Elikira Kimbita | Sokoine University of Agriculture (original) (raw)

Papers by Elikira Kimbita

Indo Pacific Journal of Ocean Life, May 29, 2020

By 2050, global food consumption is expected to rise by 60% compared to the 2005–2007 level. In s... more By 2050, global food consumption is expected to rise by 60% compared to the 2005–2007 level. In sub-Saharan Africa (SSA), the population increase may be as much as 250% by the same period. Hence, there is an urgent need to increase food production and introduce productivity-enhancing measures in SSA agriculture, including the livestock sector, which is the main focus of this article. The current productivity of the Tanzanian livestock sector is low due to seasonal variations in the availability and quality of pasture and other feeds. The cattle gain weight during the rainy season and lose weight in the subsequent dry season. Additionally, pastoralists face challenges due to the conversion of grazing areas into cropland, overgrazing, and the increasingly frequent droughts. Although the optimum age for slaughter is 3.5–4.5 years, farmers in Tanzania slaughter their cows at 5–6 years. This article argues that this may be an unhelpful economical management practice. To study the effects...

Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock d... more Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock development in Tanzania. Over the years Rufiji District was excluded from livestock production owing to tsetse fly infestation, however, a few years ago there was an influx of livestock following evictions aimed at conserving the Usangu wetlands. Methods: A study was conducted to determine the efficiency of available traps for catching tsetse flies, Glossina species infesting the area, their infection rates and Trypanosoma species circulating in the area. Trapping was conducted during the semi dry season for a total of 30 days (ten days each month) during the onset of the dry season of May- July 2009. Harvested flies after every 24 hours were dissected and examined under a light microscope for trypanosome infections and whole fly DNA was extracted from 82 flies and analyzed for trypanosomes by polymerase chain reaction (PCR) using different sets of primers. Results: The proportions of tot...

Livestock Research for Rural Development

A study was carried out to determine the importance of the face fly (Musca sorbens) at Kambala, a... more A study was carried out to determine the importance of the face fly (Musca sorbens) at Kambala, a pastoral village situated 6 00-6 03 South and 37 03-38 00 East in Mvomero District , Morogoro, Tanzania. This village has had a recent re-introduction of cattle dipping for tick control. A total of 32 livestock keepers were interviewed using structured pre-tested questionnaire and data on human fly-related eye and diarrhoeal infections from five-year (2001 -2005) patient records from Kambala dispensary were obtained. Results showed that there was 39% drop in eye infections from 2003 to 2004 concomitant with increase in dipping following rehabilitation of the village livestock dip tank and start of dipping cattle in synthetic pyrethroid acaricide. Fly population density in homesteads with livestock dipped in the synthetic pyrethroid was lower than in those homesteads where animals were sprayed with acaricide from the diamidine group. Both Musca sorbens andMusca domestica were identified ...

Livestock Research for Rural Development

Trypanosomosis is one of the major diseases hindering livestock production in Africa. Many studie... more Trypanosomosis is one of the major diseases hindering livestock production in Africa. Many studies have been carried out on the prevalence of the disease in cattle but very little has been done in small ruminants. In Tanzania several reports have been written on livestock diseases in the country, but with very little attention to diseases of small ruminants. The study was undertaken in goats in selected farms in Morogoro, Tanzania, between June and August 2006. The aim was to establish the prevalence rate of trypanosomosis in naturally infected goats and to determine awareness of livestock keepers on the factors contributing to the existence and magnitude of the infection. The methods used included administration of a pre-tested questionnaire to 28 farmers and laboratory diagnosis using thick and thin blood smears as well as buffy coat for the examination of the blood. A total of 243 goats were sampled, but none of the goats were found to be parasitologically positive for trypanosom...

