BMC Microbiology BioMed Central Methodology article Large scale multiplex PCR improves pathogen detection by DNA (original) (raw)
Related papers
Journal of Clinical Microbiology, 2002
We describe a novel adaptation of the TaqMan PCR assay which potentially allows for highly sensitive detection of any eubacterial species with simultaneous species identification. Our system relies on a unique multiprobe design in which a single set of highly conserved sequences encoded by the 16S rRNA gene serves as the primer pair and is used in combination with both an internal highly conserved sequence, the universal probe, and an internal variable region, the species-specific probe. A pre-PCR ultrafiltration step effectively decontaminates or removes background DNA. The TaqMan system described reliabAly detected 14 common bacterial species with a detection limit of 50 fg. Further, highly sensitive and specific pathogen detection was demonstrated with a prototype species-specific probe designed to detect Staphylococcus aureus . This assay has broad potential in the clinical arena for rapid and specific diagnosis of infectious diseases.
Development of Multiplex PCR Based Assay for the Concurrent Detection of Pathogenic Microorganisms
2015
Objective: Salmonella enterica is an important enteric pathogen which causes gastroenteritis and enteric fever in humans and is widely spread in nature. Outbreaks of Salmonella infections are frequently reported in both developed and developing countries, as this pathogen spreads very rapidly by means of water and the food chain. Methods: A multiplex PCR (mPCR) assay was developed for the detection of multiple Salmonella serotypes in different kind of food products. To increase specificity of this molecular method, three sets of oligonucleotide primer were used to detect the most prevalent salmonella species. Different primer pairs were used for the optimization of the multiplex PCR. The primer pair, ST FW and ST RV, was specific to Salmonella typhi and targeted a randomly selected sequence of 600bp. The primer pair SPFW and SPRV specific to Salmonella paratyphi for a sequence of 800 bp in length. Likewise, the primers pairs SEFW and SERV were designed to amplify a sequence of about...
2014
Salmonella enterica is an important enteric pathogen which causes gastroenteritis and enteric fever in humans and is widely spread in nature. Outbreaks of Salmonella infections are frequently reported in both developed and developing countries, as this pathogen spreads very rapidly by means of water and the food chain. A multiplex PCR (mPCR) assay was developed for the detection of multiple Salmonella serotypes in different kind of food products. To increase specificity of this molecular method, three sets of oligonucleotide primer were used to detect the most prevalent salmonella species. Different primer pairs were used for the optimization of the multiplex PCR. The primer pair, ST FW and ST RV, was specific to Salmonella typhi and targeted a randomly selected sequence of 600bp. The primer pair SPFW and SPRV specific to Salmonella paratyphi for a sequence of 800bp in length. Likewise, the primers pairs SEFW and SERV were designed to amplify a sequence of about 1000bp from S. enter...
Large scale multiplex PCR improves pathogen detection by DNA microarrays
BMC Microbiology, 2009
Background Medium density DNA microchips that carry a collection of probes for a broad spectrum of pathogens, have the potential to be powerful tools for simultaneous species identification, detection of virulence factors and antimicrobial resistance determinants. However, their widespread use in microbiological diagnostics is limited by the problem of low pathogen numbers in clinical specimens revealing relatively low amounts of pathogen DNA. Results To increase the detection power of a fluorescence-based prototype-microarray designed to identify pathogenic microorganisms involved in sepsis, we propose a large scale multiplex PCR (LSplex PCR) for amplification of several dozens of gene-segments of 9 pathogenic species. This protocol employs a large set of primer pairs, potentially able to amplify 800 different gene segments that correspond to the capture probes spotted on the microarray. The LSplex protocol is shown to selectively amplify only the gene segments corresponding to the...
Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens
2012
sufficient in specifically and simultaneously detecting as few as 10 CFU/ mL of the five pathogens in artificially inoculated food samples after enrichment for 12 h. Finally, each 25-g sample was mixed with 225mL of SEB medium and incubated at 37 o C for 12-h. Then, each1mL of the culture broth was subjected to the multiplex PCR assay as the schematic representation of detection procedure is presented in Figure 3. The assay is reliable, rapid, specific, and robust. Therefore, it can be another tool for the investigation of microbial contamination in raw food and food products, and will also be useful for identifying the sources of food borne out break
PCR-based Diagnostic for Infectious Diseases
Molecular diagnostics are revolutionising the clinical practice of infectious disease. Their effects will be significant in acutecare settings where timely and accurate diagnostic tools are critical for patient treatment decisions and outcomes. PCR is the most well-developed molecular technique up to now, and has a wide range of already fulfilled, and potential, clinical applications, including specific or broad-spectrum pathogen detection, evaluation of emerging novel infections, surveillance, early detection of biothreat agents, and antimicrobial resistance profiling. PCR-based methods may also be cost effective relative to traditional testing procedures. Further advancement of technology is needed to improve automation, optimise detection sensitivity and specificity, and expand the capacity to detect multiple targets simultaneously (multiplexing). This review provides an up-to-date look at the general principles, diagnostic value, and limitations of the most current PCR-based platforms as they evolve from bench to bedside.
Novel Multiplex PCR to Specifically Detect Bacterial Foodborne Pathogens
2013
Bacterial foodborne pathogens prevalent in poultry, especially Escherichia coli, Salmonella spp., Shigella spp., and Listeria monocytogenes, have been reported in many countries including Thailand. Rapid methods for identification and detection of these dominant foodborne pathogens are still required. In our study, multiplex polymerase chain reaction (m-PCR) was developed for detecting multiple bacterial foodborne pathogens. Specific genes for the m-PCR primers were screened and selected. m-PCR targeting the uspA, fimY, ipaH, and prfA gene was used to detect E. coli, Salmonella spp., Shigella spp., and L. monocytogenes, respectively. The optimum conditions for the m-PCR reaction were found to be primer concentrations of 0.02 μM ipaH, 0.036 μM fimY, 0.06 μM uspA,0.12 μM prfA, and 0.4 μM 16S rRNA gene (used as internal control) for at least 10 ng of each bacterial total genomic DNA; and 52 o C was the annealling temperature. The expected PCR products of 884, 489, 422, and 398 bp were ...
BMC Microbiology, 2013
Background: Polymerase chain reaction (PCR)-based techniques are widely used to identify fungal and bacterial infections. There have been numerous reports of different, new, real-time PCR-based pathogen identification methods although the clinical practicability of such techniques is not yet fully clarified. The present study focuses on a novel, multiplex, real-time PCR-based pathogen identification system developed for rapid differentiation of the commonly occurring bacterial and fungal causative pathogens of bloodstream infections. Results: A multiplex, real-time PCR approach is introduced for the detection and differentiation of fungi, Gram-positive (G+) and Gram-negative (G-) bacteria. The Gram classification is performed with the specific fluorescence resonance energy transfer (FRET) probes recommended for LightCycler capillary real-time PCR. The novelty of our system is the use of a non-specific SYBR Green dye instead of labelled anchor probes or primers, to excite the acceptor dyes on the FRET probes. In conjunction with this, the use of an intercalating dye allows the detection of fungal amplicons. With the novel pathogen detection system, fungi, G + and G-bacteria in the same reaction tube can be differentiated within an hour after the DNA preparation via the melting temperatures of the amplicons and probes in the same tube.
