Frameshift mutation - Definition and Examples - Biology Online Dictionary (original) (raw)

Frameshift mutation
n., plural: frameshift mutations
[ˈfreɪmˌʃɪft mjuˈteɪʃən]
Definition: a gene mutation resulting in a shift in the reading frame of the codons
Table of Contents
Toggle
- Define Frameshift Mutation
- What Causes a Frameshift Mutation?
- Types of Frameshift Mutations
- Effects of Frameshift Mutations
- The Genetic Code
- Discovery of the Genetic Code
- Frameshift Mutation Examples
- Frameshift Mutation Diseases
- Point Mutation vs. Frameshift Mutation
- Quiz
- References
What is a frameshift mutation? In biology, insertions or deletions of nucleotides in the coding region resulting in an altered sequence of amino acids at the translation of the codons are known as frameshift mutations. This type of mutation may result in phenotypic changes, for instance, the production of an altered protein.
What Causes a Frameshift Mutation?
In a nucleic acid (e.g. DNA), the nucleotides may be “_read_” in groups of non-overlapping, consecutive triplets referred to altogether as a reading frame. During translation, triplets (or codons) in a reading frame are translated into specific amino acids (or a codon signal). Thus, if a mutation, for example, an insertion or a deletion of the nucleotide, occurs, this could result in the alteration of the reading frame. It completely changes the amino acid sequence. Such mutations are known as frameshift mutation (also called reading frame mutation, reading frame shift, or framing error).

Figure 1. Frameshift mutation wherein deletion of CG alters the amino acid sequence. Source: Maria Victoria Gonzaga of Biology Online, modified diagram of Thomas Splettstoesser, CC BY-SA 4.0.
Biology definition:
A frameshift mutation is a type of gene mutation in which the addition or deletion of one or more nucleotides causes a shift in the reading frame of the codons in the mRNA, which may lead to the alteration in the amino acid sequence at protein translation. Variant: frame shift mutation. Synonyms: reading frame mutation, reading frame shift, or framing error. Compare: base-pair substitution
You may be wondering, why are insertions and deletions called frameshift mutations? In the diagram above (Figure 1), notice how the insertion/deletion mutations (or indels) that are not in the multiples of three disrupted the reading frame and thus leads to a frameshift mutation. An incorrect amino acid has been formed by the deletion of two nucleotides, which in the above figure are the nucleotides with bases, cytosine (C) and guanine (G). Arginine (arg) has been replaced by glutamate (glu). (See Figure 2 for the amino acid code)

Figure 2: The codon table of the mRNA and amino acid sequence chart. Credit: Scott Henry Maxwell, CC BY-SA 4.0.
The addition or deletion of the nucleotides in the multiples of three, however, will not alter the reading frame. Thus, the protein in such cases would likely have either an extra or missing amino acid.
So, what occurs during frameshift mutation?
Usually, frameshift mutations occur as caused by a mutational error during DNA repair or replication. They can also occur by exposure to acridine dyes, which are capable of inducing frameshift mutations.
Due to insertion or deletion (also referred to as indels) of the nucleotide, the reading frame of the nucleotide sequence changes; however, the implication of these mutations depends on where they occur. The addition or deletion of a nucleotide can occur at the interstitial or intercalary position.
In some instances, the addition and the deletion of nucleotides occur simultaneously (known as double frameshift), which eventually restore the reading frame to normal.
The outcome of the frameshift mutation may be a complete loss of protein structure and functionality, resulting in the non-functional polypeptide. However, the effect of the mutation at the phenotypic level will be determined by the resulting codons, _post_-mutation, and the mutation position.
The resultant codons after frameshift mutations can be of three types:
- Sense codons: these are codons that are read in the same manner as before frameshift mutation.
- Missense codons: these are the codons that result in an incorrect amino acid or a different amino acid formation.
- Non-sense codons: these are the codons for which there is no corresponding tRNA, resulting in the truncation of the translation process.
Hence, frameshift mutations result in an abnormal or defective protein product containing an improper sequence of amino acids. Depending upon the location of the mutation, such proteins may be wholly new or non-usable. Frameshift mutation can also result in the stop codon. This occurrence of the premature stop codon on mRNA will terminate the translation process, thereby, resulting in a short-length polypeptide.
Depending on the extent and nature of frameshift mutation, the protein may either be shorter or longer in comparison to the normal protein. Such mutation can occur either spontaneously or due to environmental stimuli.
An interesting fact is that frameshift mutations generally occur in the Adenine-Thymine (AT)-rich regions of the nucleic acid.
Types of Frameshift Mutations
Frameshift mutations can occur either by deleting or inserting the nucleotide in the nucleic acid (Figure 3). Deletion frameshift mutation, wherein one or more nucleotides are deleted in a nucleic acid, resulting in the alteration of the reading frame, i.e., reading frameshift, of the nucleic acid. Deletion is a more common mechanism for inducing the frameshift mutation that results in an altered reading frame. This mutation is also referred to as (+)1 frameshift mutation. Insertion frameshift mutation, wherein one or more nucleotides are added to the base sequence of the nucleic acid, which results in the change in the reading frame. The severity of this type of frameshift mutation is dependent on the number of nucleotides and the position of insertion of nucleotides. This mutation is also referred to as (-)1 frameshift mutation.

