Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains (original) (raw)

Abstract

We identified a new type of staphylococcal cassette chromosome mec (SCC_mec_) from two community-acquired methicillin-resistant Staphylococcus aureus (MRSA) strains. The novel element, designated type IV SCC_mec_, had a unique combination of the class B mec gene complex and the type 2 ccr gene complex and was much smaller in size (21 to 24 kb) than previously identified SCC_mec_ elements of hospital-acquired MRSA. Consistent with the strains' susceptibilities to various non-β-lactam antibiotics, the type IV SCC_mec_ was devoid of any antibiotic resistance genes other than the mecA gene.


Since the first discovery of methicillin-resistant Staphylococcus aureus (MRSA) in 1961 in England, MRSA has become one of the most prevalent pathogens that cause nosocomial infections (13). MRSA produces a specific penicillin-binding protein (PBP) called PBP 2′ (or PBP 2a) that possesses reduced affinities for binding to β-lactam antibiotics (2, 7, 22). PBP 2′ is encoded by the mecA gene, which is carried by a large mobile genetic element that is designated staphylococcal cassette chromosome mec (SCC_mec_) and that is integrated on the chromosomes of MRSA strains isolated from hospitals in various countries throughout the world (11, 12, 14, 15).

Recently, MRSA infections have increasingly been reported among groups of patients with no apparent connection to hospitals (4). Those strains, designated community-acquired MRSA (C-MRSA) strains, have been reported in various countries such as Australia (16, 18), New Zealand (19), the United Kingdom (20), Canada (5), and the United States (6, 8). The death of four children caused by C-MRSA strains has alerted us to the threat of latent dissemination of highly virulent C-MRSA strains in the community in the United States (3).

In contrast to hospital-acquired MRSA (H-MRSA), C-MRSA is characteristically susceptible to many antibiotics (3, 21), but it remains unclear whether C-MRSA is a descendant of H-MRSA or was born and evolved independently of the hospital environment (4). In order to understand the evolutionary relationship between C-MRSA and H-MRSA, we determined the entire nucleotide sequences of the SCC_mec_ elements integrated into the chromosomes of two C-MRSA clinical strains. Strain CA05 (JCSC1968) was isolated from the joint fluid of a patient with septic arthritis and osteomyelitis, and strain 8/6-3P (JCSC1978) was isolated from the perineum of another patient (10).

We amplified DNAs encompassing the entire SCC_mec_ sequence by long-range PCR with several sets of primers, as follows. The region from the left extremity to the ccr genes (L-C region) was covered by primer sets α5 and cLs1 (CA05) or CL2b (8/6-3P) (Fig. 1). Primers α6 and mcR8 were used to cover the middle part (from the region just upstream of ccrA to mecR1; the C-M region). Two overlapping primer sets (primers is4 and mA2 and primers mA3 and cR1) were used to cover the right extremities (from IS_431mec_ to orfX; the I-R region) (Fig. 1) (11, 12, 14). The rest of the element was amplified and sequenced with primers as described previously (11, 12, 14). The PCR products were purified with a High Pure PCR product purification kit (Roche Diagnostics GmbH, Mannheim, Germany), and their nucleotide sequences were determined as described previously (9).

FIG. 1.

FIG. 1.

