slides. Sections and whole mounts were photographed with an Olympus BX60 with Normaski optics and documented using an Olympus DP10 digital camera. The sections in Fig. 2 are counter stained with acid fuschin.

Fig. 2

Fig. 2

The alternative text for this image may have been generated using AI.

Full size image

Structure and expression of HasHsp90A. a Schematic diagram of HsHsp90 and HasHsp90A (Young et al. 2001). Hs Homo sapiens, Has H. asinina. b Neighbour joining tree of the HasHsp90A amino acid sequence. Htu Haliotis tuberculata, Ls Lottia scutum, Cf Chlamys farreri, Gg Gallus gallus, Dr Danio rerio, Dm Drosophila melanogaster, Ce Caenorhabditis elegans, Sj Schistosoma japonica, Mm Mus musculus, Sp Strongylocentrotus purpatus. c–x Representative in situ micrographs. c–o, q–s and u–x Whole mounts; p and t are histological sections. c–e, g, i, k, m, q and u–x Lateral views of expression presented with anterior facing the top and dorsal left when dorsal is known, t is a lateral view with anterior facing the top and dorsal right, f, h and o are anterior views, and j, l, n, p, r and s are ventral views, of which s is an optical section. x The same individual as shown in w at a higher magnification. c HasHsp90 expression in the unfertilised egg with animal pole up, d 8-cell stage embryo. e, f Localisation of HasHsp90A transcripts in the trochoblast lineage in 4 hpf and g, h 5-hpf gastrulas. i, j Seven-hpf late gastrulas, with expression in pre-trochal and ventrolateral ectoderm. k, l This pattern is maintained in the trochophore stage at 9 hpf and 11 hpf (m–p). HasHsp90A is expressed in the pre-trochal ectoderm (o); however, expression was not detected in the endoderm (p). q–t In the pre-torsional veliger, HasHsp90A is expressed predominantly in the foot and mantle. s, t HasHsp90A is expressed internally, including the cells that flank the stomodaeum. u HasHsp90A expression was maintained in the foot and mantle after torsion, at 24 hpf. v Expression in the pallial cavity during mid-veliger development at 40 hpf. w, x HasHsp90A expression is in a few cells in the buccal cavity at 72 hpf. ap animal pole, bc buccal cavity, e eyespot, f foot, m mantle, p prototroch, pe pre-trochal ectoderm, t trochoblasts, v velum, ve ventrolateral ectoderm, vm visceral mass, vp vegetal pole, asterisk stomodaeum, dashed lines outline the prototroch

Results

Developmental expression of HasHsp90

The full-length sequence for HasHsp90 was obtained through a combination of differential display (Jackson et al. 2005) and RACE cloning of H. asinina cDNA. A conceptual translation of the composite cDNA revealed that the ORF encodes a 728-amino acid protein (Supplemental Fig. S1). HasHsp90 is structurally similar to cytoplasmic Hsp90s, (Fig. 2a) and phylogenetic analysis confirmed this observation (Fig. 2b). A new Hsp90 nomenclature proposed by Chen et al. ([2006](/article/10.1007/s00427-007-0171-2#ref-CR4 "Chen B, Zhong D, Monteiro A (2006) Comparative genomics and evolution of the Hsp90 family of genes across all kingdoms of organisms. BMC Genomics 7:156 DOI 10.1186/1471-2164-7-156

                    ")) dictates that all cytoplasmic Hsp90s be named Hsp90A; thus, HasHsp90 is termed HasHsp90A.

