ATP-dependent mobilization of the glucocorticoid receptor during chromatin remodeling - PubMed (original) (raw)
ATP-dependent mobilization of the glucocorticoid receptor during chromatin remodeling
Terace M Fletcher et al. Mol Cell Biol. 2002 May.
Abstract
Chromatin remodeling by the glucocorticoid receptor (GR) is associated with activation of transcription at the mouse mammary tumor virus (MMTV) promoter. We reconstituted this nucleoprotein transition with chromatin assembled on MMTV DNA. The remodeling event was ATP dependent and required either a nuclear extract from HeLa cells or purified human Swi/Snf. Through the use of a direct interaction assay (magnetic bead pull-down), we demonstrated recruitment of human Swi/Snf to MMTV chromatin by GR. Unexpectedly, we found that GR is actively displaced from the chromatin template during the remodeling process. ATP-dependent GR displacement was reversed by the addition of apyrase and was specific to chromatin templates. The disengagement reaction could also be induced with purified human Swi/Snf. Although GR apparently dissociated during chromatin remodeling by Swi/Snf, it participated in binding of the secondary transcription factor, nuclear factor 1. These results are paralleled by a recent discovery that the hormone-occupied receptor undergoes rapid exchange between chromatin and the nucleoplasmic compartment in living cells. Both the in vitro and in vivo results are consistent with a dynamic model (hit and run) in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, facilitates transcription factor binding, and is simultaneously lost from the template.
Figures
FIG. 1.
Binding of GR to reconstituted MMTV chromatin in vitro. (A) Diagram for chromatin pull-down assay using chromatin reconstituted onto MMTV DNA (positions −437 to +674) attached to streptavidin-coated magnetic beads at +674 (_Nco_I site). (B) Enhancement of GR binding to MMTV chromatin by HeLa nuclear extract. Purified GR (3 nM) was incubated at 30°C for 15 min with 100 ng of DNA (lanes 1 and 2) or chromatin (lanes 3 and 4) in the presence or absence of 0.5 mg of HeLa nuclear extract/ml as indicated. The associated proteins were analyzed by SDS-PAGE and immunoblotting with PAI-512 anti-GR antibody. (C) Chromatin pull-down assay detecting GR binding specifically to GREs. Purified GR (3 nM) was incubated with wild-type (wt) or GRE-mutated (m) MMTV chromatin and detected as described above. The GRE mutant template was composed of GRE sites 2, 3, 4, 5, and 6 mutated as described by Fletcher et al. (13). (D) Effect of HMG-1 on binding of GR to MMTV promoter. Purified HMG-1 (0.5 μg), instead of HeLa nuclear extract, was added in the pull-down assays described above with either naked DNA or reconstituted chromatin as indicated. HeLa NE, HeLa nuclear extract.
FIG. 2.
Effect of ATP on binding of GR to MMTV chromatin. (A) GR (3 nM) was incubated with reconstituted MMTV chromatin as indicated in the absence (lanes 5 and 6) or presence (lanes 7 and 8) of HeLa nuclear extract (HeLa NE; 0.5 mg/ml). As a control, GR and HeLa nuclear extract were also incubated with beads alone (lanes 1 and 2) or naked DNA (lanes 3 and 4). ATP (1 mM) was added as indicated. GR associated with the beads (lanes 1 through 8) or in the reaction mixtures (lanes 9 and 10) were analyzed by Western blotting with anti-GR antibody. (B) The effect of preincubation of GR or chromatin with ATP on GR binding is shown. The chromatin pull-down assay was done with concentrations of MMTV chromatin, GR, HeLa nuclear extract, and/or ATP as indicated. The top panel illustrates the experimental schedule in which the initial reaction mixture (labeled 1) was incubated as indicated, followed by addition of 1 U of apyrase (apy) to deplete ATP. The second component was added to the ATP-depleted reaction mixture (labeled 2), and the mixture was incubated further, followed by washing (wash) and Western blotting with the anti-GR antibody. The bottom panel shows the Western blot detection of GR. Lanes 1 and 2 (control) contain chromatin template, GR, and HeLa extract, with or without ATP, incubated as described for panel A. Lanes 3 and 4 contain GR incubated first with HeLa extract, with or without ATP, followed by apyrase, and then chromatin was added. Lanes 5 and 6 contain chromatin incubated first with HeLa extract, with or without ATP, followed by apyrase, and then GR was added. (C) GR, HeLa nuclear extract, and ATP (concentrations same as above) were incubated for 15 (lanes 1 and 2) or 30 (lanes 3 and 4) min. A parallel assay was performed in the presence of ATP for 15 min, followed by addition of apyrase (1 U) and further incubation for 15 min (lane 5). Alternatively, the mixture was incubated for 15 min without ATP, followed by 15 min of incubation with ATP (lane 6). The presence of GR was analyzed by Western blotting.
FIG. 3.
Recruitment of hBRG1 to MMTV promoter by GR. (A) Reaction mixtures contained MMTV DNA (lanes 1 through 5), chromatin (lanes 8 through 12), or beads alone (lanes 6 and 7). The presence of hBRG1 on chromatin (lanes 1 through 12) or in one-fifth of the total protein in the mixtures (lanes 13 and 14) was analyzed by Western blotting with the J1 anti-BRG1 antibody. (B) Reaction mixtures containing 3 nM GR and 0.5 mg of HeLa nuclear extract/ml were coimmunoprecipitated with MA1.1-510 (biotin-labeled BuGR2) anti-GR antibody. Lanes 1 and 2 contain streptavidin beads alone as negative controls. Lanes 3 and 4 contain biotin-labeled anti-GR antibody with streptavidin beads. Lanes 5 and 6 contain aliquots of supernatants from lanes 1 and 2. Lanes 7 and 8 contain aliquots of supernatants from lanes 3 and 4. Both the pellets and the supernatants were analyzed for the presence of GR and hBRG1 as described above. HeLa NE, HeLa nuclear extract.