Parasites & Vectors, 2011

Tsetse flies and trypanosomiasis are among several factors that constrain livestock development i... more Tsetse flies and trypanosomiasis are among several factors that constrain livestock development in Tanzania. Over the years Rufiji District was excluded from livestock production owing to tsetse fly infestation, however, a few years ago there was an influx of livestock following evictions aimed at conserving the Usangu wetlands. A study was conducted to determine the efficiency of available traps for catching tsetse flies, Glossina species infesting the area, their infection rates and Trypanosoma species circulating in the area. Trapping was conducted during the semi dry season for a total of 30 days (ten days each month) during the onset of the dry season of May - July 2009. Harvested flies after every 24 hours were dissected and examined under a light microscope for trypanosome infections and whole fly DNA was extracted from 82 flies and analyzed for trypanosomes by polymerase chain reaction (PCR) using different sets of primers. The proportions of total tsetse catches per trap were in the following decreasing order S3 (33%), H-Trap (27%), Pyramidal (19%), sticky panel (11%) and biconical trap (10%). Of the 1200 trapped flies, 75.6% were identified as Glossina pallidipes, 11.7% as G. brevipalpis, 9.6% as G. austeni and 3.0% G. morsitans morsitans. Dissections revealed the overall infection rate of 6.6% (13/197). Whole DNA was extracted from 82 tsetse flies and the prevalence of trypanosomes circulating in the area in descending order was 92.7% (76/82) for T. simiae; 70.7% (58/82) for T. brucei types; 48.8% (40/82) for the T. vivax types and 32.9% (27/82) for the T. congolense types as determined by PCR. All trypanosome types were found in all tsetse species analysed except for the T. congolense types, which were absent in G. m. morsitans. None of the T. brucei positive samples contained human infective trypanosomes by SRA - PCR test All tsetse species found in Rufiji are biologically important in the transmission of animal trypanosomiasis and the absence of T. congolense in G. m. morsitans could be a matter of chance only. Therefore, plans for control should consider all tsetse species.

BMC veterinary research, Jan 7, 2016

Sub-optimal performance of the animal health delivery system in rural areas is common in developi... more Sub-optimal performance of the animal health delivery system in rural areas is common in developing countries including Tanzania. However, penetration of mobile phones and availability of good road network and public transport systems offer opportunities for improving the access of rural communities to diagnostic and advisory services from facilities and expertise located in urban areas. A questionnaire survey on possession and use of mobile phones by pastoral and agro-pastoral communities in Kilosa and Gairo districts was carried out between November and December 2015. A total number of 138 livestock keepers from three villages of Chakwale (54), Mvumi (41) and Parakuyo (43) participated in the study. An e-based system was designed and tested to link rural communities with urban diagnostic facilities. It was observed that the average number of phones possessed by individuals interviewed and household families was 1.1 ± 0.26 (1-2) and 3.5 ± 2.23 (1-10), respectively. It was further o...

Veterinary Parasitology, 2016

A descriptive cross-sectional survey of Dirofilaria infections in dogs was carried out from Janua... more A descriptive cross-sectional survey of Dirofilaria infections in dogs was carried out from January to March 2015 in Morogoro municipality, Tanzania. One hundred and fifty two blood samples were collected from healthy dogs aged more than 6 months living in different areas of Morogoro, and analyzed by modified Knott's technique for circulating microfilariae. Microfilaraemic samples were further analyzed by Polymerase chain reaction (PCR) and PCR products were sequenced for molecular identification. Microfilariae were detected by microscopy in 9 samples (5.92%), of which 6 tested positive by PCR. The 5.8S-internal transcribed spacer 2 (ITS2)-28S ribosomal DNA (rDNA) sequences generated were 97% identical to Dirofilaria immitis and 86% to 90% identical to D. repens, confirming the presence of D. immitis in Tanzania and showing the presence of D. repens, not previously observed.

The Journal of Parasitology, Sep 1, 2002

Journal of Clinical Microbiology

... to Edwardsiella ictaluri PHILLIP KLESIUS AND KATHY JOHNSON US Department of Agriculture, Agri... more ... to Edwardsiella ictaluri PHILLIP KLESIUS AND KATHY JOHNSON US Department of Agriculture, Agricultural Research Service Animal Parasite Research Laboratory, Auburn, Alabama 36830, USA ROBERT DURBOROW* Cooperative ...