Structure of the SCC_mec_ elements identified from C-MRSA strains in comparison with the three types of SCC_mec_ elements. (A) Type I SCC_me_c carried by NCTC 10442. (B) Type IV SCC_mec_ carried by strain CA05 (subtype a). (C) Type IV SCC_mec_ carried by strain 8/6-3P (subtype b). (D) Type II SCC_mec_ carried by N315. (E) Type III SCC_mec_ carried by 85/2082. The ORFs of greater than 200 nucleotides in six possible reading frames of type IV SCC_mec_ elements are illustrated in the squares under the bars that represent essential genes and restriction sites for Hin_dIII and Xba_I. Differences in coloration correspond to differences in the nucleotide sequences. Color codes are as follows: white, ORFs or the parts of ORFs that are conserved in all four types of SCC_mec elements with greater than 99% amino acid identities; gray, ORFs or the parts of ORFs that are conserved in four types of SCC_mec with amino acid identities of 46 to 98%; magenta, ORFs or the parts of ORFs that are common to type I and type II SCC_mec_ elements; yellow, ORFs or the parts of ORFs that are common to type II and type III SCC_mec_ elements; blue, ORFs or the parts of ORFs that are unique to type I SCC_mec_; red, ORFs or the parts of ORFs that are unique to type II SCC_mec_; green, ORFs or the parts of ORFs that are unique to type III SCC_mec_, light green, ORFs or the parts of ORFs that are unique to type IVa SCC_mec_; and orange, ORFs or the parts of ORFs that are unique to type IVb SCC_mec_. The locations of primers used for amplification of the type IV SCC_mec_ are indicated by arrows: they are primers α5 (5′-TGTTAAGTATATTGCACTTTATGATTCAATGCCT-3′), cLs1 (5′-TGCCAATCACAGTTCAATCAATT-3′), α6 (5′-ATTAGCCGATTTGGTAATTGAA-3′), mCR8 (5′-ATATTCCCGTATGAAAAACAGGACTTGAACTTGCA-3′), and CL2b (ATATTCCCGATAGAAAAACAGGACTTGAACTTGCA) and previously described primers is4, mA2, mA3, and cR1 (11, 12, 14). The entire nucleotide sequences of the type IV SCC_mec_ elements are available in the DDBJ/EMBL/GenBank databases under accession no. AB063172 (subtype a) and AB063173 (subtype b). H, _Hin_dIII, X, _Xba_I; E, _Eco_RI; P, Pst1.

Figure 1 illustrates the genomic organizations of the SCC_mec_ elements identified from the two C-MRSA strains in comparison with the three extant types of SCC_mec_. The SCC_mec_ elements of strains CA05 and 8/6-3P were 24,248 and 20,920 bp, respectively, and were much smaller (34 to 67 kb) than three types of SCC_mec_ elements identified from H-MRSA strains (12). Both elements were found to be integrated at the integration site for SCC_mec_, attBscc, which is found inside orfX, which has an unknown function and is located near the origin of replication of the S. aureus chromosome (12, 15). The SCC_mec_ elements shared a pair of 15-bp direct repeat sequences: one (DRscc-R) at the right extremities and the other (DRscc-L) on the chromosome region abutting the left termini of the elements (shown as thick arrows in Fig. 2). Degenerate inverted repeats were also found in the extremities of the two SCC_mec_ elements (shown by thin arrows in Fig. 2). The authenticity of the SCC_mec_ boundaries was vindicated by using a previously described method (14); i.e., by confirming that the element was precisely cut out from the chromosomes of the two C-MRSA strains, regenerating attBscc in the chromosomes of the cell populations from which it was excised.

FIG. 2.

FIG. 2.

Chromosome-SCC_mec_ junction sequences of type IV SCC_mec_. The nucleotide sequences around the left and right boundaries of the SCC_mec_ elements of CA05 and 8/6-3P are aligned with those of type II SCC_mec_. Thin arrows indicate inverted repeats IR-L and IR-R at both extremities of SCC_mec_ elements. Thick arrows indicate direct repeats DRscc-L and DRscc-R.

