Identification of 6 new mutations in the iduronate sulfatase gene (original) (raw)
Related papers
Journal of inherited metabolic disease, 1998
Our series of studies on Hunter disease in Japanese patients showed allelic heterogeneity of IDS gene mutations, genotype/phenotype correlation and racial differences in distribution of mutations. Twenty-five different small mutations have been characterized. Small mutations in the Japanese population are widely distributed through the IDS gene, although some mutations were unevenly concentrated on exon 5 (28%) and on exon 9 (24%). Mutations were seen at the same codon 468 in exon 9 in 5 patients. These findings are in good agreement with data on other ethnic groups. Two unique mutations linked to a severe phenotype were apparently associated with aberrant splicings; one was a point mutation within exon 3 (P86L), partially activating a cryptic splice acceptor site at 28 bp downstream from the mutation site within exon 3 and producing a 44-base truncated mRNA, and the other was a point mutation at the consensus sequence of the splice donor site of intron 2, causing exon 2 skipping.
American journal of human genetics, 1995
Virtually all mutations causing Hunter syndrome (mucopolysaccharidosis type II) are expected to be new mutations. Therefore, as a means of molecular diagnosis, we developed a rapid method to sequence the entire iduronate-2-sulfatase (IDS) coding region. PCR amplicons representing the IDS cDNA were sequenced with an automatic instrument, and output was analyzed by computer-assisted interpretation of tracings, using Staden programs on a Sun computer. Mutations were found in 10 of 11 patients studied. Unique missense mutations were identified in five patients: H229Y (685C-->T, severe phenotype); P358R (1073C-->G, severe); R468W (1402C-->T, mild); P469H (1406C-->A, mild); and Y523C (1568A-->G, mild). Non-sense mutations were identified in two patients: R172X (514C-->T, severe) and Q389X (1165C-->T, severe). Two other patients with severe disease had insertions of 1 and 14 bp, in exons 3 and 6, respectively. In another patient with severe disease, the predominant (&g...
Hunter syndrome: isolation of an iduronate-2-sulfatase cDNA clone and analysis of patient DNA
Proceedings of the National Academy of Sciences, 1990
Iduronate 2-sulfatase (IDS, EC 3.1.6.13) is required for the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations causing IDS deficiency in humans result in the lysosomal storage of these glycosaminoglycans and Hunter syndrome, an X chromosome-linked disease. We have isolated and sequenced a 2.3-kilobase cDNA clone coding for the entire sequence of human IDS. Analysis of the deduced 550-amino acid IDS precursor sequence indicates that IDS has a 25-amino acid amino-terminal signal sequence, followed by 8 amino acids that are removed from the proprotein. An internal proteolytic cleavage occurs to produce the mature IDS present in human liver shown to contain a 42-kDa polypeptide N-terminal to a 14-kDa polypeptide. The IDS sequence has strong sequence homology with other sulfatases (such as sea urchin arylsulfatase, human arylsulfatases A, B, and C, and human glucosamine 6-sulfatase), suggesting that the sulfatases comprise an evolutionarily related family of genes that arose by gene duplication and divergent evolution. The arylsulfatases have a greater homology with each other than with the nonarylsulfatases (IDS and glucosamine 6-sulfatase). The IDS cDNA detected RNA species of 5.7, 5.4, 2.1, and 1.4 kilobases in human placental RNA and revealed structural alterations and gross deletions of the IDS gene in many of the clinically severe Hunter syndrome patients studied.
Molecular basis of mucopolysaccharidosis type II: Mutations in the iduronate-2-sulphatase gene
Human Mutation, 1993
A number of mutations in the X-chromosomal human iduronate-2-sulphatase gene have now been identified as the primary genetic defect leading to the clinical condition known as Hunter syndrome or mucopolysaccharidosis type 11. The mutations that are tabulated include different deletions, splice-site and point mutations. From the group of 319 patients thus far studied by Southern analysis, 14 have a full deletion of the gene and 48 have a partial deletion or other gross rearrangements. All patients with full deletions or gross rearrangements have severe clinical presentations. Twenty-nine different "small" mutations have so far been characterised in a total of 32 patients. These include 4 nonsense and 13 missense mutations, 7 different small deletions from 1 to 3 bp, with most leading to a frameshift and premature chain termination, and 5 different splice-site mutations also leading to small insertions or deletions in the mRNA. A 60 bp deletion, that results from a new donor spliceesite, has been observed in five unrelated patients with relatively mild clinical phenotypes. This information will not only be useful for MPS I1 patient and carrier diagnosis, but also will aid in the understanding of the structure and function of iduronate-2-sulphatase, and possibly in correlating genotype with phenotype. o 1993 WiIeyLiss, Inc.
Human Mutation, 2003
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is a n X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T , 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs , we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.
