Germ line activation of the Tie2 and SMMHC promoters causes noncell-specific deletion of floxed alleles - PubMed (original) (raw)
Germ line activation of the Tie2 and SMMHC promoters causes noncell-specific deletion of floxed alleles
Willem J de Lange et al. Physiol Genomics. 2008.
Abstract
Tissue-specific knockouts generated through Cre-loxP recombination have become an important tool to manipulate the mouse genome. Normally, two successive rounds of breeding are performed to generate mice carrying two floxed target-gene alleles and a transgene expressing Cre-recombinase tissue-specifically. We show herein that two promoters commonly used to generate endothelium-specific (Tie2) and smooth muscle-specific [smooth muscle myosin heavy chain (Smmhc)] knockout mice exhibit activity in the female and male germ lines, respectively. This can result in the inheritance of a null allele in the second generation that is not tissue specific. Careful experimental design is required therefore to ensure that tissue-specific knockouts are indeed tissue specific and that appropriate controls are used to compare strains.
Figures
Fig. 1.
Genotyping of Tie2-cre and peroxisome proliferator-activated receptor-γ (PPARG) mice. A: schematic showing the 3 alleles of Pparg. The positions of PCR primers, location of loxP sites (filled triangles), and the expected PCR product sizes are indicated. Genotyping of the Pparg floxed allele and the eCre or sCre transgenes was performed as previously described (13, 17). WT, wild type. B: PCR genotyping for Pparg and Tie2-Cre is shown. Lanes 1–2 are offspring of a 1st cross (♂eCre+ × ♀PPARGF/F); lanes 3–11 are offspring of a 2nd cross where eCre was passed through the male (♂PPARGF/+ eCre+ × ♀PPARGF/F); lanes 12–15 are offspring of a 2nd cross where eCre was passed through the female (♂PPARGF/F × ♀PPARGF/+ eCre+). C: table shows the number of mice distributed by genotype. The expected number of animals is indicated in brackets. F2male−cre and F2female−cre represent the eCre transgene transmitted to F2 generation through the male and female germ line, respectively.
Fig. 2.
RT-PCR assay. A: schematic of the mRNA species generated from the 3 alleles shown in Fig. 1_A_. The primers used for RT-PCR are shown along with their expected size. B. aortic RT-PCR products generated from F2 endothelial-null offspring. Lanes 1–4 are RT-PCR products generated from samples where eCre was passed through the male; lanes 5–8 are RT-PCR products generated from samples where eCre was passed through the female. The animal genotype as assessed by tail genomic DNA is indicated below the figure. Total RNA was isolated from thoracic aorta using TriReagent (Molecular Research Center), DNase I treated and repurified using RNeasy spin columns (Qiagen). cDNA was generated by reverse transcription PCR using Superscript III (Invitrogen); 10 ng of reverse transcribed RNA was PCR amplified using primers 1-forward (F): AGACCACTCGCATTCCTTTGACAT and 3-reverse (R): TCCGGCAGTTAAGATCACACC.
Fig. 3.
Genotyping of smooth muscle myosin heavy chain (SMMHC)-cre and PPARG mice. PCR genotyping for Pparg and SMMHC-cre is shown. Lanes 1–4 are offspring of a 1st cross (♂sCre+ × ♀PPARGF/F); lanes 5–16 are offspring of a 2nd cross where sCre was passed through the male (♂PPARGF/+ sCre+ × ♀PPARGF/F). The table shows the number of mice distributed by genotype. The expected number of animals is indicated in brackets. F2male−cre represent the eCre transgene transmitted to F2 generation through the male germ line.
Similar articles
- A critical developmental role for tgfbr2 in myogenic cell lineages is revealed in mice expressing SM22-Cre, not SMMHC-Cre.
Frutkin AD, Shi H, Otsuka G, Levéen P, Karlsson S, Dichek DA. Frutkin AD, et al. J Mol Cell Cardiol. 2006 Oct;41(4):724-31. doi: 10.1016/j.yjmcc.2006.06.067. Epub 2006 Aug 2. J Mol Cell Cardiol. 2006. PMID: 16887142 - High frequency of germline recombination in Nestin-Cre transgenic mice crossed with Glucagon-like peptide 1 receptor floxed mice.
Kajitani Y, Miyazawa T, Inoue T, Kajitani N, Fujita M, Takeichi Y, Miyachi Y, Sakamoto R, Ogawa Y. Kajitani Y, et al. PLoS One. 2023 Dec 20;18(12):e0296006. doi: 10.1371/journal.pone.0296006. eCollection 2023. PLoS One. 2023. PMID: 38117787 Free PMC article. - Annotated expression and activity data for murine recombinase alleles and transgenes: the CrePortal resource.
