Jan Kwiatowski | University of Warsaw (original) (raw)

Papers by Jan Kwiatowski

We have sequenced most of the coding region of the gene Dopa decarboxylase (Ddc) in 24 fruitfly s... more We have sequenced most of the coding region of the gene Dopa decarboxylase (Ddc) in 24 fruitfly species. The Ddc gene is quite informative about Drosophila phylogeny. Several outstanding issues in Drosophila phylogeny are resolved by analysis of the Ddc sequences alone or in combination with three other genes, Sod, Adh, and Gpdh. The three species groups, melanogaster, obscura, and willistoni, are each monophyletic and all three combined form a monophyletic group, which corresponds to the subgenus Sophophora. The Sophophora subgenus is the sister group to all other Drosophila subgenera (including some named genera, previously considered outside the Drosophila genus, namely, Scaptomyza and Zaprionus, which are therefore downgraded to the category of subgenus). The Hawaiian Drosophila and Scaptomyza are a monophyletic group, which is the sister clade to the virilis and repleta groups of the subgenus Drosophila. The subgenus Drosophila appears to be paraphyletic, although this is not definitely resolved. The two genera Scaptodrosophila and Chymomyza are older than the genus Drosophila. The data favor the hypothesis that Chymomyza is older than Scaptodrosophila, although this issue is not definitely resolved. Molecular evolution is erratic. The rates of nucleotide substitution in 3rd codon position relative to positions 1 + 2 vary from one species lineage to another and from gene to gene.

Journal of Phycology, 2002

We investigated the similarity of a single Euglena myxocylindracea strain, isolated originally by... more We investigated the similarity of a single Euglena myxocylindracea strain, isolated originally by Bold and MacEntee, to several Euglena geniculata strains on both morphological and DNA levels. We found the three DNA stretches, consisting of fragments coding for the parts of cytoplasmic and chloroplast small subunit rRNA, and the internal transcribed spacer (ITS2) of cytoplasmic rDNA, with the combined length of 4332 nucleotides, are identical in E. myxocylindracea and E. geniculata , strain SAG 1224-4b. Morphological differences between E. myxocylindracea and any E. geniculata strain examined were well within the range of E. geniculata variability as well. The only difference behind the distinction of E. myxocylindracea from E. geniculata is the presence of the second chloroplast in the latter. However, we were able to induce the appearance of the second chloroplast in the cells of E. myxocylindracea and its disappearance in the cells of E. geniculata by changing the composition of the culture media. We therefore conclude that E. myxocylindracea Bold and MacEntee should be regarded as an environmental form of E. geniculata Dujardin. For the first time the morphology of E. geniculata chloroplasts was shown as revealed by confocal laser microscopy.

Genetics

We report the first case of two Cu/Zn Sod genes (ccSodl and ccSod2) that have been cloned and seq... more We report the first case of two Cu/Zn Sod genes (ccSodl and ccSod2) that have been cloned and sequenced from an insect, the medfly, Ceratitis capitata. Biochemical evidence suggested the presence of two Sod genes in the medfly. The two genes are isolated using different molecular strategies: ccSodl via cross-hybridization to a genomic library using a heterologous probe and ccSod2 from cDNA using a homologous probe generated by PCR. Sequence analysis shows that ccSodl and ccSod2 are different genes. The inferred amino sequences show that all essential residues of the active site are strictly conserved, which suggests both genes encode functional Cu/Zn superoxide dismutase (SOD). Phylogenetic analysis by the maximum parsimony method with bootstrap resampling of previously known Cu/ Zn SOD reveals two monophyletic groups, vertebrates and insects. The position of ccSOD2 in this phylogeny is undefined with respect to dipteran ccSOD1, vertebrate, plant, fungal, and extracellular Cu/Zn SOD, which suggests that the duplication detected in Ceratitis is ancient, perhaps as old as the origins of the arthropod phylum in the Cambrian more than 500 million years ago. In situ hybridization to polytene chromosomes places the genes on different chromosomes, which is consistent with an ancient gene duplication.