The nucleotide sequences of the L-C regions of the two SCC_mec_ elements differed from each other, but otherwise, they shared the same features: type 2 ccr gene complexes, the class B mec gene complexes (IS_1272_-Δ_mecR1_-mecA_-IS_431), and the I-R region that was 99.9% identical to that of type II SCC_mec_ elements (Fig. 1). This combination of ccr and mec gene complexes was a novel one. That is, the class B mec gene complex has been found to be in close linkage with the type 1 ccr gene complex in type I SCC_mec_ (12). However, the ccr gene complexes of the novel SCC_mec_ elements were more similar to the type 2 gene complex than to the type 1 ccr gene complex: the amino acid identities between the novel CcrA proteins and the type 2 CcrA (CcrA2) and type 1 CcrA (CcrA1) proteins were about 98 and 75%, respectively; and those between the novel CcrB proteins and the CcrB2 and CcrB1 proteins were 97 to 99 and 72 to 81%, respectively (Table 1). Accordingly, we classified the genes as variants of ccrA2 and ccrB2 by designating them the ccrA2.1 and ccrA2.2 genes and the ccrB2.1 and ccrB2.2 genes, respectively (Table 1). As shown in Table 1, the predicted proteins encoded by the open reading frames (ORFs) surrounding the ccrA and ccrB genes also had significantly higher degrees of similarity to those of the type 2 gene complex than to those of the type 1 ccr gene complex. On the basis of this unique combination of the two complexes, we named the novel SCC_mec_ elements type IV SCC_mec_ and assigned the designations subtypes IVa and IVb to the individual elements of CA05 and 8/6-3P, respectively, on the basis of their unique nucleotide sequences in the L-C region (Fig. 1).

TABLE 1.