Veterinary parasitology, Jan 3, 2001

The gene encoding surface antigen 1 (SAG1, P30) of Toxoplasma gondii (T. gondii) was cloned into ... more The gene encoding surface antigen 1 (SAG1, P30) of Toxoplasma gondii (T. gondii) was cloned into the plasmid pGEX-4T-3 and subsequently expressed in Escherichia coli (E. coli) as a glutathione-S-transferase (GST) fusion protein. The recombinant SAG1 (rSAG1) was refolded using 8M urea solution followed by dialysis and thereafter evaluated in an enzyme-linked immunosorbent assay (ELISA) for serological diagnosis of toxoplasmosis. The test sera were adsorbed with GST to block non-specific reactivity to the GST-SAG1 fusion protein. The ELISA with rSAG1 was able to differentiate very clearly between sera from cats or mice experimentally infected with T. gondii and sera from normal cats or mice. The ELISA detected no cross-reactivity with sera from mice experimentally infected with the closely related parasite Neospora caninum (N. caninum). Some 193 cat sera were tested for antibodies to T. gondii, out of which 40 (20.7%) reacted positively by ELISA with the rSAG1 while another 79.3% cats...

Tropical animal health and production, 2001

An in vitro infectivity assay was used to examine five cryoprotectants for their suitability for ... more An in vitro infectivity assay was used to examine five cryoprotectants for their suitability for preserving Theileria parva sporozoites. All five were capable of preserving T. parva sporozoites through freezing, the optimal concentrations being 7.5% for glycerol, 5% for dimethyl sulphoxide (DMSO), poly (vinylpyrrolidone) (PVP) and poly(ethylene glycol) (PEG), and 2.5% for hydroxyethyl starch (HES). When the five cryoprotectants were compared at their optimal concentrations, using a modification of the standard method of stabilate preparation, glycerol was significantly better than the others (p < 0.05). Measurement of the effects of each cryoprotectant on the osmolality of the media revealed that glycerol and DMSO elevated the osmolality significantly (p < 0.05). Resuscitation of glycerol-preserved sporozoites required the presence of glycerol in the diluent to maintain infectivity. Studies on the effects of equilibration time in glycerol on the infectivity of sporozoites show...

Veterinary Parasitology, 1997

Adult male and female Rhipicephalus appendiculatus ticks infected with Theileria parva (Muguga 30... more Adult male and female Rhipicephalus appendiculatus ticks infected with Theileria parva (Muguga 3087) were fed on rabbits and the development of infection was monitored daily using light microscopy and an in vitro titration technique able to quantify the infectivity of sporozoite suspensions. The salivary glands stained with methyl green pyronine showed presence of infection in some unfed ticks. The intensity of staining was shown to increase with the number of days the ticks had fed. The in vitro technique, on the other hand, could detect infection only in ticks which had fed for 3-5 days. Feeding of ticks on rabbits for 4 days produced significantly more sporozoites than any other lengths of feeding (P = 0.001). The in vitro assay was also able to demonstrate differences between male and female R. appendiculatus in production of infective sporozoites. Female ticks produced significantly more sporozoites than male ticks (P = 0.002).

Tropical Animal Health and Production, 2004

Theileria parva: in vitro studies on the e¡ects of holding temperature, pH and medium on sporozoi... more Theileria parva: in vitro studies on the e¡ects of holding temperature, pH and medium on sporozoite infectivity. Tropical Animal Health and Production, 36(4), 3413 51

Veterinary Parasitology, 2001

The cDNA encoding the entire mature hypodermin C (HC) of Hypoderma lineatum was cloned and expres... more The cDNA encoding the entire mature hypodermin C (HC) of Hypoderma lineatum was cloned and expressed in Escherichia coli as a glutathione S-transferase fusion protein using pGEX vector. The recombinant HC protein (rHC) was tested by Western blotting to detect antibodies to H. lineatum in cattle. Western blotting with rHC as antigen clearly differentiated between H. lineatum-infested cattle sera and normal cattle sera. Forty-six out of forty-eight serum samples from cattle in Central Mongolia were positive, whereas all 30 serum samples from cows in Hokkaido, Japan, were negative by Western blotting. The result of Western blotting was identical to that of a previously developed enzyme-linked immunosorbent assay. These data demonstrated that Western blotting, with rHC expressed in E. coli, might be a useful method for the diagnosis of cattle hypodermosis.