European journal of biochemistry / FEBS, Jan 15, 1985

A cyanide-insensitive superoxide dismutase was purified from tomato leaves (Lycopersicon esculent... more A cyanide-insensitive superoxide dismutase was purified from tomato leaves (Lycopersicon esculentum, Mill., var. Venture) to apparent homogeneity. The enzyme had twofold higher specific activity (about 4000 standard units) than ferric superoxide dismutases purified from Brassica campestris [Salin, M. L. and Bridges, S. M. (1980) Arch. Biochem. Biophys. 201, 369-374] and Nuphar luteum [Salin, M.L. and Bridges, S. M. (1982) Plant Physiol. 69, 161-165]. The protein had a relative molecular mass of about 42000 and was composed of two equal subunits noncovalently joined. It was negatively charged (pI = 4.6) and contained about 1.45 mol Fe/mol dimer and negligible amounts of Mn, Cu and Zn. Absorption spectrum and sensitivity to NaN3, H2O2 and temperature are also reminiscent of other ferric superoxide dismutases. Comparison of amino acid composition indicated, however, a closer relationship to the Mn-containing enzymes rather than to other Fe-containing superoxide dismutases. Two possible...

Chemistry and Biology of Pteridines and Folates, 2002

Proceedings of the National Academy of Sciences, 1995

The exon theory of genes proposes that the introns of protein-encoding nuclear genes are remnants... more The exon theory of genes proposes that the introns of protein-encoding nuclear genes are remnants of the DNA spacers between ancient minigenes. The discovery of an intron at a predicted position in the triose-phosphate isomerase (EC 5.3.1.1) gene of Cukx mosquitoes has been hailed as an evidential pillar of the theory. We have found that that intron is also present in Aedes mosquitoes, which are closely related to Culex, but not in the phylogenetically more distant Anopheks, nor in the fly CaUliphora vicina, nor in the moth Spodoptera littoralis. The presence of this intron in Culex and Aedes is parsimoniously explained as the result of an insertion in a recent common ancestor of these two species rather than as the remnant of an ancient intron. The absence of the intron in 19 species of very diverse organisms requires at least 10 independent evolutionary losses in order to be consistent with the exon theory.

Nucleic Acids Research, 1989

A Cu, Zn superoxide dismtase gene sec ewas btainied frcm a clone isolated

Nucleic Acids Research, 1989

The seqpence of 2103 bp given belaw, isolated frm a lambda ENBI3 nnmiic library of Droscriila vir... more The seqpence of 2103 bp given belaw, isolated frm a lambda ENBI3 nnmiic library of Droscriila virilis, codes for 0Oi-Zn spride disutase (SCD) . Ancps reii frene and a texminaticn c± are i£ifi&1e s artin atcsitimrs 154 aid 3163, rE tively.

Nucleic Acids Research, 1989

The sequence of 1793 bp given below, isolated from a lambda EMBL4 genomic library of Drosophila s... more The sequence of 1793 bp given below, isolated from a lambda EMBL4 genomic library of Drosophila simulans , codes for Cu-Zn superoxide dismutase (SOD). This sequence is very similar to that of D. melanogaster (1,2). The putative regulatory sequences found in D. melanogaster sequence are identifiable in homologous positions in D. simulans. These include the TATA box starting at position -26 and a polyadenylation signal at 1400. An open reading frame and a termination codon start at positions 69 and 1258, respectively. The overall identity of the sequence herein to the D. melanogaster SOD sequence from a Canton S strain (2) is 93.8%, but 4 and 10 gaps, constituting 95 nucleotides in all (the largest one of 28 nucleotides), are introduced in the D. melanogaster and D. simulans sequences, respectively. The transcribed region (capitalized; inferred by analogy with the D. melanogaster one) displays 95.3% identity. The coding region consists of two exons; the 729bp-long intron, spanning from position 135 to 864, separates the codons for amino acids 22 and 23, similarly as for D. melanogaster. The coding region is 97.6% identical in the two species (i.e., 11 substitutions out of 459 sites). The inferred sequence of 153 amino acids is the same as in D. melanogaster. gettcccettcgctttttatttatgcaettgetatttcccgccct -270 gtcattggataatggaagttccaatgeccactgttcgtttacwetcaegtscactetttetgcastgtecaaa -180 tgttccgttttaeattttgcatttgtawttttec te e -----eeeca tgcttgae tttteeegcttatecttcc -90 egtecgeteatagtgtgacacttttgcacctg"etgtettetatttccctggl=teagctgctctgctacggtc 1 ACACCTTAGAAGATACCTGGAAAGTTCTCAACTTTTTTCGCTTTGATAAATTGATTATTCATTCGAAATGGTGGTTAAA6CTGTCTGCG N V V K A V C 91 TAATTAACGGCGATGcCA CCTTTTCTTCGACA0GAGGTMATCCAAATCATTTGAACTTCTCTQCTCOGCAAAATATAC V I C D A K C T V F FfE Q E

Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 1997

The pathogenic yeast Cryptococcus neoformans ( Cn ) var. gattii causes meningoencephalitis in hea... more The pathogenic yeast Cryptococcus neoformans ( Cn ) var. gattii causes meningoencephalitis in healthy individuals, unlike the better known Cn varieties grubii and neoformans , which are common in immunocompromised individuals. The virulence determinants and mechanisms of host predilection are poorly defined for var. gattii . The present study focused on the characterization of a Cu,Zn superoxide dismutase ( SOD1 ) gene knock-out mutant constructed by developing a DNA transformation system. The sod1 mutant was highly sensitive to the redox cycling agent menadione, and showed fragmentation of the large vacuole in the cytoplasm, but no other defects were seen in growth, capsule synthesis, mating, sporulation, stationary phase survival or auxotrophies for sulphurcontaining amino acids. The sod1 mutant was markedly attenuated in virulence in a mouse model, and it was significantly susceptible to in vitro killing by human neutrophils (PMNs). The deletion of SOD1 also resulted in defects in the expression of a number of virulence factors, i.e. laccase, urease and phospholipase. Complementation of the sod1 mutant with SOD1 resulted in recovery of virulence factor expression and menadione resistance, and in restoration of virulence. Overall, these results suggest that the antioxidant function of Cu,Zn SOD is critical for the pathogenesis of the fungus, but is dispensable in its saprobic life. This report constitutes the first instance in which superoxide dismutase has been directly implicated in the virulence of a fungal pathogen.

Almost complete sequences of plastid SSU rDNA (16S rDNA) from 17 species belonging to the order E... more Almost complete sequences of plastid SSU rDNA (16S rDNA) from 17 species belonging to the order Euglenales (sensu Ne! meth, 1997 ; Shi et al., 1999) were determined and used to infer phylogenetic relationships between 10 species of Euglena, three of Phacus, and one of each of Colacium, Lepocinclis, Strombomonas, Trachelomonas and Eutreptia. The maximum-parsimony (MP), maximum-likelihood (ML) and distance analyses of the unambiguously aligned sequence fragments imply that the genus Euglena is not monophyletic. Parsimony and distance methods divide Euglenaceae into two sister groups.

Molecular phylogenetics and evolution, 1999

Drosophila species are extensively used in biological research; yet, important phylogenetic relat... more Drosophila species are extensively used in biological research; yet, important phylogenetic relationships within the genus and with related genera remain unresolved. The combined data for three genes (Adh, Sod, and Gpdh) statistically resolves outstanding issues. We define the genus Drosophila inclusively so as to include Scaptomyza and Zaprionus (considered distinct genera in the taxonomy of Wheeler, 1981) but excluding Scaptodrosophila. The genus Drosophila so defined is monophyletic. The subgenus Sophophora (including the melanogaster, obscura, and willistoni groups) is monophyletic and the sister clade to all other Drosophila subgenera. The Hawaiian Drosophila (including Scaptomyza) is a monophyletic group, but the subgenus Drosophila is not monophyletic, because the immigrans group is more closely related to the subgenus Hirtodrosophila than to other species of the subgenus Drosophila, such as the virilis and repleta groups.

Molecular biology and evolution, 1991

The Thermus aquaticus ( Taq) polymerase chain reaction (PCR) is a rapid means for DNA amplificati... more The Thermus aquaticus ( Taq) polymerase chain reaction (PCR) is a rapid means for DNA amplification, with many applications both in population and evolutionary biology, and in other fields. We report here the results of an experiment that tests the fidelity of the reaction. We have cloned and sequenced the products of six PCR amplifications of a 2.5-kb fragment containing the SodcAl gene of Drosophila melanogaster. We have observed four substitutions and two single-nucleotide frameshifts. The observed cumulative error frequency is 3.0 X 1O-4 for substitutions and 1.5 X lop4 for frameshifts. The error.rates per nucleotide polymerized are estimated as 1.5 X lop5 and 0.7 X 10e5 for substitutions and frameshifts, respectively.