FIG. 4.
Recruitment of purified hSwi/Snf to MMTV DNA and chromatin by GR. (A) Silver staining of an SDS-7.5% PAGE gel containing Flag affinity-purified hSwi/Snf (0.675 ng of protein). (B) Western blot demonstrating the presence of hBRM, BRG1, and INI in affinity-purified hSwi/Snf. (C) Coimmunoprecipitation of GR with hSwi/Snf. Reaction mixtures containing 3 nM GR with or without 0.1 μg of hSwi/Snf were immunoprecipitated with an anti-Flag affinity gel. Lanes 1 and 2 contain 0.5 mg of Flag peptide/ml added to the immunoprecipitation reaction mixture as negative controls. Lanes 5 and 6 contain supernatants of the reaction mixtures in lanes 1 and 2. Lanes 7 and 8 contain supernatants of the reaction mixtures shown in lanes 3 and 4. GR and BRG1 were detected in both pellets and an aliquot of the supernatants by the antibodies, as indicated next to the panels. (D) Chromatin and DNA pull-down assay. Immobilized MMTV DNA or chromatin (50 ng) was incubated at 30°C for 15 min with hSwi/Snf (2 ng/μl) with or without GR (3 nM). GR and BRG1 were detected by the antibodies, as indicated in the panels. (E) Change in Sac_I cleavage [Δ_F(x)] of immobilized MMTV chromatin (50 ng) with hSwi/Snf (25 ng), with or without GR (1 nM) and/or ATP (1 mM) as indicated. The Δ_F_(x) values were obtained by subtracting the fractional cleavage of the control [F(x)control] from the fractional cleavage with hSwi/Snf, GR, and/or ATP [F(x)sample].
FIG. 5.
hSwi/Snf complexes facilitate displacement of GR from MMTV chromatin. Immobilized MMTV chromatin (A) or DNA (B) (50 ng) was incubated at 30°C for 15 min with hSwi/Snf (2 ng/μl), with or without GR (3 nM), HeLa extract (25 ng/μl), and/or ATP (1 mM) as indicated. An asterisk indicates that the concentration of the HeLa nuclear extract was 1/20 that used for Fig. 1 through 3. GR and BRG1 were detected as indicated next to the panels.
FIG. 6.
GR-dependent interactions of the transcription factor NF-1 with MMTV DNA and chromatin. (A) NF-1 binding detected by λ exonuclease footprinting on 40 ng of immobilized DNA with 10 μg of extract from Schneider S2 cells expressing recombinant NF-1 (lane 1) or lacking NF-1 (lane 2) and 160 ng of purified NF-1 (lane 3). Markers (M) from left to right are a φX174 ladder labeled at the 5′ end with 32P (Life Technologies) and a ddGTP sequencing ladder primer extended with the same primer used in footprinting. The arrow to the right of the gel denotes the λ exonuclease stop at the 5′ edge of the NF-1 site. (B) NF-1 binding to its site detected by chromatin pull-down assay. Immobilized MMTV chromatin (50 ng) with either a wild-type (TTTTGGAATTTATCCAAATCTT) or mutant (TTCTCGAGTTTATCCAGATCTT) NF-1 binding site was incubated at 30°C for 15 min with 160 ng of NF-1, with or without GR (3 nM), HeLa nuclear extract (25 ng/μl), and/or ATP (1 mM) as indicated. V5-epitope-tagged NF-1 was detected by anti-V5 antibody (Invitrogen). HeLa NE, HeLa nuclear extract. (C) Greater binding of NF-1 to MMTV naked DNA than to chromatin. Fifty nanograms of immobilized MMTV DNA or chromatin (Chr.) was incubated at 30°C for 15 min with NF-1 (160 ng of protein). NF-1 was detected as described for panel B. (D) GR and hSwi/Snf facilitation of binding of NF-1 to MMTV chromatin. Chromatin and DNA pull-down assays were performed in the presence of 2 ng of hSwi/Snf per μl and GR, with or without ATP and/or NF-1 as indicated. NF-1 was detected as described for panel B. (E) Absence of effect of NF-1 on ATP-dependent dissociation of GR. Chromatin pull-down assay was performed in the presence of 2 ng of hSwi/Snf per μl and GR, with or without ATP and/or NF-1 as indicated. GR was detected by Western blotting.
References
- Beato, M. 1996. Chromatin structure and the regulation of gene expression: remodeling at the MMTV promoter. J. Mol. Med. 74:711-724. - PubMed
- Blomquist, P., Q. Li, and O. Wrange. 1996. The affinity of nuclear factor 1 for its DNA site is drastically reduced by nucleosome organization irrespective of its rotational or translational position. J. Biol. Chem. 271:153-159. - PubMed
- Boonyaratanakornkit, V., V. Melvin, P. Prendergast, M. Altmann, L. Ronfani, M. E. Bianchi, L. Taraseviciene, S. K. Nordeen, E. A. Allegretto, and D. P. Edwards. 1998. High-mobility group chromatin proteins 1 and 2 functionally interact with steroid hormone receptors to enhance their DNA binding in vitro and transcriptional activity in mammalian cells. Mol. Cell. Biol. 18:4471-4487. - PMC - PubMed
MeSH terms
Substances
LinkOut - more resources
Full Text Sources
Other Literature Sources
Molecular Biology Databases
Miscellaneous