HasHsp90A expression was examined throughout embryonic and larval development by WMISH (Fig. 2c–x). HasHsp90A was detected in the animal hemisphere and the animal half of the vegetal hemisphere of the unfertilised egg (Fig. 2c). At the 8-cell stage, 1.25 h post-fertilisation (hpf), transcripts were localised to the micromeres and the anterior portion of the macromeres (Fig. 2d). At 4 hpf (early gastrulation), HasHsp90A expression was localised to all micromeres, with transcripts more abundant in the trochoblasts (Fig. 2e,f). Relative HasHsp90A expression increased in the trochoblasts in the gastrula at 5 hpf (Fig. 2g,h). At 7 hpf, HasHsp90A expression was detected in the ventrolateral and pre-trochal ectoderms in addition to the prototroch (Fig. 2i,j). This pattern was maintained at 9 hpf (hatching of the trochophore), with HasHsp90A expression appearing stronger in the ventrolateral ectoderm than the prototroch (Fig. 2k,l). HasHsp90A expression was not detected in the prototroch at 11 hpf, and the HasHsp90A expression in the ventrolateral ectoderm was reminiscent of the progeny of the A and C quadrants in Patella vulgata (Dictus and Damen 1997) (Fig. 2m,n). Additionally, HasHsp90A was expressed in the majority of pre-trochal ectodermal cells (Fig. 2o). Expression was not detected in the endoderm (Fig. 2p). At 16 hpf, expression of HasHsp90A was localised throughout the foot and mantle (Fig. 2q–t). Expression was also maintained in the ectoderm and was detected in the cells in the vicinity of the stomodaeum (Fig. 2s,t). HasHsp90A was localised to the mantle and foot in the 24 hpf post-torsional veliger (Fig. 2u) and expressed in a complex pattern in the mid-veliger (40 hpf), which included expression in the cephalic tentacles, mantle and pallial cavity (Fig. 2v); the precise identity of the structures in the pallial cavity was not determined. Expression of HasHsp90A became restricted to a few cells in the buccal cavity and the visceral mass of the late veliger (72 hpf) (Fig. 2w,x).

Developmental expression of HasHsp70

A 854-bp Hsp70 fragment was isolated from H. asinina cDNA including most of the highly conserved ATPase domain and part of the protein interaction domain (Fig. 3a). A conceptual amino acid translation confirmed that HasHsp70 is an inducible, cytoplasmic Hsp70 isoform as it contains numerous motifs indicative of these properties, as identified in Rensing and Maier (1994) and Kourtidis et al. (2006) (Supplemental Fig. S2), and confirmed by phylogenetic analysis (Swofford 1998) (Fig. 3b).

Fig. 3

Fig. 3

The alternative text for this image may have been generated using AI.

Full size image

Structure and expression of HasHsp70. a Schematic diagram of HsHsp70 (Chou et al. 2003; Sriram et al. 1997) and fragment of HasHsp70. Hs Homo sapiens, Has H. asinina. b Neighbour joining tree of the HasHsp70 ATP interaction and protein interaction domain amino acid sequence. Ce Caenorhabditis elegans, Oe Ostrea edulis, Ci Ciona intestinalis, Pl Paracentrotus lividus, Gg Gallus gallus, Dr Danio rerio, Sc Saccharomyces cerevisiae, Mm Mus musculus. c–t Representative in situ micrographs. c–o and q–t Whole mounts; p is a histological section. c–e, g, i, k, m, q, s and t Lateral views of expression presented with anterior facing the top and dorsal left when dorsal is known. f, h, j and o Anterior views; l, n, p and r are ventral views. t The same individual as shown in s, at a higher magnification. c HasHsp70 in the unfertilised egg with animal pole up, d 8-cell stage embryo. e–f Localisation of HasHsp70 transcripts to the trochoblast lineage in 4 hpf and 5 hpf gastrulas (g, h). i, j Seven-hpf late gastrulas, with expression in pre-trochal and ventrolateral ectoderm. The pre-trochal and ventrolateral ectoderm express HasHsp70, and this pattern is maintained throughout the trochophore stage at 9 hpf (k, l), and 11 hpf (m, p). HasHsp70 is also expressed in the shell gland. q, r In the pre-torsional veliger, HasHsp70 expression is predominantly restricted to the foot and mantle. s, t At 40 hpf, HasHsp70 expression is restricted to two patches of three cells just posterior to the leading edge of the mantle, indicated by arrows. ap animal pole, e eyespot, f foot, m mantle, p prototroch, pe pre-trochal ectoderm, sg shell gland, t trochoblasts, v velum, ve ventrolateral ectoderm, vm visceral mass, vp vegetal pole, asterisk stomodaeum, dashed lines outline the prototroch

We examined the developmental expression of HasHsp70 through WMISH (Fig. 3c–t). Similar to HasHsp90A, HasHsp70 was maternally localised to the animal hemisphere and the animal half of the vegetal hemisphere of the egg and 8-cell stage (Figs. 2c,d and 3c,d;). At 4 hpf, HasHsp70 was strongly expressed in the trochoblast lineage and in the pre-trochal micromeres, except for the presumptive 1a111–1d111 (Fig. 3e,f). Weak expression was detected in all other micromeres. HasHsp70 expression was most prominent in the trochoblast lineage at 5 hpf (Fig. 3g,h). At 7 hpf, HasHsp70 expression was detected more extensively in the ventrolateral and pre-trochal ectoderms, the shell gland and the prototroch (Fig. 3i,j). HasHsp70 was detected in the ventrolateral and pre-trochal ectoderms and the shell gland of the 9 hpf trochophore; however, it was not detected in the prototroch (Fig. 3k,l). Expression was detected in the ventrolateral and pre-trochal ectoderms, shell gland and prototroch at 11 hpf (Fig. 3m–p). Similar to HasHsp90A, HasHsp70 expression was not detected in the endoderm (Fig. 3p). At 16 hpf, HasHsp70 was detected throughout the foot, and expression was maintained in the shell gland lineage through the formation of the mantle (Fig. 3q,r). HasHsp70 was dramatically restricted in the 40-hpf veliger to two clusters of three cells positioned just behind the leading edge of the mantle on the right hand side (Fig. 3s,t). Occasionally, staining of a similar nature was observed on the left-hand side, possibly indicating that these cells migrate during later development.