Molecular analysis of the iduronate-2-sulfatase gene in Thai patients with Hunter syndrome
Journal of Inherited Metabolic Disease, 2008
Molecular defects in the gene encoding the enzyme iduronate-2-sulfatase (IDS) result in Hunter disease (mucopolysaccharidosis type II, MPS II). To determine the molecular basis of MPS II in Thailand, the IDS gene was analysed in 20 Thai patients with Hunter syndrome from 18 unrelated families. A total of 19 different mutations, including 9 missense mutations, 3 nonsense mutations, 3 splice site alterations, 1 deletion, 2 indels, and 1 rearrangement were identified, 8 of which were novel (p.R101C, p.D148V, p.G224A, p.K227E, p.E254X, p.W337X, c.440_442delinsTT and c.720_731delinsTTTCAGATGTTCTCCCCAG). Evaluation of the IDS activity of two hemizygous variants identified in the same patient, p.R101C and p.R468Q, by expression of IDS with the individual mutations in COS 7 cells indicated that only the p.R468Q mutation affected IDS protein activity. Two exonic mutations, c.257C>T (p.P86L) and c.418G>A, were found to activate multiple cryptic splice sites, resulting in aberrantly spliced transcripts. Thus, MPS II in Thailand is caused by a diverse set of defects affecting both IDS protein production and activity. Abbreviations ESE exonic splicing enhancer IDS iduronate 2-sulfatase IDS iduronate 2-sulfatase gene IDS-2 iduronate 2-sulfatase pseudogene
Human Mutation, 2001
Mucopolysaccharidosis type II (MPS2, or Hunter syndrome), rare X-linked lysosomal storage disorder, results from deleterious mutations in the iduronate-2-sulfatase (IDS) gene. We report here the mutational analysis of a total of 40 unrelated Italian MPS II patients ranging from mild to severe phenotype. We are able to assign the genotype to 29 of them (72.5%), identifying 22 different mutations, five of which are unpublished (c.533delTT, W12X, N265I, c.1131-1142del, c.1131-1305del). A total of 55.2% of the molecularly characterised patients resulted from missense mutations, 20.7% from nonsense mutations, and another 13.8% of patients from small deletions (<20pb) or splice mutations, whereas 10.3% of the cases carried major structural alterations such as large deletion and rearrangements. The results reported here support the evidence of the mutational heterogeneity of the IDS gene as well as the difficulty to correlate genotype and phenotype in the patients with MPSII. However, the molecular characterisation of the patients is advantageous, making the carrier detection feasible for the females in the family at risk and improving the reliability of prenatal diagnosis techniques. Moreover, it provides a good foundation for therapeutic strategies.
Human Mutation, 2010
Sequence analysis of the X-linked iduronate-2-sulfatase (IDS) gene in two Hunter syndrome patients revealed a lack of concordance between IDS genomic DNA and cDNA. These individuals were found to be hemizygous respectively for a nonsense mutation [c.22C>T;p.R8X] and a frameshift micro-insertion [c.10insT;p.P4Sfs] in their genomic DNA. However, both wildtype and mutant IDS sequences were evident upon cDNA analysis. Similar discrepant results were also obtained in a third unrelated patient carrying the same p.R8X mutation. Since both p.R8X mutations were inherited from carrier mothers, somatic mosaicism could be excluded. Although the presence of wild-type IDS mRNA-transcripts was confirmed in all three patients by restriction enzyme digestion, clone sequencing, pyrosequencing and single nucleotide primer extension (SNuPE), no wild-type IDS genomic sequence was detectable. The relative abundance of wild-type and mutation-bearing IDS-transcripts in different tissues was quantified by SNuPE. Although IDS transcript levels, as measured by real-time PCR, were reduced (51-71% normal) in these patients, some wild-type IDS protein was detectable by western blotting. Various possible explanations for these unprecedented findings (e.g. accidental contamination, artefactual in vitro nucleotide misincorporation, malsegregation of an extra maternal X-chromosome) were explored and experimentally excluded. PCR-based discriminant assay and segregation analysis of a linked IDS polymorphism (rs1141608) also served to exclude the presence of IDS cDNA derived from the maternal wild-type chromosome. Although it remains to be formally demonstrated by direct experimentation, the intriguing possibility arises that we have observed the in vivo correction of heritable gene lesions at the RNA level operating via a correction mechanism akin to RNA-editing.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 2001
Mucopolysaccharidosis type II (Hunter syndrome; OMIM 309900) is a rare X-linked recessive lysosomal storage disorder caused by the deficiency of the enzyme iduronate-2-sulfatase (IDS; EC 3.1.6.13). Different alterations at the IDS locus, mostly missense mutations, have been demonstrated, by expression study, as deleterious, causing significant consequences on the enzyme function or stability. In the present study we report on the results of the transient expression of the novel K347T, 533delTT, N265I and the already described 473delTCC (previously named vS117) mutations in the COS 7 cells proving their functional consequence on IDS activity. This type of information is potentially useful for genotype^phenotype correlation, prognosis and possible therapeutic intervention. ß 0925-4439 / 01 / $^see front matter ß 2001 Elsevier Science B.V. All rights reserved. PII: S 0 9 2 5 -4 4 3 9 ( 0 1 ) 0 0 0 7 5 -8 * Corresponding