Gram Type-Specific Broad-Range PCR Amplification for Rapid Detection of 62 Pathogenic Bacteria
1999
Broad-range PCR has proven to be useful for the detection of bacteria. A set of broad-range PCR primers directed against conserved regions in the 16S rRNA gene was designed to specifically amplify either gram- positive or gram-negative bacteria. The gram type-specific broad-range PCR correctly classified all 62 patho- genic species tested. Antibiotic treatment of bacterial infections depends on the species
Journal of Infection, 2013
Objectives: To determine whether systematic testing of faecal samples with a broad range multiplex PCR increases the diagnostic yield in patients with diarrhoea compared with conventional methods and a clinician initiated testing strategy. Methods: 1758 faecal samples from 1516 patients with diarrhoea submitted to two diagnostic laboratories were tested for viral, bacterial, and parasitic pathogens by Fast-Track Diagnostics multiplex real-time PCR kits and conventional diagnostic tests. Results: Multiplex PCR detected pathogens in 530 samples (30%): adenovirus (51, 3%), astrovirus (95, 5%), norovirus (172, 10%), rotavirus (3, 0.2%), Campylobacter jejuni/coli (85, 5%), Salmonella spp. (22, 1%), Clostridium difficile (72, 4%), entero-haemorrhagic Escherichia coli (21, 1%), Cryptosporidium spp. (3, 0.2%), Entamoeba histolytica (1, 0.1%), and Giardia lamblia (59, 3%). In contrast, conventional testing detected a pathogen in 324 (18%) samples. Conclusions: Using a systematic approach to the diagnosis of gastroenteritis improved diagnostic yield. This enhanced detection with PCR was achieved by a combination of improved detection of individual pathogens and detection of pathogens not requested or unable to be tested by conventional tests. This approach also allowed earlier identification for most pathogens and created a workflow which is likely to adapt well for many diagnostic laboratories.
Multiplex PCR for the concurrent detection and differentiation of
2016
Abstract: Salmonellosis outbreaks involving typhoid fever and human gastroenteritis are important diseases in tropical countries where hygienic conditions are often not maintained. A rapid and sensitive method to detect Sal-monella spp., Salmonella Typhi and Salmonella Typhimurium is needed to improve control and surveillance of ty-phoid fever and Salmonella gastroenteritis. Our objective was the concurrent detection and differentiation of these food-borne pathogens using a multiplex PCR. We therefore designed and optimized a multiplex PCR using three specific PCR primer pairs for the simultaneous detection of these pathogens. The concentration of each of the primer pairs, magnesium chloride concentration, and primer annealing temperature were optimized before verifica-tion of the specificity of the primer pairs. The target genes produced amplicons at 429 bp, 300 bp and 620 bp which were shown to be 100 % specific to each target bacterium, Salmonella spp., Salmonella Typhi and Salmo...
Rapid detection and differentiation of pathogenic and by real-time PCR
Research in Microbiology, 2005
A two-tube real-time assay, developed in a LightCycler TM , was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5 -GTG-CTAGCTTGCTAGAACTTAGAGA-FITC-3 ) and a universal downstream probe Cy5 (5 -Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO 4 -3 ), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 • C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85 ± 0.5 and 56 • C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.
Clinical Microbiology and Infection, 2007
The aim of this study was to develop a sensitive and reliable method for the molecular identification of pathogenic bacteria. A multiplex PCR-based reverse line blot (mPCR ⁄ RLB) hybridisation assay was developed and evaluated for the rapid identification of 24 systemic and respiratory bacterial pathogens in routine diagnosis. All species-specific probes designed for the RLB hybridised with amplified DNA only from the corresponding species. Sensitivity limits of the mPCR ⁄ RLB assay varied among the 24 target organisms from 0.05 pg to 0.5 ng of genomic DNA. The sensitivity of the assay was 2 · 10 2 CFU ⁄ mL for Streptococcus pneumoniae and 6 · 10 2 CFU ⁄ mL for Escherichia coli. The specificity of each probe was tested against 24 species. There were no cross-reactions among any of the 43 probes. The mPCR ⁄ RLB assay appeared to be a useful alternative tool for the molecular identification of common pathogens.
Scandinavian Journal of Infectious Diseases, 2011
The potential use of bacteria and viruses as biological terror weapons makes certain highly pathogenic microorganisms a worldwide public health threat. In an outbreak investigation involving a possible deliberate spread of a biological warfare agent there is a need for a fast and reliable diagnostic method. Ideally, the same method should be usable for both bacteria and viruses. To distinguish between natural and deliberate spread, information on the prevalence/incidence of the organism/disease, ecology and natural mechanisms for spread is needed. In addition, knowledge of national and international subtypes reflecting both micro-and macro-evolution of the organisms is required for the analysis.
