Application of new catalytic phosphate protecting groups for the highly efficient phosphotriester oligonucleotide synthesis (original) (raw)
Related papers
Phosphotriester approach to the synthesis of oligonucleotides: a reappraisal
Journal of the Chemical Society, Perkin Transactions 1, 1993
The phosphotriester approach to the synthesis of oligodeoxyribo-and oligoribo-nucleotides in solution has been reinvestigated. The efficacy of mesitylene-2-sulfonyl chloride (MSCI) 15a, 2,4,6triisopropylbenzenesulfonyl chloride (TrisCI) 1 5b, 4bromobenzenesulfonyl chloride 1 5c. naphthalene-1-sulfonyl chloride 39, and 2-and 4-nitrobenzenesulfonyl chlorides 40a and 40b, respectively, as activating agents has been examined. The latter arenesulfonyl chlorides have been used in conjunction with the following nucleophilic catalysts: 1-methylimidazole, 3-nitro-I H-1,2,4-triazole 19, 5-(3-nitrophenyl)-l H-tetrazole 20a, 5-(3.5-dinitrophenyl)-l H-tetrazole 20b. 5-(1-methylimidazol-2y l)-I H-tetrazole 21, 5-[ (1-methylimidazol-2-yl)methyl]-1 H-tetrazole 22, 4-ethoxypyridine 1-oxide 14a. 4,6-dinitro-l-hydroxybenzotriazole 29a, 1-hydroxy-4-nitro-6-(trifluoromethyl) benzotriazole 29b. 1-hydroxy-5-phenyltetrazole 30a and 1-hydroxy-5-(3-nitrophenyl) tetrazole 30b. The rates of formation and yields of the fully protected dideoxyribonucleoside and diribonucleoside phosphates 37 and 47, respectively, were determined using various combinations of activating agents and nucleophilic catalysts. Although 2-and 4-nitrobenzenesulfonyl chlorides 40a and 40b. respectively, proved to be the most powerful activating agents, their use in the deoxy-series led to the formation of by-products and hence to unsatisfactory isolated yields of the dideoxyribonucleoside phosphate 37. I I +-0 ii. iii /o 3 4 Ar = 2-chlorophenyl; B and B' are protected in substrates 1, 2 and 3, and unprotected base residues in product 4
Oligonucleotide synthesis using the manual phosphotriester method
Methods in molecular biology (Clifton, N.J.), 1988
During the past few years, synthetic DNA, used as a primer in DNA polymerization, in site-directed mutagenesis or as a probe in gene selection, has assumed a central role in recombinant DNA technology (1). This was made possible by the development of methods for efficient solid phase chemical synthesis. Deoxyribonucleotides are ideally suited to solid-phase synthesis since their relative chemical uniformity allows for application of oligodeoxyribonucleotide (oligonucleotide) purification techniques, which are largely dependent on chain length. Hence, the potential disadvantage of omitting purification after each coupling step is minimized. This contrasts with peptide synthesis in which purification of the final product is more difficult, thereby placing greater demands on coupling efficiency. In practice, coupling efficiencies of at least 95% are now attainable in oligonucleotide synthesis because of the availability of highly reactive mononucleotides and specially developed couplin...
Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support
Nucleic Acids Research, 1980
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtainable by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.
Nucleic Acids Research, 1977
Nucleoside 3'-phosphotriesters as key intermediates for the oligoribonucleotide synthesis. IV. New method for removal of 2,2,2-trichloroethyl group and 31P NM R as a new tool for analysis of deblocking of intemucleotide phosphate protecting groups1 ABSTRACT Zinc/acetylacetone/pyridine treatment has been designed as a very efficient method for removal of 2,2,2-trichloroethyl group from phosphoesters. Internucleotide and terminal 2,2,2-trichloroethylphosphotriesters were transformed to corresponding diesters quantitatively. Much less reactive 2,2,2-trichloroethylphosphodiesters produced monoesters with ca. 909 yield. 31 NMR spectroscopy has been proposed as a new tool for analysis of removal of internucleotide phosphate protecting groupsa crucial step in oligonucleotides synthesis via phosphotriester approach.
Solid-phase synthesis of base-sensitive oligonucleotides
Arkivoc, 2008
Oligonucleotides bearing N-acylated and O-alkylated nucleobases, biodegradable phosphate protections, cap-structures, internucleotidic H-phosphonates, methylphosphates, Omethylphosphorothioates and phosphotriesters are sensitive to nucleophiles, nucleopeptides are prone to β-elimination and some of the dihydropyrimidines undergo retro condensation. None of them withstand the standard ammonolytic deprotection, but an alternative synthetic procedure should be adopted. In this review, orthogonal protecting group schemes and the N-unprotected methods for the solid-phase synthesis of these important oligonucleotides are presented.