Perry MN, Smith CM, Onda H, Ringwald M, Murray SA, Smith CL. Perry MN, et al. Mamm Genome. 2022 Mar;33(1):55-65. doi: 10.1007/s00335-021-09909-w. Epub 2021 Sep 4. Mamm Genome. 2022. PMID: 34482425 Free PMC article. Review. - Development of mice with brain-specific deletion of floxed glud1 (glutamate dehydrogenase 1) using cre recombinase driven by the nestin promoter.
Karaca M, Maechler P. Karaca M, et al. Neurochem Res. 2014;39(3):456-9. doi: 10.1007/s11064-013-1041-0. Epub 2013 Apr 18. Neurochem Res. 2014. PMID: 23595828 Review.
Cited by
- Endocardial HDAC3 is required for myocardial trabeculation.
Jang J, Bentsen M, Kim YJ, Kim E, Garg V, Cai CL, Looso M, Li D. Jang J, et al. Nat Commun. 2024 May 16;15(1):4166. doi: 10.1038/s41467-024-48362-6. Nat Commun. 2024. PMID: 38755146 Free PMC article. - Defining Gene Function in Spermatogonial Stem Cells Through Conditional Knockout Approaches.
Legrand JMD, Hobbs RM. Legrand JMD, et al. Methods Mol Biol. 2023;2656:261-307. doi: 10.1007/978-1-0716-3139-3_15. Methods Mol Biol. 2023. PMID: 37249877 - Myh6 promoter-driven Cre recombinase excises floxed DNA fragments in a subset of male germline cells.
Sheldon C, Kessinger CW, Sun Y, Kontaridis MI, Ma Q, Hammoud SS, Gao Z, Zhang H, Lin Z. Sheldon C, et al. J Mol Cell Cardiol. 2023 Feb;175:62-66. doi: 10.1016/j.yjmcc.2022.12.005. Epub 2022 Dec 28. J Mol Cell Cardiol. 2023. PMID: 36584478 Free PMC article. - The Wnt1-Cre2 transgene is active in the male germline.
Dinsmore CJ, Ke CY, Soriano P. Dinsmore CJ, et al. Genesis. 2022 Mar;60(3):e23468. doi: 10.1002/dvg.23468. Epub 2022 Feb 18. Genesis. 2022. PMID: 35180326 Free PMC article. - Imaging and tracing the pattern of adult ovarian angiogenesis implies a strategy against female reproductive aging.
Xu X, Mu L, Li L, Liang J, Zhang S, Jia L, Yang X, Dai Y, Zhang J, Wang Y, Niu S, Xia G, Yang Y, Zhang Y, Cao Y, Zhang H. Xu X, et al. Sci Adv. 2022 Jan 14;8(2):eabi8683. doi: 10.1126/sciadv.abi8683. Epub 2022 Jan 12. Sci Adv. 2022. PMID: 35020427 Free PMC article.
References
- BagnallAJ, Kelland NF, Gulliver-Sloan F, Davenport AP, Gray GA, Yanagisawa M, Webb DJ, Kotelevtsev YV. Deletion of endothelial cell endothelin B receptors does not affect blood pressure or sensitivity to salt. Hypertension 48: 286–293, 2006 - PubMed
- CattelinoA, Liebner S, Gallini R, Zanetti A, Balconi G, Corsi A, Bianco P, Wolburg H, Moore R, Oreda B, Kemler R, Dejana E. The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility. J Cell Biol 162: 1111–1122, 2003 - PMC - PubMed
- ConstienR, Forde A, Liliensiek B, Grone HJ, Nawroth P, Hammerling G, Arnold B. Characterization of a novel EGFP reporter mouse to monitor Cre recombination as demonstrated by a Tie2 Cre mouse line. Genesis 30: 36–44, 2001 - PubMed
- De MartinoC, Capanna E, Nicotra MR, Natali PG. Immunochemical localization of contractile proteins in mammalian meiotic chromosomes. Cell Tissue Res 213: 159–178, 1980 - PubMed
MeSH terms
Substances
Grants and funding
- P01 HL062984/HL/NHLBI NIH HHS/United States
- T32 GM007337/GM/NIGMS NIH HHS/United States
- R01 HL076421/HL/NHLBI NIH HHS/United States
- P50 HL055006/HL/NHLBI NIH HHS/United States
- P01 NS024621/NS/NINDS NIH HHS/United States
LinkOut - more resources
Full Text Sources
Molecular Biology Databases
Miscellaneous