Tropical Animal Health and Production, 2009

Parasites & Vectors, 2011

Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock d... more Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock development in Tanzania. Over the years Rufiji District was excluded from livestock production owing to tsetse fly infestation, however, a few years ago there was an influx of livestock following evictions aimed at conserving the Usangu wetlands. Methods: A study was conducted to determine the efficiency of available traps for catching tsetse flies, Glossina species infesting the area, their infection rates and Trypanosoma species circulating in the area. Trapping was conducted during the semi dry season for a total of 30 days (ten days each month) during the onset of the dry season of May -July 2009. Harvested flies after every 24 hours were dissected and examined under a light microscope for trypanosome infections and whole fly DNA was extracted from 82 flies and analyzed for trypanosomes by polymerase chain reaction (PCR) using different sets of primers. Results: The proportions of total tsetse catches per trap were in the following decreasing order S3 (33%), H-Trap (27%), Pyramidal (19%), sticky panel (11%) and biconical trap (10%). Of the 1200 trapped flies, 75.6% were identified as Glossina pallidipes, 11.7% as G. brevipalpis, 9.6% as G. austeni and 3.0% G. morsitans morsitans. Dissections revealed the overall infection rate of 6.6% (13/197). Whole DNA was extracted from 82 tsetse flies and the prevalence of trypanosomes circulating in the area in descending order was 92.7% (76/82) for T. simiae; 70.7% (58/ 82) for T. brucei types; 48.8% (40/82) for the T. vivax types and 32.9% (27/82) for the T. congolense types as determined by PCR. All trypanosome types were found in all tsetse species analysed except for the T. congolense types, which were absent in G. m. morsitans. None of the T. brucei positive samples contained human infective trypanosomes by SRA -PCR test Conclusion: All tsetse species found in Rufiji are biologically important in the transmission of animal trypanosomiasis and the absence of T. congolense in G. m. morsitans could be a matter of chance only. Therefore, plans for control should consider all tsetse species.

Journal of Veterinary Medical Science, 2001

A pair of oligonucleotide primers were designed according to the nucleotide sequence of the P18 g... more A pair of oligonucleotide primers were designed according to the nucleotide sequence of the P18 gene of Babesia gibsoni (B. gibsoni), NRCPD strain, and were used to detect parasite DNA from blood samples of B. gibsoni-infected dogs by polymerase chain reaction (PCR). PCR was specific for B. gibsoni since no amplification was detected with DNA from B. Canis or normal dog leucocytes. PCR was sensitive enough to detect parasite DNA from 2.5 microl of blood samples with a parasitemia of 0.000002%. PCR detected parasite DNA from 2 to 222 days post-infection in sequential blood samples derived from a dog experimentally infected with B. gibsoni. The detection of B. gibsoni DNA by PCR was much earlier than the detection of antibodies to B. gibsoni in blood samples by the indirect fluorescent antibody test (IFAT) or that of the parasite itself in Giemsa-stained thin blood smear film examined by microscopy. In addition, 28 field samples collected from dogs in Kansai area, Japan, were tested for B. gibsoni infection. Nine samples were positive in blood smears, 9 samples were positive by IFAT and 11 samples were positive for B. gibsoni DNA by PCR. The nucleotide sequences of PCR products from all 11 samples found positive by PCR were completely identical to that of the P18 gene of the B. gibsoni, NRCPD strain. These results suggest that PCR provides a useful diagnostic tool for the detection of B. gibsoni infection in dogs.

A study was done to determine the prevalence of animal trypanasomiasis at Urambo and Mpanda distr... more A study was done to determine the prevalence of animal trypanasomiasis at Urambo and Mpanda district. Two villages which previously have history of Human African Trypanasomiasis were used in each district. Blood sample were collected from a total of 365 cattle, 98 goats and 11 dogs originating from 4 villages in both districts. Using microscopic diagnosis method, trypanosome infection were found to be 10.6% and 4.1% in cattle from Urambo and Mpanda respectively, 2.8% in goat from Urambo district and only one of dog out of seven sampled dogs in Urambo District was trypanosome positive. None of goat and dog from Mpanda district was positive. A total 390 samples collected on FTA cards in all district were tested for the presence of Trypanasome brucei sl using TBR 1&2 primers (TBR 1; GAATATACAATGCGCAG and TBR 2; CCATTTATTAGCTTTGTTGC) reviled high percentage of T.brucei s.l in cattle (53.5%) and goats (34.0%) at Urambo district while only 2.1% of cattle from Mpanda district were positive...