Water science and technology : a journal of the International Association on Water Pollution Research, 2004
We evaluated quantitative real-time PCR (qPCR) and RTqPCR (for RNA species) for their ability to quantify microorganisms and viruses in problematic environmental samples such as cattle manure, digester material, wastewater and soil. Important developments included a standard spiking approach which compensated for methodological bias and allowed sample-to-sample comparison and reliable quantification. Programme CeTe was developed to calculate endogenous concentrations of target organisms (nucleic acid copies) for each sample separately from the generated standard curves. The approach also permitted assessment of the detection limit of the complete method, including extraction. It varied from sample to sample, due to different extraction efficiencies and variable co-extraction of PCR inhibitors. False negative results were thereby avoided. By using this approach we were able to optimise a DNA extraction protocol from the different tested sample types. Protocols for the extraction of R...
Improving sensitivity of single tube nested PCR to detect fastidious microorganisms
Heliyon
Single Tube Nested PCR (ST-nPCR) is of value to clinical laboratories with limited settings for the detection of fastidious microorganisms. The detection sensitivity of ST-nPCR is dependent on ensuring minimal leftovers of outer primers during the second round of the reaction. In this work, we investigated various approaches to optimize the performance of outer primers, including decreasing outer primer concentrations; using antisense oligonucleotides to block outer primers; using chemically modified inner primers; and using Q5 Taq polymerase that lacks 5 0 -3 0 exonuclease and strand displacement capabilities. These solutions were tested on C. abortus and C. psittaci, which are both fastidious intracellular bacteria that are difficult to diagnose. The best obtained result was by using Q5 Taq polymerase. A detection limit with a range between 0.1 and 1 ag was achieved, which corresponds to a range between 0.2 and 2 copies of the plasmid positive control. This level of sensitivity is comparable or even better than the sensitivity achieved by TaqMan probe based real-time PCR assays. The assay was validated using 70 veterinary clinical samples from small ruminant abortions and 10% of these samples gave positive results. In conclusion, sensitivity of ST-nPCR to detect fastidious microorganisms can be improved by using Taq polymerases that lacks 5 0 -3 0 exonuclease. The proposed assay is affordable and applicable to a wide range of fastidious pathogens and can be suitable for laboratories with limited settings.
Novel Multiplex PCR Assay for Rapid Detection of Five Bacterial Foodborne Pathogens
2017
Milk and dairy products can harbor varieties of foodborne pathogens especially Bacillus cereus, Escherichia coli, Listeria monocytogenes, Salmonella spp., and Staphylococcus aureus. In this work, a rapid multiplex polymerase chain reaction (m-PCR) method for simultaneous detection of 5 major foodborne pathogens in milk was developed. Specific primers targetting the enterotoxin FM, uspA, prfA, fimY, and eap genes were selected for specific detection of B. cereus, E. coli, L. monocytogenes, Salmonella spp., and S. aureus, respectively. The optimum concentrations of the primers in the m-PCR reaction were 0.04 μM enterotoxin FM, 0.12 μM uspA, 0.16 μM prfA, 0.04 μM fimY, and 0.2 μM eap. The expected polymerase chain reaction (PCR) products of 513, 884, 398, 315, and 230 bp were detected from the specific amplification of B. cereus, E. coli, L. monocytogenes, Salmonella spp., and S. aureus, respectively. Cross-amplifications from non-target bacteria isolated from raw milk samples were not...
Brazilian Journal of Microbiology, 2011
Nosocomial infections are major clinical threats to hospitalised patients and represent an important source of morbidity and mortality. It is necessary to develop rapid detection assays of nosocomial pathogens for better prognosis and initiation of antimicrobial therapy in patients. In this study, we present the development of molecular methods for the detection of six common nosocomial pathogens including Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniae, Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter spp. Conventional multiplex PCR and SYBR Green based real time PCR assays were performed using genus and species specific primers. Blind testing with 300 clinical samples was also carried out. The two assays were found to be sensitive and specific. Eubacterial PCR assay exhibited positive results for 46 clinical isolates from which 43 samples were detected by real time PCR assay. The sensitivity of the assay is about 93.7% in blind test isolates. The P...
