Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains - PubMed (original) (raw)

Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains

Xiao Xue Ma et al. Antimicrob Agents Chemother. 2002 Apr.

Abstract

We identified a new type of staphylococcal cassette chromosome mec (SCCmec) from two community-acquired methicillin-resistant Staphylococcus aureus (MRSA) strains. The novel element, designated type IV SCCmec, had a unique combination of the class B mec gene complex and the type 2 ccr gene complex and was much smaller in size (21 to 24 kb) than previously identified SCCmec elements of hospital-acquired MRSA. Consistent with the strains' susceptibilities to various non-beta-lactam antibiotics, the type IV SCCmec was devoid of any antibiotic resistance genes other than the mecA gene.

PubMed Disclaimer

Figures

FIG. 1.

FIG. 1.

Structure of the SCC_mec_ elements identified from C-MRSA strains in comparison with the three types of SCC_mec_ elements. (A) Type I SCC_me_c carried by NCTC 10442. (B) Type IV SCC_mec_ carried by strain CA05 (subtype a). (C) Type IV SCC_mec_ carried by strain 8/6-3P (subtype b). (D) Type II SCC_mec_ carried by N315. (E) Type III SCC_mec_ carried by 85/2082. The ORFs of greater than 200 nucleotides in six possible reading frames of type IV SCC_mec_ elements are illustrated in the squares under the bars that represent essential genes and restriction sites for Hin_dIII and Xba_I. Differences in coloration correspond to differences in the nucleotide sequences. Color codes are as follows: white, ORFs or the parts of ORFs that are conserved in all four types of SCC_mec elements with greater than 99% amino acid identities; gray, ORFs or the parts of ORFs that are conserved in four types of SCC_mec with amino acid identities of 46 to 98%; magenta, ORFs or the parts of ORFs that are common to type I and type II SCC_mec_ elements; yellow, ORFs or the parts of ORFs that are common to type II and type III SCC_mec_ elements; blue, ORFs or the parts of ORFs that are unique to type I SCC_mec_; red, ORFs or the parts of ORFs that are unique to type II SCC_mec_; green, ORFs or the parts of ORFs that are unique to type III SCC_mec_, light green, ORFs or the parts of ORFs that are unique to type IVa SCC_mec_; and orange, ORFs or the parts of ORFs that are unique to type IVb SCC_mec_. The locations of primers used for amplification of the type IV SCC_mec_ are indicated by arrows: they are primers α5 (5′-TGTTAAGTATATTGCACTTTATGATTCAATGCCT-3′), cLs1 (5′-TGCCAATCACAGTTCAATCAATT-3′), α6 (5′-ATTAGCCGATTTGGTAATTGAA-3′), mCR8 (5′-ATATTCCCGTATGAAAAACAGGACTTGAACTTGCA-3′), and CL2b (ATATTCCCGATAGAAAAACAGGACTTGAACTTGCA) and previously described primers is4, mA2, mA3, and cR1 (11, 12, 14). The entire nucleotide sequences of the type IV SCC_mec_ elements are available in the DDBJ/EMBL/GenBank databases under accession no. AB063172 (subtype a) and AB063173 (subtype b). H, _Hin_dIII, X, _Xba_I; E, _Eco_RI; P, Pst1.

FIG. 2.

FIG. 2.

Chromosome-SCC_mec_ junction sequences of type IV SCC_mec_. The nucleotide sequences around the left and right boundaries of the SCC_mec_ elements of CA05 and 8/6-3P are aligned with those of type II SCC_mec_. Thin arrows indicate inverted repeats IR-L and IR-R at both extremities of SCC_mec_ elements. Thick arrows indicate direct repeats DRscc-L and DRscc-R.

Similar articles

Cited by

References

    1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. - PubMed
    1. Brown, D. F., and P. E. Reynolds. 1980. Intrinsic resistance to beta-lactam antibiotics in Staphylococcus aureus. FEBS Lett. 122:275-278. - PubMed
    1. Centers for Disease Control and Prevention. 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus—Minnesota and North Dakota, 1997-1999. Morb. Mortal. Wkly. Rep. 48:707-710. - PubMed
    1. Chambers, H. F. 2001. The changing epidemiology of Staphylococcus aureus. Emerg. Infect. Dis. 7:178-182. - PMC - PubMed
    1. Embil, J., K. Ramotar, L. Tomance, M. Alfa, J. Conly, S. Cronk, G. Taylor, B. Sutherland, T. Louie, E. Henderson, et al. 1994. Methicillin-resistant Staphylococcus aureus in tertiary care institutions on the Canadian prairies 1990-1992. Infect. Control. Hosp. Epidemiol. 15:646-651. - PubMed

Publication types

MeSH terms

Substances

LinkOut - more resources