ORFs in SCC_mec_’s of CA05 and 8/6-3P

Strain (element) and ORFa Location (position)b Size (bp) of gene Description of gene product
CA05 (JCSC1968) (type IV SCC_mec_ subtype a)
CQ001 Complement (1280-1900) 621 Hypothetical protein
Q001 2653-3657 1,005 Hypothetical protein
CQ002 Complement (4281-5771) 1,491 Hypothetical protein
CQ003 Complement (6389-7438) 1,050 Conserved hypothetical protein
Q002 7577-7867 291 Conserved hypothetical protein
Q003 7867-9654 1,788 Conserved hypothetical protein
Q005 9888-11237 1,350 (ccrA2.1) Cassette chromosome recombinase A
Q006 11259-12887 1,629 (ccrB2.1) Cassette chromosome recombinase B
Q007 13409-13759 351 Conserved hypothetical protein
Q008 13846-14157 312 Conserved hypothetical protein
Q009 14169-14678 510 Conserved hypothetical protein
Q010 14679-16337 1,659 Putative transposase of IS 1272
CQ004 Complement (16560-17546) 987 (Δ_mecR1_) Truncated signal transducer protein MecR1
Q011 17646-19652 2,007 (mecA) PBP 2′
CQ005 Complement (19698-20126) 429 Conserved hypothetical protein
CQ007 Complement (20223-20966) 744 (ugpQ) Glycerophosphoryldiester phosphodiesterase
Q012 22268-22942 675 tnp Transposase for insertion sequence-like element IS_431me_c
CQ008 Complement (22974-23213) 240 Conserved hypothetical protein
CQ009 Complement (23628-24659) 1,032 Truncated conserved hypothetical protein
CQ010 Complement (24509-24883) 375 Truncated conserved hypothetical protein
(CQ011) Complement (25205-25684) 480 OrfX
8/6-3P (JCSC1978) (type IV SCC_mec_ subtype b)
CM001 Complement (325-1446) 1,122 Hypothetical protein
CM002 Complement (1424-2194) 771 Hypothetical protein
M001 2311-3741 1,431 Hypothetical protein
M002 3861-5651 1,791 Conserved hypothetical protein
M004 5885-7234 1,350 (ccrA2.2) Cassette chromosome recombinase A
M005 7256-8884 1,629 (ccrB2.2) Cassette chromosome recombinase B
M006 9406-9756 351 Conserved hypothetical protein
M007 9843-10154 312 Conserved hypothetical protein
M008 10166-10675 510 Conserved hypothetical protein
M009 10676-12334 1,659 Putative transposase of IS_1272_
CM003 Complement (12557-13543) 987 (Δ_mecR1_) Truncated signal transducer protein MecR1
M010 13643-15649 2,007 (mecA) PBP 2′
CM004 Complement (15695-16123) 429 Conserved hypothetical protein
CM006 Complement (16220-16963) 744 (ugpQ) Glycerophosphoryldiester phosphodiesterase
M011 18265-18939 675 tnp Transposase for insertion sequence-like element IS_431me_c
CM007 Complement (18971-19210) 240 Conserved hypothetical protein
CM008 Complement (19625-20656) 1,032 Truncated conserved hypothetical protein
CM009 Complement (20506-20880) 375 Truncated conserved hypothetical protein
CM010 Complement (21204-21683) 480 OrfX
Homology to ORFs of type I SCC_mec_ Homology to ORFs of type II SCC_mec_ Homology to ORFs of type III SCC_mec_ Homology to ORFs of type IV SCC_mec_ subtype b
% Identityc Corresponding ORF(s) (size [bp]) % Identityc Corresponding ORF(s) (size [bp]) % Identityc Corresponding ORF(s) (size [bp]) % Identityc Corresponding ORF(s) (size [bp])
96.4 E024 (1329) 72.4 N053d (861) 72.4 Z025d (861)
77.8 CZ002 (1,068)
46.2 E025 (297) 46 N030 (297) 45.7 Z003 (288)
77.3 E026 (1,770) 85.3 N031 (1,794) 66.3 Z004 (1,569) 82.4 M002 (1791)
75 ccrA1 (1,350) 97.6 ccrA2 (1,350) 72.4 ccrA3 (1,350) 98.2 M004 (1350)
72.4 ccrB1 (1,152) 97.4 ccrB2 (1,629) 87.5 ccrB3 (1,629) 99.3 M005 (1629)
85.3 E031 (351) 88.8 N041 (351) 51.3 Z011 (351) 100 M006 (351)
85.4 E032 (327) 89.2 N042 (312) 47.2 Z013 (396) 100 M007 (312)
97.6 E033 (510) 92.7 N043 (318) 61.3 Z014 (522) 100 M008 (510)
100 E034 (1,659) 100 M009 (1659)
100 Δ_mecR1_NCTC10442 (987) 100 _mecR1_N315 (1,758) 100 Δ_mecR1_85/2082 (114) 100
99.9 _mecA_NCTC10442 (2,007) 100 _mecA_N315 (2,007) 99.7 _mecA_85/2082 (2007) 100
99.3 CE025 (429) 100 CN038 (429) 100 CZ029 (429) 100 CM004 (429)
100 CE026 (744) 100 CN039 (744) 100 CZ030 (744) 100
100 E040 (675) 100 N062 and N070 (675) 100, 99.6, 99.1, 99.1 Z035, Z041, Z046, and Z058 (675) 100
100 CE029 (240) 100 CM007 (240)
100 CE030 (1,296) 100 CN050 (1,296) 100 CM008 (1032)
98.4 CE030 (1,296) 98.4 CN050 (1,296) 100 CM009 (375)
100 orfX (480) 100 orfX (480) 100 orfX (480) 100 CM010 (480)
70.3 E026 (1,770) 80.7 N031 (1,794) 72.1 Z004 (1,569)
75.2 ccrA1 (1,350) 96.2 ccrA2 (1,350) 73.5 ccrA3 (1,350)
80.6 ccrB1 (1,152) 98.2 ccrB2 (1,629) 87.1 ccrB3 (1,629)
85.3 E031 (351) 88.8 N041 (351) 5.3 Z011 (351)
85.4 E032 (327) 89.2 N042 (312) 4.2 Z013 (396)
97.6 E033 (510) 92.3 N043 (318) 61.3 Z014 (522)
100 E034 (1,659)
100 Δ_mecR1_NCTC10442 (987) 100 _mecR1_N315 (1,758) 100 Δ_mecR1_85/2082 (114)
99.9 _mecA_NCTC10442 (2,007) 100 _mecA_N315 (2,007) 99.7 _mecA_85/2082 (2,007)
99.3 CE025 (429) 100 CN038 (429) 100 CZ029 (429)
100 CE026 (744) 100 CN039 (744) 100 CZ030 (744)
100 E040 (675) 100 N062 and N070 (675) 100, 99.6, 99.1, 99.1 Z035, Z041, Z046, and Z058 (675)
100 CE029 (240)
100 CE030 (1,296) 100 CN050 (1,296)
98.4 CE030 (1,296) 98.4 CN050 (1,296)
100 orfX (480) 100 orfX (480) 100 orfX (480)