Indo Pacific Journal of Ocean Life, May 29, 2020

By 2050, global food consumption is expected to rise by 60% compared to the 2005–2007 level. In s... more By 2050, global food consumption is expected to rise by 60% compared to the 2005–2007 level. In sub-Saharan Africa (SSA), the population increase may be as much as 250% by the same period. Hence, there is an urgent need to increase food production and introduce productivity-enhancing measures in SSA agriculture, including the livestock sector, which is the main focus of this article. The current productivity of the Tanzanian livestock sector is low due to seasonal variations in the availability and quality of pasture and other feeds. The cattle gain weight during the rainy season and lose weight in the subsequent dry season. Additionally, pastoralists face challenges due to the conversion of grazing areas into cropland, overgrazing, and the increasingly frequent droughts. Although the optimum age for slaughter is 3.5–4.5 years, farmers in Tanzania slaughter their cows at 5–6 years. This article argues that this may be an unhelpful economical management practice. To study the effects...

Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock d... more Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock development in Tanzania. Over the years Rufiji District was excluded from livestock production owing to tsetse fly infestation, however, a few years ago there was an influx of livestock following evictions aimed at conserving the Usangu wetlands. Methods: A study was conducted to determine the efficiency of available traps for catching tsetse flies, Glossina species infesting the area, their infection rates and Trypanosoma species circulating in the area. Trapping was conducted during the semi dry season for a total of 30 days (ten days each month) during the onset of the dry season of May- July 2009. Harvested flies after every 24 hours were dissected and examined under a light microscope for trypanosome infections and whole fly DNA was extracted from 82 flies and analyzed for trypanosomes by polymerase chain reaction (PCR) using different sets of primers. Results: The proportions of tot...

Livestock Research for Rural Development

A study was carried out to determine the importance of the face fly (Musca sorbens) at Kambala, a... more A study was carried out to determine the importance of the face fly (Musca sorbens) at Kambala, a pastoral village situated 6 00-6 03 South and 37 03-38 00 East in Mvomero District , Morogoro, Tanzania. This village has had a recent re-introduction of cattle dipping for tick control. A total of 32 livestock keepers were interviewed using structured pre-tested questionnaire and data on human fly-related eye and diarrhoeal infections from five-year (2001 -2005) patient records from Kambala dispensary were obtained. Results showed that there was 39% drop in eye infections from 2003 to 2004 concomitant with increase in dipping following rehabilitation of the village livestock dip tank and start of dipping cattle in synthetic pyrethroid acaricide. Fly population density in homesteads with livestock dipped in the synthetic pyrethroid was lower than in those homesteads where animals were sprayed with acaricide from the diamidine group. Both Musca sorbens andMusca domestica were identified ...

Livestock Research for Rural Development

Trypanosomosis is one of the major diseases hindering livestock production in Africa. Many studie... more Trypanosomosis is one of the major diseases hindering livestock production in Africa. Many studies have been carried out on the prevalence of the disease in cattle but very little has been done in small ruminants. In Tanzania several reports have been written on livestock diseases in the country, but with very little attention to diseases of small ruminants. The study was undertaken in goats in selected farms in Morogoro, Tanzania, between June and August 2006. The aim was to establish the prevalence rate of trypanosomosis in naturally infected goats and to determine awareness of livestock keepers on the factors contributing to the existence and magnitude of the infection. The methods used included administration of a pre-tested questionnaire to 28 farmers and laboratory diagnosis using thick and thin blood smears as well as buffy coat for the examination of the blood. A total of 243 goats were sampled, but none of the goats were found to be parasitologically positive for trypanosom...

