Cyclin B2-null mice develop normally and are fertile whereas cyclin B1-null mice die in utero - PubMed (original) (raw)

Cyclin B2-null mice develop normally and are fertile whereas cyclin B1-null mice die in utero

M Brandeis et al. Proc Natl Acad Sci U S A. 1998.

Abstract

Two B-type cyclins, B1 and B2, have been identified in mammals. Proliferating cells express both cyclins, which bind to and activate p34(cdc2). To test whether the two B-type cyclins have distinct roles, we generated lines of transgenic mice, one lacking cyclin B1 and the other lacking cyclin B2. Cyclin B1 proved to be an essential gene; no homozygous B1-null pups were born. In contrast, nullizygous B2 mice developed normally and did not display any obvious abnormalities. Both male and female cyclin B2-null mice were fertile, which was unexpected in view of the high levels and distinct patterns of expression of cyclin B2 during spermatogenesis. We show that the expression of cyclin B1 overlaps the expression of cyclin B2 in the mature testis, but not vice versa. Cyclin B1 can be found both on intracellular membranes and free in the cytoplasm, in contrast to cyclin B2, which is membrane-associated. These observations suggest that cyclin B1 may compensate for the loss of cyclin B2 in the mutant mice, and implies that cyclin B1 is capable of targeting the p34(cdc2) kinase to the essential substrates of cyclin B2.

PubMed Disclaimer

Figures

Figure 1

Cyclin B1 and B2 diverged early in vertebrate evolution. The protein sequences of cloned cyclins B1, B2 and B3 were compared by using

clustal_x

(46) and the output displayed by the

treeview

(47) program, using sequences starting at the beginning of the α–1 helix of the cyclin box, (MRAILIDWLV… ), and finishing at the C terminus. The scale is as calculated by the

clustal_x

program (46).

Figure 2

Cyclin B2 targeting in ES cells. (A) Map of the mouse cyclin B2 gene and of the targeting vector used for homologous recombination. (B) Southern blotting of the _Nco_I-digested genomic DNA from G-418 resistant colonies with an intron 7 probe (see map) and RT-PCR with exon 3 (CTGTGAAACCAGTGCAGATG) and 6 (ACTGGTGTAAGCATTATCTG) specific oligonucleotides, by using cDNA prepared from RNA of heterozygous or wt ES cells. (C) Southern blots of genomic DNA of homozygous, heterozygous, or wt mice were probed with an exon 4 probe, an intron 7 probe (whose location is indicated in A) or a neo probe as indicated. Northern blots of RNA were prepared from the testes of homozygous, heterozygous, or wt mice and were probed with cyclin B1- and B2-specific probes.

Figure 3

Cyclin B1 targeting in ES cells. (A) Map of the mouse cyclin B1 gene and of the targeting vector used for homologous recombination. (B) Southern blot analysis of the _Nco_I-digested genomic DNA from G418-resistant colonies with an intron 3 probe (see map).

Figure 4

Total protein was extracted from wt or mutant mouse tissues as indicated, or from fibroblasts prepared from 13-day-old embryos (MEF). Equivalent amounts of protein were analyzed by SDS/PAGE and immunoblotted with the anti-cyclin B1 mouse mAb V143 or by the anti-cyclin B2 rabbit polyclonal antibody 190 directed against the 101 N-terminal residues of cyclin B2. The cyclin B2 immunoblot was exposed about 10× longer than the B1 blot.

Figure 5

Cyclin B1 and B2 localization in the testis. Sections of testis, prepared from cyclin B2 nullizygous mice or their heterozygous littermates, were analyzed by immunostaining with the indicated antibodies (brown) and counterstained with hematoxylin (blue) The sections in A show mitotic precursors (M, Sg) and postmeiotic spermatocytes (Sp). Cyclin B2 staining is seen in late pachytene and diplotene cells, whereas cyclin B1 staining is most intense at the earlier zygotene stage. The postmeiotic spermatocytes do not stain with either anti-B type cyclin antibody. B represents stages X or XI of spermatogenesis, cell types are: P/D, late pachytene or diplotene; Z, zygotene. A section from a B2 nullizygous animal is shown as a control. C shows stage XII sections with fields of meiotic metaphases and an anaphase from the same series of testis sections (B2+/− heterozygotes), stained with anti-cyclin B1 (Upper) or anti-cyclin B2 (Lower). Note the disappearance of cyclin B2 at anaphase, and the association of both B-type cyclins with mitotic spindles. The upper two metaphase figures in the cyclin B1 panel probably represent meiosis I, and the lower set are probably meiosis II, judged by position in the section and the intensity of chromosome staining.

Figure 6

Cyclin B1 and B2 differ in their subcellular localization. Mouse testes were homogenized in a Hepes-sucrose buffer and nuclei were removed by low speed centrifugation. The postnuclear extract was loaded on a 4 ml sucrose step gradient and centrifuged overnight in a Beckman SW55 rotor at 30,000 rpm (105 g). The fractions collected from the gradient were diluted and spun for 45 min in a Beckman TL100 benchtop ultracentrifuge. The membranous pellet was dissolved in SDS/PAGE sample buffer. The protein in the supernatant was precipitated with methanol and chloroform, dried, and dissolved in sample buffer. The fractions were analyzed by immunoblotting with anti-cyclin B1 and B2 antibodies.

References

1. Labbé J C, Capony J P, Caput D, Cavadore J C, Derancourt J, Kaghad M, Lelias J M, Picard A, Dorée M. EMBO J. 1989;8:3053–3058. - PMC - PubMed
1. Draetta G, Luca F, Westendorf J, Brizuela L, Ruderman J, Beach D. Cell. 1989;56:829–838. - PubMed
1. Gautier J, Matsukawa T, Nurse P, Maller J. Nature (London) 1989;339:626–629. - PubMed
1. Chapman D L, Wolgemuth D J. Mol Reprod Dev. 1992;33:259–269. - PubMed
1. Pines J, Hunter T. Cell. 1989;58:833–846. - PubMed

Cyclin B2-null mice develop normally and are fertile whereas cyclin B1-null mice die in utero - PubMed (original) (raw)