Broad-Range PCR for Detection and Identification of Bacteria
Molecular Microbiology
Broad-range PCR is based on the recognition that there are a number of broadly conserved molecules across a range of many different organisms. rRNA genes, for example, are present in all cellular forms of life, namely the domains Bacteria, Archaea, and Eukarya (163). rRNA genes possess highly conserved regions that are suitable as sites for PCR primers that recognize large, diverse groups of organisms (e.g., all members of the Bacteria) and possess variable regions that provide distinct signatures for identification at phylogenetic levels below the level initially targeted by the primers. Commonly, broad-range PCR are aimed at members of the domain Bacteria, although broad-range PCRs have also been developed for other large relevant groups of organisms or combinations of such groups. For example, broad-range PCRs may target Eukarya (91, 119), Archaea (1, 4, 143), Eukarya and Archaea (10), fungi (70, 130, 159), or fungi and protists (44). Fungal broad-range PCRs are often termed panfungal PCRs in the medical literature. Below the level of broad groups of organisms, PCRs may be constructed to target organisms at various other phylogenetic levels; for example, within the Bacteria it is possible to design phylum-, family-, or genus-specific PCRs, depending on the availability of phylogenetically informative signature sequences. The strength of broad-range PCR for diagnostic microbiology lies in the relative absence of selectivity, assuming little or no prior knowledge of an infecting organism, so that-in principle-any bacterium (in the case of bacterial assays) can be detected and identified. This is an area of analogy to the detection by culture and is in contrast to typical organism-specific PCR assays. The aim of most broad-range PCRs is to amplify as broadly as possible within the domain Bacteria and, at the same time, to obtain sufficient portions of variable sequence for identification. Not all broadly conserved mol
Cited by
Applied microbiology and biotechnology, 2012
Presently, 2 to 4 days elapse between sampling at infection suspicion and result of microbial diagnostics. This delay for the identification of pathogens causes quite often a late and/or inappropriate initiation of therapy for patients suffering from infections. Bad outcome and high hospitalization costs are the consequences of these currently existing limited pathogen identification possibilities. For this reason, we aimed to apply the innovative method multi-capillary column–ion mobility spectrometry (MCC-IMS) for a fast identification of human pathogenic bacteria by determination of their characteristic volatile metabolomes. We determined volatile organic compound (VOC) patterns in headspace of 15 human pathogenic bacteria, which were grown for 24 h on Columbia blood agar plates. Besides MCC-IMS determination, we also used thermal desorption–gas chromatography–mass spectrometry measurements to confirm and evaluate obtained MCC-IMS data and if possible to assign volatile compounds to unknown MCC-IMS signals. Up to 21 specific signals have been determined by MCC-IMS for Proteus mirabilis possessing the most VOCs of all investigated strains. Of particular importance is the result that all investigated strains showed different VOC patterns by MCC-IMS using positive and negative ion mode for every single strain. Thus, the discrimination of investigated bacteria is possible by detection of their volatile organic compounds in the chosen experimental setup with the fast and cost-effective method MCC-IMS. In a hospital routine, this method could enable the identification of pathogens already after 24 h with the consequence that a specific therapy could be initiated significantly earlier.
Extracellular electron uptake by two Methanosarcina species
Direct electron uptake by prokaryotes is a recently described mechanism with a potential application for energy and CO2 storage into value added chemicals. Members of Methanosarcinales, an environmentally and biotechnologically relevant group of methanogens, were previously shown to retrieve electrons from an extracellular electrogenic partner performing Direct Interspecies Electron Transfer (DIET) and were therefore proposed to be electroactive. However, their intrinsic electroactivity has never been examined. In this study, we tested two methanogens belonging to Methanosarcina, M. barkeri and M. horonobensis, regarding their ability to accept electrons directly from insoluble electron donors like other cells, conductive particles and electrodes. Both methanogens were able to retrieve electrons from Geobacter metallireducens via DIET. Furthermore, DIET was also stimulated upon addition of electrically conductive granular activated carbon (GAC) when each was co-cultured with G. meta...