Parasites & Vectors, 2011

Tsetse flies and trypanosomiasis are among several factors that constrain livestock development i... more Tsetse flies and trypanosomiasis are among several factors that constrain livestock development in Tanzania. Over the years Rufiji District was excluded from livestock production owing to tsetse fly infestation, however, a few years ago there was an influx of livestock following evictions aimed at conserving the Usangu wetlands. A study was conducted to determine the efficiency of available traps for catching tsetse flies, Glossina species infesting the area, their infection rates and Trypanosoma species circulating in the area. Trapping was conducted during the semi dry season for a total of 30 days (ten days each month) during the onset of the dry season of May - July 2009. Harvested flies after every 24 hours were dissected and examined under a light microscope for trypanosome infections and whole fly DNA was extracted from 82 flies and analyzed for trypanosomes by polymerase chain reaction (PCR) using different sets of primers. The proportions of total tsetse catches per trap were in the following decreasing order S3 (33%), H-Trap (27%), Pyramidal (19%), sticky panel (11%) and biconical trap (10%). Of the 1200 trapped flies, 75.6% were identified as Glossina pallidipes, 11.7% as G. brevipalpis, 9.6% as G. austeni and 3.0% G. morsitans morsitans. Dissections revealed the overall infection rate of 6.6% (13/197). Whole DNA was extracted from 82 tsetse flies and the prevalence of trypanosomes circulating in the area in descending order was 92.7% (76/82) for T. simiae; 70.7% (58/82) for T. brucei types; 48.8% (40/82) for the T. vivax types and 32.9% (27/82) for the T. congolense types as determined by PCR. All trypanosome types were found in all tsetse species analysed except for the T. congolense types, which were absent in G. m. morsitans. None of the T. brucei positive samples contained human infective trypanosomes by SRA - PCR test All tsetse species found in Rufiji are biologically important in the transmission of animal trypanosomiasis and the absence of T. congolense in G. m. morsitans could be a matter of chance only. Therefore, plans for control should consider all tsetse species.

BMC veterinary research, Jan 7, 2016

Sub-optimal performance of the animal health delivery system in rural areas is common in developi... more Sub-optimal performance of the animal health delivery system in rural areas is common in developing countries including Tanzania. However, penetration of mobile phones and availability of good road network and public transport systems offer opportunities for improving the access of rural communities to diagnostic and advisory services from facilities and expertise located in urban areas. A questionnaire survey on possession and use of mobile phones by pastoral and agro-pastoral communities in Kilosa and Gairo districts was carried out between November and December 2015. A total number of 138 livestock keepers from three villages of Chakwale (54), Mvumi (41) and Parakuyo (43) participated in the study. An e-based system was designed and tested to link rural communities with urban diagnostic facilities. It was observed that the average number of phones possessed by individuals interviewed and household families was 1.1 ± 0.26 (1-2) and 3.5 ± 2.23 (1-10), respectively. It was further o...

Veterinary Parasitology, 2016

A descriptive cross-sectional survey of Dirofilaria infections in dogs was carried out from Janua... more A descriptive cross-sectional survey of Dirofilaria infections in dogs was carried out from January to March 2015 in Morogoro municipality, Tanzania. One hundred and fifty two blood samples were collected from healthy dogs aged more than 6 months living in different areas of Morogoro, and analyzed by modified Knott&amp;amp;amp;amp;amp;amp;amp;amp;#39;s technique for circulating microfilariae. Microfilaraemic samples were further analyzed by Polymerase chain reaction (PCR) and PCR products were sequenced for molecular identification. Microfilariae were detected by microscopy in 9 samples (5.92%), of which 6 tested positive by PCR. The 5.8S-internal transcribed spacer 2 (ITS2)-28S ribosomal DNA (rDNA) sequences generated were 97% identical to Dirofilaria immitis and 86% to 90% identical to D. repens, confirming the presence of D. immitis in Tanzania and showing the presence of D. repens, not previously observed.

The Journal of Parasitology, Sep 1, 2002

Journal of Clinical Microbiology

... to Edwardsiella ictaluri PHILLIP KLESIUS AND KATHY JOHNSON US Department of Agriculture, Agri... more ... to Edwardsiella ictaluri PHILLIP KLESIUS AND KATHY JOHNSON US Department of Agriculture, Agricultural Research Service Animal Parasite Research Laboratory, Auburn, Alabama 36830, USA ROBERT DURBOROW* Cooperative ...

