Highly Diverse Cyanobactins in Strains of the Genus Anabaena (original) (raw)

2010, Applied and Environmental Microbiology

Cyanobactins are small, cyclic peptides recently found in cyanobacteria. They are formed through proteolytic cleavage and posttranslational modification of short precursor proteins and exhibit antitumor, cytotoxic, or multi-drug-reversing activities. Using genome project data, bioinformatics, stable isotope labeling, and mass spectrometry, we discovered novel cyclic peptides, anacyclamides, in 27 Anabaena strains. The lengths of the anacylamides varied greatly, from 7 to 20 amino acids. Pronounced sequence variation was also detected, and only one amino acid, proline, was present in all anacyclamides. The anacyclamides identified included unmodified proteinogenic or prenylated amino acids. We identified an 11-kb gene cluster in the genome of Anabaena sp. 90, and heterologous expression in Escherichia coli confirmed that this cluster was responsible for anacyclamide production. The discovery of anacyclamides greatly increases the structural diversity of cyanobactins. Cyanobacteria are a prolific source of secondary metabolites with potential as drug leads or useful probes for cell biology studies (23). They include biomedically interesting compounds, such as the anticancer drug lead cryptophycin (15), and environmentally problematic hepatotoxic peptides, such as microcystins and nodularins produced by bloom-forming cyanobacteria (23). Many of these compounds contain nonproteinogenic amino acids and modified peptides and are produced by nonribosomal peptide synthesis (23, 26). The cyanobactins are a new group of cyclic peptides recently found in cyanobacteria (4). They are assembled through posttranslational proteolytic cleavage and head-to-tail macrocyclization of short precursor proteins. The cyanobactins are low-molecular-weight cyclic peptides that contain heterocyclized amino acids and can be prenylated or contain D-amino acids (3, 4). The cyanobactins that contain heterocyclized amino acids include patellamides, ulithiacyclamides, trichamide, tenuecyclamides, trunkamides, patellins, and microcyclamides and are synthesized in this manner (3, 4, 20, 24, 28). They possess antitumor, cytotoxic, and multi-drug-reversing activities and have potential as drug leads (4, 18, 20). Cyanobactins containing heterocyclized amino acids are found in a variety of cyanobacteria (4). A recent study demonstrated that the cyanobactin biosynthetic pathway is prevalent in planktonic bloom-forming cyanobacteria (14). However, the products of these gene clusters encoding new cyanobactins are unknown. Here we report discovery of a novel family of low-molecular-weight cyanobactins and show that these compounds are common in strains of the genus Anabaena. These anacyclamides exhibit pronounced length and sequence variation and contain unmodified or prenylated amino acids. MATERIALS AND METHODS Cyanobacterial strains and cultivation. The Anabaena strains were grown in Z8 (12) medium lacking a source of combined nitrogen, except for a few cultures for which nitrogen was included in the medium (Table 1). Strains were grown in 40-ml cultures under continuous light with a photon irradiance of 5 to 12 mol m Ϫ2 s Ϫ1 at 20 to 25°C. Z8 medium containing 34 S was used to detect sulfurcontaining peptides. The MgSO 4 ⅐ 7 H 2 O of Z8 medium was replaced by a stable isotope of MgSO 4 (catalog no. IS7080; 90 atom% 34 S; Icon). Annotation of the acy gene cluster. We obtained the complete genome sequence of the toxic bloom-forming freshwater cyanobacterium Anabaena sp. 90. Open reading frame (ORF) predictions were made with Glimmer, and the acy gene cluster was annotated using Artemis (Sanger Institute). Functional analysis of proteins was performed using BLASTp, and the predictions for start sites of the genes were checked manually. A putative peptide precursor gene was identified using BLASTp searches and homology of the N-terminal sequence of the 49-amino-acid AcyE protein and the precursor proteins of patellamide, tenuecyclamide, trichamide, and microcyclamide (4, 20, 24, 28). DNA extraction, amplification, and sequencing. Genomic DNA was extracted from the strains of Anabaena using an E.Z.N.A. plant DNA mini kit (Omega Bio-Tek, Doraville, GA). We prescreened 74 Anabaena strains for the presence of cyanobactin biosynthetic genes using a PCR approach based on the conserved subtilisin-like protease gene, as previously described (14). In order to identify an Anabaena strain producing a cyanobactin containing a sulfur amino acid, the acyE peptide precursor gene was amplified using primers preRNAF (5ЈGAAG AACATCCGCCCCCAACAAGTTG3Ј) and preRNAR (5ЈCTCCGCGTCGTC GCCTGCAAAAGG-3Ј) and primers PreF (5Ј-GCCTTCACCAAACCAGTCT TCTTCAT-3Ј) and PreR (5Ј-CATCGAGGCGAACCGTGCGCCAAGGGAT-3Ј) from the genomic DNA of Anabaena strains that were selected based on the presence of a cyanobactin biosynthetic gene fragment. PCRs were performed as previously described (14). Sequencing was carried out with an ABI 3730xl automated sequencer (Applied Biosystems) by Macrogen (Seoul, Korea). Sequences were checked and edited by using the Chromas 2.2 program (Technelysium Pty. Ltd.) and were aligned by using the Bioedit sequence alignment editor. Cloning the acy biosynthetic gene cluster. The entire 11-kb acy gene cluster was amplified from genomic DNA of Anabaena sp. 90 by PCR using primers patex2f (5Ј-ATGGATCCTGATGGACTGTAGTGTGAG-3Ј) and patex5r (5Ј-TACTCGAGAGGTTTTGGGACTCTTTAG-3Ј) in three 60-l reaction mixtures containing 1ϫ PCR buffer for Super Taq Plus (HT Biotechnology Ltd.), 200 mol of each nucleotide (Finnzymes), 0.75 M of each primer, 0.8 U Super Taq Plus proofreading polymerase (HT Biotechnology Ltd.), and 100 ng of Anabaena sp. 90 template DNA. The thermocycling conditions were 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 56.4°C for 30 s, and 68°C for 9 min and then a final extension at 68°C for 20 min. The PCR products were separated on a 0.6% agarose gel containing 0.5ϫ Tris-acetate-EDTA and run for 30 min at 100 V. The gel was stained using SYBR Safe DNA gel stain (Invitrogen) and was visualized using a Dark reader (Clare Chemical Research Inc.