A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus - PubMed (original) (raw)
. 2005 May 25;336(1):83-92.
doi: 10.1016/j.virol.2005.02.025.
Affiliations
- PMID: 15866073
- DOI: 10.1016/j.virol.2005.02.025
Free article
A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus
Gisle Vestergaard et al. Virology. 2005.
Free article
Abstract
Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.
Similar articles
- Sequences and replication of genomes of the archaeal rudiviruses SIRV1 and SIRV2: relationships to the archaeal lipothrixvirus SIFV and some eukaryal viruses.
Peng X, Blum H, She Q, Mallok S, Brügger K, Garrett RA, Zillig W, Prangishvili D. Peng X, et al. Virology. 2001 Dec 20;291(2):226-34. doi: 10.1006/viro.2001.1190. Virology. 2001. PMID: 11878892 - Stygiolobus rod-shaped virus and the interplay of crenarchaeal rudiviruses with the CRISPR antiviral system.
Vestergaard G, Shah SA, Bize A, Reitberger W, Reuter M, Phan H, Briegel A, Rachel R, Garrett RA, Prangishvili D. Vestergaard G, et al. J Bacteriol. 2008 Oct;190(20):6837-45. doi: 10.1128/JB.00795-08. Epub 2008 Aug 22. J Bacteriol. 2008. PMID: 18723627 Free PMC article. - Genome of the Acidianus bottle-shaped virus and insights into the replication and packaging mechanisms.
Peng X, Basta T, Häring M, Garrett RA, Prangishvili D. Peng X, et al. Virology. 2007 Jul 20;364(1):237-43. doi: 10.1016/j.virol.2007.03.005. Epub 2007 Apr 6. Virology. 2007. PMID: 17412384 - Genomics and biology of Rudiviruses, a model for the study of virus-host interactions in Archaea.
Prangishvili D, Koonin EV, Krupovic M. Prangishvili D, et al. Biochem Soc Trans. 2013 Feb 1;41(1):443-50. doi: 10.1042/BST20120313. Biochem Soc Trans. 2013. PMID: 23356326 Free PMC article. Review. - Exceptionally diverse morphotypes and genomes of crenarchaeal hyperthermophilic viruses.
Prangishvili D, Garrett RA. Prangishvili D, et al. Biochem Soc Trans. 2004 Apr;32(Pt 2):204-8. doi: 10.1042/bst0320204. Biochem Soc Trans. 2004. PMID: 15046572 Review.
Cited by
- New virus isolates from Italian hydrothermal environments underscore the biogeographic pattern in archaeal virus communities.
Baquero DP, Contursi P, Piochi M, Bartolucci S, Liu Y, Cvirkaite-Krupovic V, Prangishvili D, Krupovic M. Baquero DP, et al. ISME J. 2020 Jul;14(7):1821-1833. doi: 10.1038/s41396-020-0653-z. Epub 2020 Apr 22. ISME J. 2020. PMID: 32322010 Free PMC article. - R-loop-forming Sequences Analysis in Thousands of Viral Genomes Identify A New Common Element in Herpesviruses.
Wongsurawat T, Gupta A, Jenjaroenpun P, Owens S, Forrest JC, Nookaew I. Wongsurawat T, et al. Sci Rep. 2020 Apr 14;10(1):6389. doi: 10.1038/s41598-020-63101-9. Sci Rep. 2020. PMID: 32286400 Free PMC article. - The enigmatic archaeal virosphere.
Prangishvili D, Bamford DH, Forterre P, Iranzo J, Koonin EV, Krupovic M. Prangishvili D, et al. Nat Rev Microbiol. 2017 Nov 10;15(12):724-739. doi: 10.1038/nrmicro.2017.125. Nat Rev Microbiol. 2017. PMID: 29123227 Review. - Formation of a Viral Replication Focus in Sulfolobus Cells Infected by the Rudivirus Sulfolobus islandicus Rod-Shaped Virus 2.
Martínez-Alvarez L, Deng L, Peng X. Martínez-Alvarez L, et al. J Virol. 2017 Jun 9;91(13):e00486-17. doi: 10.1128/JVI.00486-17. Print 2017 Jul 1. J Virol. 2017. PMID: 28424282 Free PMC article. - Cell Walls and the Convergent Evolution of the Viral Envelope.
Buchmann JP, Holmes EC. Buchmann JP, et al. Microbiol Mol Biol Rev. 2015 Dec;79(4):403-18. doi: 10.1128/MMBR.00017-15. Microbiol Mol Biol Rev. 2015. PMID: 26378223 Free PMC article. Review.
Publication types
MeSH terms
Substances
LinkOut - more resources
Full Text Sources
Other Literature Sources
Molecular Biology Databases