Veterinary parasitology, Jan 3, 2001

The gene encoding surface antigen 1 (SAG1, P30) of Toxoplasma gondii (T. gondii) was cloned into ... more The gene encoding surface antigen 1 (SAG1, P30) of Toxoplasma gondii (T. gondii) was cloned into the plasmid pGEX-4T-3 and subsequently expressed in Escherichia coli (E. coli) as a glutathione-S-transferase (GST) fusion protein. The recombinant SAG1 (rSAG1) was refolded using 8M urea solution followed by dialysis and thereafter evaluated in an enzyme-linked immunosorbent assay (ELISA) for serological diagnosis of toxoplasmosis. The test sera were adsorbed with GST to block non-specific reactivity to the GST-SAG1 fusion protein. The ELISA with rSAG1 was able to differentiate very clearly between sera from cats or mice experimentally infected with T. gondii and sera from normal cats or mice. The ELISA detected no cross-reactivity with sera from mice experimentally infected with the closely related parasite Neospora caninum (N. caninum). Some 193 cat sera were tested for antibodies to T. gondii, out of which 40 (20.7%) reacted positively by ELISA with the rSAG1 while another 79.3% cats...

Tropical animal health and production, 2001

An in vitro infectivity assay was used to examine five cryoprotectants for their suitability for ... more An in vitro infectivity assay was used to examine five cryoprotectants for their suitability for preserving Theileria parva sporozoites. All five were capable of preserving T. parva sporozoites through freezing, the optimal concentrations being 7.5% for glycerol, 5% for dimethyl sulphoxide (DMSO), poly (vinylpyrrolidone) (PVP) and poly(ethylene glycol) (PEG), and 2.5% for hydroxyethyl starch (HES). When the five cryoprotectants were compared at their optimal concentrations, using a modification of the standard method of stabilate preparation, glycerol was significantly better than the others (p < 0.05). Measurement of the effects of each cryoprotectant on the osmolality of the media revealed that glycerol and DMSO elevated the osmolality significantly (p < 0.05). Resuscitation of glycerol-preserved sporozoites required the presence of glycerol in the diluent to maintain infectivity. Studies on the effects of equilibration time in glycerol on the infectivity of sporozoites show...

Veterinary Parasitology, 1997

Adult male and female Rhipicephalus appendiculatus ticks infected with Theileria parva (Muguga 30... more Adult male and female Rhipicephalus appendiculatus ticks infected with Theileria parva (Muguga 3087) were fed on rabbits and the development of infection was monitored daily using light microscopy and an in vitro titration technique able to quantify the infectivity of sporozoite suspensions. The salivary glands stained with methyl green pyronine showed presence of infection in some unfed ticks. The intensity of staining was shown to increase with the number of days the ticks had fed. The in vitro technique, on the other hand, could detect infection only in ticks which had fed for 3-5 days. Feeding of ticks on rabbits for 4 days produced significantly more sporozoites than any other lengths of feeding (P = 0.001). The in vitro assay was also able to demonstrate differences between male and female R. appendiculatus in production of infective sporozoites. Female ticks produced significantly more sporozoites than male ticks (P = 0.002).

Tropical Animal Health and Production, 2004

Theileria parva: in vitro studies on the e¡ects of holding temperature, pH and medium on sporozoi... more Theileria parva: in vitro studies on the e¡ects of holding temperature, pH and medium on sporozoite infectivity. Tropical Animal Health and Production, 36(4), 3413 51

Veterinary Parasitology, 2001

The cDNA encoding the entire mature hypodermin C (HC) of Hypoderma lineatum was cloned and expres... more The cDNA encoding the entire mature hypodermin C (HC) of Hypoderma lineatum was cloned and expressed in Escherichia coli as a glutathione S-transferase fusion protein using pGEX vector. The recombinant HC protein (rHC) was tested by Western blotting to detect antibodies to H. lineatum in cattle. Western blotting with rHC as antigen clearly differentiated between H. lineatum-infested cattle sera and normal cattle sera. Forty-six out of forty-eight serum samples from cattle in Central Mongolia were positive, whereas all 30 serum samples from cows in Hokkaido, Japan, were negative by Western blotting. The result of Western blotting was identical to that of a previously developed enzyme-linked immunosorbent assay. These data demonstrated that Western blotting, with rHC expressed in E. coli, might be a useful method for the diagnosis of cattle hypodermosis.