Molecular Phylogenetics and Evolution, 1992

Genetics, 1994

DNA sequence variation in a 1410-bp region including the Cu,Zn Sod locus was examined in 41 homoz... more DNA sequence variation in a 1410-bp region including the Cu,Zn Sod locus was examined in 41 homozygous lines of Drosophila melanogaster. Fourteen lines were from Barcelona, Spain, 25 were from California populations and the other two were from laboratory stocks. Two common electromorphs, SODS and SODF, are segregating in the populations. Our sample of 41 lines included 19 SodS and 22 SodF alleles (henceforward referred to as Slow and Fast alleles). All 19 Slow alleles were identical in sequence. Of the 22 Fast alleles sequenced, nine were identical in sequence and are referred to as the Fast A haplotypes. The Slow allele sequence differed from the Fast A haplotype at a single nucleotide site, the site that accounts for the amino acid difference between SODS and SODF. There were nine other haplotypes among the remaining 13 Fast alleles sequenced. The overall level of nucleotide diversity (pi) in this sample is not greatly different than that found at other loci in D. melanogaster. It...

The phylogeny and taxonomy of the drosophilids have been the subject of extensive investigations.... more The phylogeny and taxonomy of the drosophilids have been the subject of extensive investigations. Recently, has challenged some common conceptions, and several sets of molecular data have provided information not always compatible with other taxonomic knowledge or consistent with each other. We present the coding nucleotide sequence of the Cu,Zn superoxide dismutase gene (Sod) for 15 species, which include the medfly Ceratitis capitata (family Tephritidae), the genera Chymomyza and Zaprionus, and representatives of the subgenera Dorsilopha, Drosophila, Hirtodrosophila, Scaptodrosophila, and Sophophora. Phylogenetic analysis of the Sod sequences indicates that Scaptodrosophila and Chymomyza branched off the main lineage before the major Drosophila radiations. The presence of a second intron in Chymomyza and Scaptodrosophila (as well as in the medfly) confirms the early divergence of these two taxa. This second intron became deleted from the main lineage before the major Drosophila radiations. According to the Sod sequences, Sophophora (including the melanogaster, obscura, saltans, and wiIlistoni species groups) is older than the subgenus Drosophila; a deep branch splits the willistoni and saltans groups from the melanogaster and obscura groups. The genus Zaprionus and the subgenera Dorsilopha and Hirtodrosophila appear as branches of a prolific "bush" that also embraces the numerous species of the subgenus Drosophila. The Sod results corroborate in many, but not all, respects Throckmorton's (King, R.C. (ed) Hand-Correspondence requests to: F..l. Ayala book of Genetics. Plenum Press, New York, pp. 421-469, 1975) phylogeny; are inconsistent in some important ways with Grimaldi's (Bull. Am. Museum Nat. Hist. 197:1-139, 1990) cladistic analysis; and also are inconsistent with some inferences based on mitochondrial DNA data. The Sod results manifest how, in addition to the information derived from nucleotide sequences, structural features (i.e., the deletion of an intron) can help resolve phylogenetic issues.

The phylogenetic position of Koliella , a chlorophyte characterized by Klebsormidium type cell di... more The phylogenetic position of Koliella , a chlorophyte characterized by Klebsormidium type cell division, was inferred from analyses of partial 18S rDNA and partial 16S rDNA. Parsimony and distance analyses of separate and combined data sets indicated that the members of Koliella belonged to Trebouxiophyceae, and high decay indices and bootstrap values supported this affinity. However, the genus appeared to be polyphyletic. Koliella spiculiformis , the nomenclatural type of the genus, was allied with Nannochloris eucaryota and the "true" chlorellas ( Chlorella vulgaris , C. lobophora , C. sorokiniana , and C. kessleri ). The close relatives of Koliella longiseta ( ϵ Raphidonema longiseta ) and Koliella sempervirens appeared to be Stichococcus bacillaris and some species traditionally classified in Chlorella that were characterized by the production of secondary carotenoids under nitrogendeficient conditions. This clade was also supported by the presence of a relatively phylogenetically stable group I intron (1506) in the 18S rRNA gene. Because of the presence of Klebsormidium type cell division, some authors regarded the members of Koliella as closely related to charophytes. Molecular analyses, however, did not confirm this affinity and suggested that a Klebsormidium type cell division is homoplastic in green plants.