Microbial Colonization of the Salt Deposits in the Driest Place of the Atacama Desert (Chile)
Origins of Life and Evolution of Biospheres, 2012
The Atacama Desert (Chile), one of the most arid places on Earth, shows hostile conditions for the development of epilithic microbial communities. In this study, we report the association of cyanobacteria (Chroococcidiopsis sp.) and bacteria belonging to Actinobacteria and Beta-Gammaproteobacteria and Firmicutes phyla inhabiting the near surface of salt (halite) deposits of the Salar Grande Basin, Atacama Desert (Chile). The halite deposits were investigated by using optical, confocal and field emission scanning electron microscopes, whereas culture-independent molecular techniques, 16S rDNA clone library, alongside RFLP analysis and 16S rRNA gene sequencing were applied to investigate the bacterial diversity. These microbial communities are an example of life that has adapted to extreme environmental conditions caused by dryness, high irradiation, and metal concentrations. Their adaptation is, therefore, important in the investigation of the environmental conditions that might be expected for life outside of Earth.
Genomic insight into pathogenicity of dematiaceous fungus Corynespora cassiicola
PeerJ, 2017
Corynespora cassiicola is a common plant pathogen that causes leaf spot disease in a broad range of crop, and it heavily affect rubber trees in Malaysia (Hsueh, 2011; Nghia et al., 2008). The isolation of UM 591 from a patient's contact lens indicates the pathogenic potential of this dematiaceous fungus in human. However, the underlying factors that contribute to the opportunistic cross-infection have not been fully studied. We employed genome sequencing and gene homology annotations in attempt to identify these factors in UM 591 using data obtained from publicly available bioinformatics databases. The assembly size of UM 591 genome is 41.8 Mbp, and a total of 13,531 (≥99 bp) genes have been predicted. UM 591 is enriched with genes that encode for glycoside hydrolases, carbohydrate esterases, auxiliary activity enzymes and cell wall degrading enzymes. Virulent genes comprising of CAZymes, peptidases, and hypervirulence-associated cutinases were found to be present in the fungal ...
Microarrays, 2011
Reliable and sensitive pathogen detection in clinical and environmental (including food and water) samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i) specificity; (ii) sensitivity; (iii) multiplexing potential; (iv) robustness; (v) speed; (vi) automation potential; and (vii) low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples.
2021
ABSTRACTMicrobial communities inhabiting extreme environments like Salar de Huasco (SH) are adapted to thrive while exposed to several abiotic pressures and the presence of toxic elements like arsenic (As). Hence, we aimed to uncover the role of arsenic in shaping bacterial composition, structure, and functional potential in five different sites in this Altiplanic wetland using a shotgun metagenomic approach. The sites exhibit wide gradients of arsenic (9 to 321 mg/kg), and our results showed highly diverse communities and a clear dominance exerted by the Proteobacteria and Bacteroidetes phyla. Functional potential analyses showed broadly convergent patterns, contrasting with their great taxonomic variability. Arsenic-related metabolism is different among the five communities, as well as other functional categories like those related to the CH4 and S cycles. Particularly, we found that the distribution and abundance of As-related genes increase, following along the As concentration ...
Virulence and transcriptome profile of multidrug-resistant Escherichia coli from chicken
Scientific reports, 2017
Numerous studies have examined the prevalence of pathogenic Escherichia coli in poultry and poultry products; however, limited data are available regarding their resistance- and virulence-associated gene expression profiles. This study was designed to examine the resistance and virulence of poultry E. coli strains in vitro and in vivo via antibiotic susceptibility, biofilm formation and adhesion, and invasion and intracellular survivability assays in Caco-2 and Raw 264.7 cell lines as well as the determination of the median lethal dose in two-day old chickens. A clinical pathogenic multidrug-resistant isolate, E. coli 381, isolated from broilers, was found to be highly virulent in cell culture and 1000-fold more virulent in a chicken model than other strains; accordingly, the isolate was subsequently selected for transcriptome analysis. The comparative gene expression profile of MDR E. coli 381 and the reference human strain E. coli ATCC 25922 was completed with Illumina HiSeq. 2500...