The BLAST and MOTIF programs failed to assign any biological functions to the hypothetical ORFs in the L-C regions of type IV SCC_mec_ elements (1, 17). With their simple genetic organizations, neither a virulence factor nor antibiotic resistance other than that encoded by mecA was found to be encoded by the entire regions of the novel SCC_mec_ elements. This lack of genes encoding resistance to non-β-lactam antibiotics in the type IV SCC_mec_ was consistent with the notable characteristic of C-MRSA; i.e., its susceptibility to various antibiotics except β-lactams (3, 6). In fact, as shown in Table 2, the two strains were susceptible to all the non-β-lactam antibiotics tested.

TABLE 2.

Antibiotic susceptibility profiles of the two C-MRSA strains in comparison with those of H-MRSA strains

Strain Type of SCC mec MIC (mg/liter)a
Oxacillin Ampicillin Ceftizoxime Imipenem Erythromycin Tobramycin Kanamycin Tetracycline
CA05 IV 8 32 128 0.125 0.5 0.25 2 0.125
8/6-3P IV 8 16 128 0.125 0.125 0.125 1 0.125
NCTC 10442 I 256 256 >512 16 0.125 0.125 1 128
N315 II 16 32 16 1 >512 512 >512 0.125
85/2082 III 32 32 >512 0.5 >512 8 512 128
ATCC 29213b 0.25 0.5 4 0.03 0.125 0.25 1 0.125

The lack of function of type IV SCC_mec_ other than those for the movement of the element (ccr genes) and methicillin resistance (mecA), together with its small size, may lead to the view that the element has gone through evolutionary refinement as a specific carrier of DNA for methicillin resistance. Furthermore, the lack of superfluous functions may make the element more fit as a mobile genetic element for S. aureus in the community than any other type of SCC_mec_, for the following reasons. A number of ORFs carried by type I and type II SCC_mec_ elements in their long L-C regions are considered unnecessary for the benefit of the host cells that carry the elements (11, 12). Actually, many of them are mutated or partially deleted and do not seem to be active. Moreover, an ORF for type I SCC_mec_ encoding plasmin-sensitive surface protein may even be hazardous to the host cell because it interferes with the fibrinogen- and fibronectin-binding properties of the host cell (23). Although the type III SCC_mec_ has a short L-C region comparable in size to those of type IV SCC_mec_ elements, the size of the element is extremely large (68 kb) because of the accumulation of multiple genes for resistance to various antibiotics and heavy metals (12). The determinants for resistance to multiple antibiotics carried by the previously studied types of SCC_mec_ elements (type II and type III elements) may be suited for the survival of H-MRSA in the hospital environment, where various antibiotics as well as antiseptics provide selective pressure, but their large sizes and potentially hazardous arrays of exogenous genes may not be suited to MRSA strains in the community, where selective advantage would make strains more inclined to have a higher growth rate and to be better able to colonize humans than to have a multidrug resistance phenotype. From this viewpoint, the type IV SCC_mec_ may be one of the fit SCC_mec_ types that can confer β-lactam resistance to community strains of S. aureus without greatly compromising their competitiveness among the natural flora of humans. Future analyses of many community-acquired strains will be required to test if this hypothesis holds true.

Nucleotide sequence accession numbers.

The subtype a and b type IV SCC_mec_ elements have been deposited in the DDBJ/EMBL/GenBank databases under accession no. AB063172 and AB063173, respectively.

Acknowledgments

This work was supported by the Core University System Exchange Program under the Japan Society for the Promotion of Science, coordinated by the University of Tokyo Graduate School of Medicine and Mahidol University. The study was also partly supported by a grant for International Health Cooperation Research (grant 11C-4) from the Ministry of Health and Welfare of Japan.

REFERENCES