Protist, 2010

Using Maximum Likelihood and Bayesian analyses of three genes, nuclear SSU (nSSU) and LSU (nLSU) ... more Using Maximum Likelihood and Bayesian analyses of three genes, nuclear SSU (nSSU) and LSU (nLSU) rDNA, and chloroplast SSU (cpSSU) rDNA, the relationships among 82 plastid-containing strains of euglenophytes were clarified. The resulting tree split into two major clades: clade one contained Euglena, Trachelomonas, Strombomonas, Colacium, Monomorphina, Cryptoglena and Euglenaria; clade two contained Lepocinclis, Phacus and Discoplastis. The majority of the members of Euglena were contained in clade A, but seven members were outside of this clade. Euglena limnophila grouped with, and was thus transferred to Phacus. Euglena proxima was a single taxon at the base of clade one and is unassociated with any subclade. Five members of Euglena grouped together within clade one and were transferred into the newly erected genus Euglenaria. The monophyly of the remaining genera was supported by Bayesian and Maximum Likelihood analyses. Combining datasets resolved the relationships among ten genera of photosynthetic euglenoids.

Proceedings of the National Academy of Sciences, 1996

We have investigated the evolution of glycerol-3-phosphate dehydrogenase (Gpdh). The rate of amin... more We have investigated the evolution of glycerol-3-phosphate dehydrogenase (Gpdh). The rate of amino acid replacements is 1 x 10'10/site/year when Drosophila species are compared. The rate is 2.7 times greater when Drosophila and Chymomyza species are compared; and about 5 times greater when any of those species are compared with the medfly Ceratitis capitata. This rate of 5 x 10'10/site/year is

Journal of Phycology, 2006

Eighteen new 16S rDNA and 16 new 18S rDNA sequences from 24 strains, representing 23 species of p... more Eighteen new 16S rDNA and 16 new 18S rDNA sequences from 24 strains, representing 23 species of photoautotrophic euglenoids, were obtained in nearly their entire length. Maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses were performed on separate data (39 sequences of 16S rDNA and 58 sequences of 18S rDNA), as well as on combined data sets (37 sequences). All methods of sequence analysis gave similar results in those cases in which the clades received substantial support. However, the combined data set produced several additional wellsupported clades, not encountered before in the analyses of green euglenoids. There are three main well-defined clades (A, B/C/D, and G) on trees from the combined data set. Clade G diverges first, while clades A and B/C/D form sister groups. Clade A consists of Euglena species sensu stricto and is divided into three sub-clades (A1, A2, and A3). Clade A3 (composed of E. deses and E. mutabilis) branches off first; then, two sister clades emerge: A1 (composed of E. viridis-like species) and A2 (consisting of E. agilis and E. gracilis species). Clade B/C/D consists of the Strombomonas, Trachelomonas, Cryptoglena, Monomorphina, and Colacium genera. Clade G comprises Phacus and Lepocinclis, as well as the Discoglena species of Euglena, with Discoglena branching off first, and then Phacus and Lepocinclis emerging as sister groups.

Journal of Phycology, 2002

Genetics

European journal of biochemistry / FEBS, Jan 15, 1985

Chemistry and Biology of Pteridines and Folates, 2002

Proceedings of the National Academy of Sciences, 1995

Nucleic Acids Research, 1989

A Cu, Zn superoxide dismtase gene sec ewas btainied frcm a clone isolated

Nucleic Acids Research, 1989

Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 1997

Molecular phylogenetics and evolution, 1999

Molecular biology and evolution, 1991

Molecular Phylogenetics and Evolution, 1992

Genetics, 1994

Protist, 2010

Proceedings of the National Academy of Sciences, 1996

Journal of Phycology, 2006