Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the Caucasian population - PubMed (original) (raw)

Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the Caucasian population

N de Parseval et al. J Virol. 1998 Apr.

Abstract

ERV-3 is an evolutionarily conserved single-copy human endogenous retrovirus with a coding envelope gene potentially involved in important placental functions. We have investigated the sequence variability of this gene among 150 unrelated Caucasian individuals and found eight polymorphic sites. One of them corresponds to the introduction of a stop codon resulting in the production of a severely truncated ERV-3 envelope protein lacking both the fusion peptide and the immunosuppressive domain of the protein. The stop codon is observed in a homozygous state in approximately 1% of Caucasian individuals without evidence for counterselection, thus precluding the involvement of any essential function of the gene in placental implantation and development. This natural knockout provides a mean to investigate other potential roles for this otherwise highly conserved gene.

PubMed Disclaimer

Figures

FIG. 1

Identification of polymorphic sites within the sequences of ERV-3 envelope genes from five unrelated individuals. The ERV-3 provirus with the envelope open reading frame (open rectangle) and its expected functional domains, including the proteolytic cleavage site, the fusion peptide, and the immunosuppressive domain, are schematically represented at the top. The putative hydrophobic domain is shown in a dotted rectangle as an extension of the open reading frame if the stop codon at nucleotide 2500 is read through. The G insertion at position 796 (see Table 1) leads to an upstream shift in the frame, unlike that of the previously published ERV-3 sequence, and introduces a potential signal peptide and four new Met codons (represented by short vertical lines). LTR, long terminal repeat; SD, splice donor site; SA, splice acceptor site. The primers used in this study are indicated, and 5′-3′ sequences are given for S2 (CGGCCGAAGCTTGAGTCATCATCAGGG), T7atg (GCTAATACGACTCACTATAGGAACAGACCACCatgACTAAAACCCTGTTGTATCA), S3 (AACCAACAATCACTAGGGCC), AS3 (TGCCCCTCCATAAAGTCTTTCCTAG), and AS (GTTAATACTTAGTTAGGGCC). At the bottom, the envelope gene sequences of five individuals and the corresponding polymorphic sites within the ERV-3 consensus sequence are represented; both alleles for each site are indicated. Numbers refer to the ERV-3 pol-env published sequence (; accession no. M12140).

FIG. 2

(A) Expected _Bsp_1286I restriction map of the ERV-3 S3-AS3 amplimer and restriction analysis of a series of 13 individuals. The arrows indicate the restriction fragments obtained after electrophoresis in a 2% agarose gel. Molecular size markers are shown on the right. (B) Nucleotide sequence analysis of PCR-amplified genomic fragments from three individuals for the polymorphism at nucleotide 1354. Lane numbers refer to those in A. (C) Direct in vitro transcription-translation assay for ERV-3 envelope gene products from the three individuals in B. The arrows indicate the translational products after migration in a 14% polyacrylamide gel. The two ERV-3 envelope proteins obtained are represented, and the SU, the TM, the FP (fusion peptide), and the ISU (immunosuppressive domain) are indicated. SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

FIG. 3

Pedigree of a CEPH family whose parents are heterozygous for the stop mutation. Open symbols represent C/C homozygous individuals; filled symbols represent T/T homozygous individuals, and mixed symbols represent C/T heterozygous individuals. Squares, males; circles, females.

References

1. Andersson A C, Merza M, Venables P, Ponten F, Sundström J, Cohen M, Larsson E. Elevated levels of the endogenous retrovirus erv3 in human sebaceous glands. J Invest Dermatol. 1996;106:125–128. - PubMed
1. Boyd M T, Bax C M, Bax B E, Bloxam D L, Weiss R A. The human endogenous retrovirus ERV-3 is upregulated in differentiating placental trophoblast cells. Virology. 1993;196:905–909. - PubMed
1. Cohen M, Larsson E. Human endogenous retroviruses. Bioessays. 1988;9:191–196. - PubMed
1. Cohen M, Powers M, O’Connell C, Kato N. The nucleotide sequence of the env gene from the human provirus erv3 and isolation and characterization of an erv3-specific cDNA. Virology. 1985;147:449–458. - PubMed
1. Conrad B, Weissmahr R N, Böni J, Arcari R, Schüpbach J, Mach B. A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes. Cell. 1997;90:303–313. - PubMed

Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the Caucasian population - PubMed (original) (raw)