Nature Communications, 2020
Group A Streptococcus (GAS) infection causes a range of diseases, but vaccine development is hampered by the high number of serotypes. Here, using reverse vaccinology the authors identify SPy_2191 as a cross-protective vaccine candidate. From 18 initially identified surface proteins, only SPy_2191 is conserved, surface-exposed and inhibits both GAS adhesion and invasion. SPy_2191 immunization in mice generates bactericidal antibodies resulting in opsonophagocytic killing of prevalent and invasive GAS serotypes of different geographical regions, including M1 and M49 (India), M3.1 (Israel), M1 (UK) and M1 (USA). Resident splenocytes show higher interferon-γ and tumor necrosis factor-α secretion upon antigen re-stimulation, suggesting activation of cell-mediated immunity. SPy_2191 immunization significantly reduces streptococcal load in the organs and confers ~76-92% protection upon challenge with invasive GAS serotypes. Further, it significantly suppresses GAS pharyngeal colonization ...
Journal of Molecular Catalysis B: Enzymatic, 2013
The LAC4 gene of Kluyveromyces lactis encoding for -galactosidase was overexpressed in the yeast Arxula adeninivorans to produce the enzyme, which can be used for the synthesis of -d-galactosides. These compounds play a major role as precursors for the synthesis of glycolipids and glycoproteins in medicine or for the production of tensides. The Xplor ® 2 transformation/expression platform was used because it enabled stable integration of the gene in the Arxula genome and the production of high levels of the enzyme. The recombinant -galactosidase, fused with C-terminal His-tag region (Lac4-6hp), was purified by precipitation with ammonium sulphate and FPLC using hydroxylapatite. The enzyme exhibited optimal activity at 37 to 40 • C, pH 6.5 in 50 mM sodium acetate buffer. Activity was measured by the formation of p-nitrophenol at 405 nm from the hydrolyzed chromogenic substrate, p-nitrophenyl--d-gal. Biochemical characterization included the calculation of K M and apparent k cat values of the enzyme. The formation of benzyl -d-gal by 0.1 U enzyme from A. adeninivorans with transgalactosylation was six times higher than that for the prokaryotic enzyme from E. coli. Moreover, the partially purified enzyme was used for the selective hydrolysis of allyl -d-gal in a mixture of allyl and allyl ␣-d-gal, with 4 g l −1 being hydrolysed within one day by 1 U ml −1. Thus, the recombinant -galactosidase produced in A. adeninivorans is of potential interest for the enzymatic synthesis of benzyl -d-gal and other galactosides as well as the selective hydrolysis of anomeric mixtures and could be used to replace difficult chemical procedures.
Analysis of microbial communities in heavy metals-contaminated soils using the metagenomic approach
Ecotoxicology, 2018
Soil pollution occurring at mining sites has adverse impacts on soil microbial diversity. New approaches, such as metagenomics approach, have become a powerful tool to investigate biodiversity of soil microbial communities. In the current study, metagenomics approach was used to investigate the microbial diversity of soils contaminated with different concentrations of lead (Pb) and zinc (Zn). The contaminated soils were collected from a Pb and Zn mine. The soil total DNA was extracted and 16S rDNA genes were amplified using universal primers. The PCR amplicons were sequenced and bioinformatic analysis of metagenomes was conducted to identify prokaryotic diversity in the Pb-and Zn-contaminated soils. The results indicated that the ten most abundant bacteria in all samples were Solirubrobacter (Actinobacteria), Geobacter (Proteobacteria), Edaphobacter (Acidobacteria), Pseudomonas (Proteobacteria), Gemmatiomonas (Gemmatimonadetes), Nitrosomonas, Xanthobacter, and Sphingomonas (Proteobacteria), Pedobacter (Bacterioidetes), and Ktedonobacter (Chloroflexi), descendingly. Archaea were also numerous, and Nitrososphaerales which are important in the nitrogen cycle had the highest abundance in the samples. Although, alpha and beta diversity showed negative effects of Pb and Zn contamination on soil microbial communities, microbial diversity of the contaminated soils was not subjected to a significant change. This study provided valuable insights into microbial composition in heavy metals-contaminated soils.