Developmental expression of HasHSF

The full-length sequence for HasHSF was obtained through a combination of degenerate and RACE cloning of an H. asinina cDNA library. HasHSF has a 57-bp 5′ UTR, a 490-amino acid ORF and a 406-bp 3′ UTR (Supplemental Fig. S3). A conceptual amino acid translation of HasHSF displays the hallmark characteristics of the HSF1 family outlined in Pirkkala et al. (2001), including the DNA binding domain, oligomerisation domain and C-terminal oligomerisation domain (Fig. 4a). The identity of HasHSF was confirmed through phylogenetic analysis (Swofford 1998) (Fig. 4b).

Fig. 4

Fig. 4

The alternative text for this image may have been generated using AI.

Full size image

Structure and expression of HasHSF. a Schematic diagram of HsHSF and HasHSF (Pirkkala et al. 2001). Hs Homo sapiens, Has H. asinina. b Neighbour joining tree of the HasHSF amino acid sequence. Sp Strongylocentrotus purpatus, Gg Gallus gallus, Xl Xenopus laevis, Dr Danio rerio, Am Apis mellifera, Dm Drosophila melanogaster, Ls Lottia scutum, Ce Caenorhabditis elegans, Sm Schistosoma mansoni, Ci Ciona intestinalis, Sc Saccharomyces cerevisiae. c–n Representative whole mount in situ micrographs. c–e, g, i, k, m and n Lateral views of expression with anterior facing the top and dorsal left when dorsal is known. f, h and j Anterior views; l is a ventral view. c HasHSF expression in the unfertilised egg with animal pole up, d 8-cell stage embryo. e, f Localisation of HasHSF is maintained in the micromere lineage at 4 hpf and the 5 hpf gastrula where it is upregulated in the leading edge of epibolic cells (g, h). i, j Seven-hpf late gastrulas, HasHSF is upregulated in the ventrolateral ectoderm and prototroch, and this pattern becomes increasingly restricted at the trochophore stage at 9 hpf (k, l). m The mid and late veligers (n) express HasHSF in individual cells distributed throughout the visceral mass, from a central position in the vicinity of the larval retractor muscle (arrow), to the ectodermal cells on the underside of the visceral mass (larger arrow). ap animal pole, e eyespot, f foot, lr larval retractor muscle, m mantle, mi micromeres, p prototroch, pe pre-trochal ectoderm, sg shell gland, v velum, ve ventrolateral ectoderm, vm visceral mass, vp vegetal pole, asterisk stomodaeum; dashed lines outline the prototroch

HasHSF was expressed in a more consistent and universal pattern during embryonic and early larval development than HasHsp90A and HasHsp70 (Figs. 2c–x, 3c–t and 4c–n). As in HasHsp90 and HasHsp70, HasHSF was detected in the animal hemisphere of unfertilised eggs and the 8-cell stage (Fig. 4c,d). HasHSF was evenly detected in all ectodermal micromeres at 4 hpf (Fig. 4e,f). Staining was more intense in the leading edge of the epibolic cells at 5 hpf and was maintained evenly in all other micromeres (Fig. 4g,h). At 7 hpf, HasHSF was upregulated in the vegetal micromeres, corresponding to the position of the ventrolateral ectoderm and shell gland (Fig. 4i,j). Expression was more restricted to the ventrolateral ectoderm and shell gland at 9 hpf, as well as the prototroch and in the pre-trochal ectoderm (Fig. 4k,l). HasHSF staining was very faint at 9 hpf, possibly due to low transcript abundance, and no staining was observed that exceeded the background level at 11 and 16 hpf (data not shown). Strong staining was, however, present in the mid-veliger (40 hpf) (Fig. 4m), where HasHSF was detected in a unique pattern in a subset of cells localised in the visceral mass in the vicinity of the posterior portion of the larval retractor muscle. The identity of these cells was unknown. A similar staining pattern was observed in the late veliger (72 hpf) (Fig. 4n).