Tropical Animal Health and Production, 2009

Parasites & Vectors, 2011

Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock d... more Background: Tsetse flies and trypanosomiasis are among several factors that constrain livestock development in Tanzania. Over the years Rufiji District was excluded from livestock production owing to tsetse fly infestation, however, a few years ago there was an influx of livestock following evictions aimed at conserving the Usangu wetlands. Methods: A study was conducted to determine the efficiency of available traps for catching tsetse flies, Glossina species infesting the area, their infection rates and Trypanosoma species circulating in the area. Trapping was conducted during the semi dry season for a total of 30 days (ten days each month) during the onset of the dry season of May -July 2009. Harvested flies after every 24 hours were dissected and examined under a light microscope for trypanosome infections and whole fly DNA was extracted from 82 flies and analyzed for trypanosomes by polymerase chain reaction (PCR) using different sets of primers. Results: The proportions of total tsetse catches per trap were in the following decreasing order S3 (33%), H-Trap (27%), Pyramidal (19%), sticky panel (11%) and biconical trap (10%). Of the 1200 trapped flies, 75.6% were identified as Glossina pallidipes, 11.7% as G. brevipalpis, 9.6% as G. austeni and 3.0% G. morsitans morsitans. Dissections revealed the overall infection rate of 6.6% (13/197). Whole DNA was extracted from 82 tsetse flies and the prevalence of trypanosomes circulating in the area in descending order was 92.7% (76/82) for T. simiae; 70.7% (58/ 82) for T. brucei types; 48.8% (40/82) for the T. vivax types and 32.9% (27/82) for the T. congolense types as determined by PCR. All trypanosome types were found in all tsetse species analysed except for the T. congolense types, which were absent in G. m. morsitans. None of the T. brucei positive samples contained human infective trypanosomes by SRA -PCR test Conclusion: All tsetse species found in Rufiji are biologically important in the transmission of animal trypanosomiasis and the absence of T. congolense in G. m. morsitans could be a matter of chance only. Therefore, plans for control should consider all tsetse species.

Journal of Veterinary Medical Science, 2001

A pair of oligonucleotide primers were designed according to the nucleotide sequence of the P18 g... more A pair of oligonucleotide primers were designed according to the nucleotide sequence of the P18 gene of Babesia gibsoni (B. gibsoni), NRCPD strain, and were used to detect parasite DNA from blood samples of B. gibsoni-infected dogs by polymerase chain reaction (PCR). PCR was specific for B. gibsoni since no amplification was detected with DNA from B. Canis or normal dog leucocytes. PCR was sensitive enough to detect parasite DNA from 2.5 microl of blood samples with a parasitemia of 0.000002%. PCR detected parasite DNA from 2 to 222 days post-infection in sequential blood samples derived from a dog experimentally infected with B. gibsoni. The detection of B. gibsoni DNA by PCR was much earlier than the detection of antibodies to B. gibsoni in blood samples by the indirect fluorescent antibody test (IFAT) or that of the parasite itself in Giemsa-stained thin blood smear film examined by microscopy. In addition, 28 field samples collected from dogs in Kansai area, Japan, were tested for B. gibsoni infection. Nine samples were positive in blood smears, 9 samples were positive by IFAT and 11 samples were positive for B. gibsoni DNA by PCR. The nucleotide sequences of PCR products from all 11 samples found positive by PCR were completely identical to that of the P18 gene of the B. gibsoni, NRCPD strain. These results suggest that PCR provides a useful diagnostic tool for the detection of B. gibsoni infection in dogs.

A study was done to determine the prevalence of animal trypanasomiasis at Urambo and Mpanda distr... more A study was done to determine the prevalence of animal trypanasomiasis at Urambo and Mpanda district. Two villages which previously have history of Human African Trypanasomiasis were used in each district. Blood sample were collected from a total of 365 cattle, 98 goats and 11 dogs originating from 4 villages in both districts. Using microscopic diagnosis method, trypanosome infection were found to be 10.6% and 4.1% in cattle from Urambo and Mpanda respectively, 2.8% in goat from Urambo district and only one of dog out of seven sampled dogs in Urambo District was trypanosome positive. None of goat and dog from Mpanda district was positive. A total 390 samples collected on FTA cards in all district were tested for the presence of Trypanasome brucei sl using TBR 1&2 primers (TBR 1; GAATATACAATGCGCAG and TBR 2; CCATTTATTAGCTTTGTTGC) reviled high percentage of T.brucei s.l in cattle (53.5%) and goats (34.0%) at Urambo district while only 2.1% of cattle from Mpanda district were positive...