Discussion

We cloned cDNAs encoding single isoforms of Hsp70, Hsp90 and HSF from the vetigastropod mollusc, H. asinina, as a means of determining if these genes may play a role in the development of a lophotrochozoan representative. Their developmental expression and functionality have been previously examined in ecdysozoan and vertebrate representatives (Ding et al. 1993; Rutherford and Lindquist 1998; Sconzo et al. 1997; Bishop et al. 2002; Sass et al. 1996; Lele et al. 1999; Vega-Núñez et al. 1999; Rubio et al. 2002). The dynamic spatial expression patterns of the Hsp isoforms and HSF in H. asinina are compatible with these genes having a role in tissue differentiation and morphogenesis.

While HasHsp70, HasHsp90A and HasHSF have unique developmental expression patterns, there is a significant degree of overlap in the embryonic cells and larval tissues that express them. All three genes are maternally expressed. HasHsp70, HasHsp90A and HasHSF transcripts localise to the micromere lineages during cleavage and in the developing prototroch and ventrolateral ectoderm during early trochophore development (Fig. 5a–d); we did not determine when zygotic expression of these genes is activated. HasHsp70, HasHsp90A and HasHSF transcripts do not overlap completely in their localisation patterns. For example, in the 9-hpf trochophore, HasHSF, HasHsp70 and HasHsp90A are expressed in slightly different ectodermal cells, with HasHsp70 and HasHSF being more strongly expressed in the shell gland and prototroch than HasHsp90A (Fig. 5d). HasHsp70 and HasHsp90A overlap closely in the pre-torsional veliger, HasHSF is not at a detectable level (Fig. 5e). The observed in situ hybridisation patterns are likely to represent relative transcript enrichment, as each cell should express Hsps for normal functionality (Morimoto et al. 1994).

Fig. 5

Fig. 5

The alternative text for this image may have been generated using AI.

Full size image

HasHSF, HasHsp70 and HasHsp90A are dynamically expressed in overlapping but unique domains during differentiation and morphogenesis. a–e Cartoons displaying the expression of the Hsps and HSF. Lateral orientation with anterior facing the top. a Unfertilised egg, b 8-cell stage embryo, c 4-hpf embryo, d 9-hpf trochophore, e 16-hpf pre-torsional veliger. f A temporal representation of the major tissues in which the Hsps and HSF are expressed. Early gastrula = 4 hpf; mid-gastrula = 5 hpf; late gastrula = 7 hpf; hatch = 9 hpf; mid-trochophore = 11 hpf; pre-torsional veliger = 16 hpf; post-torsional veliger = 24 hpf; mid-veliger = 40 hpf. Solid line HasHSF, dashed line HasHsp70, dotted line HasHsp90A. The span of the lines extends from the first stage in which expression is detected in a particular tissue field through to the first stage at which it is not detected. Note that no single field maintains the expression of the Hsps continually, and while expression overlaps, the expression of each gene maintains a unique spatial pattern

We observed higher levels of expression of the Hsps and HSF in tissues undergoing morphogenesis. For example, the prototroch is the first tissue to be specified in molluscan embryonic development, as indicated by a change in junctional communication, cell cycle arrest and ciliation at the 88-cell stage of P. vulgata (Serras et al. 1990). Based on relative similarities in cell lineage and fate, the timing of trochoblast specification is likely to be similar in H. asinina (van den Biggelaar 1993; Dictus and Damen 1997). HasHsp90A is expressed in the trochoblasts at 3.5 hpf, which is approximately the 91-cell stage and is maintained in the trochoblasts until they have become organised into a uniform ring in the hatching trochophore.

Hsp expression in the trochophore larva also correlates with the morphogenesis of other tissues. These data also are compatible with dye coupling experiments in Lymnaea stagnalis and P. vulgata (Serras and van den Biggelaar 1987; Serras et al. 1989), which are indicative of fields of cells functioning as coherent units. At 7 hpf in H. asinina we observed that the shell gland strongly expresses HasHsp70 and HasHSF; HasHsp90A is expressed at high levels in the shell gland/mantle a few hours later. The shell gland is the first post-trochal tissue to form an independent communication compartment in L. stagnalis (Serras and van den Biggelaar 1987). At 16 hpf, HasHsp70 and HasHsp90A are expressed at high levels throughout the foot, which forms through the proliferation of the ventral ectoderm in the region between the mantle edge and stomodaeum (Raven 1966). At this stage of larval development in P. vulgata, the foot and mantle become independent communication compartments (Serras et al. 1989). HasHsp90A is expressed in a complex pattern in the pallial cavity of the veliger, a region in which a number of organs were undergoing morphogenesis (Crofts 1937; Raven 1966; Page 2006; Hejnol et al. 2007).

It is interesting to note that in the late veliger (72 hpf), in which tissue morphogenesis is limited, HasHsp90A expression is only detected in the buccal cavity, and was patchy in the visceral mass, and was at a low level in all other cells in the veliger. It is known that morphogenesis of postlarval structures in the vicinity of the buccal cavity (radula teeth; Barlow and Truman 1992) and visceral mass (intestine; Degnan et al. 1995) occurs in late-staged Haliotis larvae, lending further support to the supposition that Hsps play a role in morphogenetic processes.

The transient upregulation of Hsps in tissues undergoing morphogenesis followed by a subsequent downregulation has been described for other animals. For example, in the sea urchin, Hsc75 is upregulated in the ingressing micromeres only during gastrulation, but it is not maintained in this lineage in subsequent stages (Sconzo et al. 1997). Drosophila Hsc4 (Hsc70) is upregulated in a stage- and tissue-specific manner throughout embryogenesis (Perkins et al. 1990) in tissues such as the pharynx, gut, muscles and neuroblasts. Hsp90 is transiently upregulated in zebrafish muscles during their differentiation (Sass et al. 1996). Hsps are also transiently upregulated during the early stages of human neural differentiation in a complex, cell-type specific and progressively more rostral pattern (Kato et al. 1995). In mouse, Hsp70 is strongly expressed prior to the differentiation of diverse tissues and is rapidly degraded after differentiation. Additionally, it is upregulated in F9 carcinoma cell lines and is downregulated towards the end of embryogenesis and upon induction of differentiation through retinoic acid (Giebel et al. 1988). Pharmacological inhibition of Hsp90 results in the morphological and functional differentiation of breast cancer cell lines (Münster et al. 2001).

In addition to a role in larval morphogenesis, Hsps may be contributing to the regulation of cleavage in H. asinina. Hsps are known to have a role in cell cleavage in a broad range of organisms, potentially through their association with components of the cell cleavage apparatus (Perret et al. 1995; Csermely et al. 1998). The H. asinina tissues that express Hsps are mainly derived from the micromere lineage, which undergoes more rapid cleavage than the macromere lineage, and may thus have an increased requirement for Hsp expression (van den Biggelaar 1993). The localisation of maternal HasHsp70, HasHsp90A and HasHSF transcripts to cytoplasmic territories that give rise to first- and second-quartet micromeres is compatible with these genes also being involved in cell cycle processes.

The patterns of Hsp coregulation may reflect the biochemical functions of the Hsps. Hsp90 is known to be dependent on an initial stabilisation of substrates by Hsp70 (Pratt and Toft 2003). Additionally, the expressions of Hsp70 and Hsp90 are likely to be controlled by HSF (Pirkkala et al. 2001). The patterns of expression of these genes in Haliotis overlapped considerably less in the mid- to late-veliger stages. This may reflect the presence of multiple Hsp isoforms. In other molluscs, four cytosolic _Hsp70_s have been isolated from Ostrea edulis (Piano et al. 2005), five from Crassostrea gigas and seven from Mytilus galloprovincialis (Kourtidis et al. 2006). Additionally, while it appears that there was a single Hsp90 isoform in invertebrates (Gupta 1995), the examination of the sea urchin genome suggests that there are four Hsp90 isoforms (Goldstone et al. 2006). While the presence of multiple Hsp90 isoforms may represent a lineage-specific duplication event specific to echinoderms, additional Hsp isoforms may also exist in the H. asinina genome.

Conclusions

Hsps are extensively expressed during the development of a range of organisms, and function in tissue differentiation and morphogenesis. Single isoforms of HSF, Hsp70 and Hsp90 were isolated from H. asinina. Each was expressed in diverse cell lineages and tissues that often overlapped during embryogenesis and larval development. These expression patterns correlated with cells and tissues undergoing differentiation and morphogenesis, as has been previously observed in ecdysozoans and deuterostomes. The research presented here represents the first demonstration of the developmental importance of Hsps in a lophotrochozoan and lends support to an ancestral role for Hsps in normal development in all bilaterians.

References

Download references