Figure 3: Understanding frameshift mutation that may occur due to insertion or deletion of the nucleotide in the normal nucleotide sequence. Credit: US National Library of Medicine.
Effects of Frameshift Mutations
Frameshift mutations can result in:
- The altered coding sequence of a protein may be non-usable or a completely new protein. As a consequence, various biochemical processes may disrupt.
- Abrupt termination of the translation process results in non-usable protein, which further affects the associated physiological processes.
- The frameshift mutation can also result in dysregulation of the cellular translational process. The absence of the formation of functional protein due to frameshift mutation may instigate the cellular machinery to compensate for the error by upregulating the expression of the mutated gene. This can result in dysregulated translation machinery of the cell. As a result, the formation of a large number of misfolded proteins could occur and that could be lethal for a cell.
- However, the altered protein could also be beneficial and could provide protection as observed in HIV patients due to frameshift mutation in the chemokine receptor gene (CCR5).
- Crohn’s disease, cystic fibrosis, and certain types of cancer are due to frameshift mutations.
The Genetic Code
All the genetic information on the RNA and DNA is encoded in the nucleotides. This genetic code is present as a three nucleotides sequence. Each triplet of the nucleotide is eventually translated to form specific proteins required for various life processes. The conversion of this genetic code to protein occurs in two essential steps (Figure 4)

Figure 4: The schematic diagram of protein synthesis.
1. Transcription: herein, the genetic information written on the DNA “_rewritten_” on an RNA.
2. Translation: herein, the transcribed RNA “_translated_” into a specific amino acid sequence that eventually forms a polypeptide or protein chain.
Discovery of the Genetic Code
The transmission of genetic traits in initial genetic experiments by Gregor Mendel indicated that genetic information is carried from one generation to another in some discrete physical and chemical entity. Later, amino acids were thought to be the carriers of genetic information. However, scientists such as Francis Crick, Sydney Brenner, Leslie Barnett, and Richard Watts-Tobin discovered the codons or the triplets on the DNA sequence. Marshall Nirenberg, Heinrich J. Matthaei, and Har Gobind Khorana (1961-1964) revealed the nature of a codon and deciphered the codons.
Reading frames and triplet codon
The whole-genome sequence is divided into consecutive, non-overlapping sequences of three nucleotides. The triplet codon that initiates the translation process defines the reading frame. Each triplet of the nucleotide encodes a specific amino acid or a stop signal known as a codon. There are 64 codon combinations that encode 20 amino acids. However, out of these 64 codons, three are the stop codons; thus, 61 codons code for amino acids and three codons for the termination of the translation process (i.e., 61 codons amino acid + 3 stop codons= 64 codons).
Some typical features of a codon are as follows:
- Upon translation each codon codes for a specific amino acid
- AUG codon encodes the initiation of the amino acid synthesis and for methionine as well.
- UAG, UGA, and UAA are the three “_stop_” codons that terminate the amino acid synthesis.
- Codons are universal.
- The translation process is initiated with a start codon and is continued until the stop codon comes up on mRNA. The mRNA is encoded from 5’ to 3’, and it translates to an amino acid in a protein from N-terminus (methionine) to C-terminus.

Figure 5: Representation of start and stop codon in the process of protein translation. Credit: petersbiology.
Ribosome translocation
Each codon is translated from an mRNA to an amino acid. These amino acids are then joined together by the ribosomes in a process known as ribosome translocation. Synthesis of protein is a cyclic process wherein, after joining one amino acid to the growing chain of the polypeptide, the ribosome moves forward by three bases (i.e. one codon) (Figure 6). The movement of ribosomes has disproportionate effects on protein or polypeptide function.

Figure 6: Ribosomal translocation during protein elongation. Credit: Knight, J. R. P., et al. (2020).
Frameshift Mutation Examples
Let us understand frameshift mutation with an example of a base sequence in RNA that codes as below:AUG-AAT-AAC-GCU = start-leucine- asparagine-alanine
In case mutation occurs in the above sequence and an A nucleotide is added or inserted after the start codon AUG. This will completely change the reading frame to:
AUG-AAA-TAA-CGC = start-lysine- isoleucine- alanine
Thus, we can see, the addition of only a single nucleotide in the RNA sequence completely altered the base sequence that resulted in the formation of completely different amino acids during the translation process.
More Examples
The reading frame of any mRNA is the coding sequence for a given polypeptide and is read continuously from the start codon AUG to one of the three stop codons. In translation, the ribosome moves down the mRNA three bases at a time and reads whatever codons follow the start codon. Adding or subtracting one or two bases (or any other number that is not a multiple of 3) can disrupt the normal reading frame and lead to the production of a completely nonfunctional protein. Frame shifts may also accidentally introduce an early stop codon.
Original coding sequence: atggtgcatctgactcctgaggagaagtct
Amino acid translation: M V H L T P E E K S
Frameshift (remove underlined at): atggtgcctgactccTGAggagaagtct
Amino acid translation: M V P D S * G E V X
(* = termination at the TGA stop codon generated)
Frameshift Mutation Diseases
Mutations are a source of variation; however certain mutations can be deleterious and results in a disease condition. Some of the known diseases that are caused due to frameshift mutations are-
- Tay-Sachs disease: A frameshift mutation in the gene Hex-A results in Tay-Sachs disease. The absence of Hex-A results in abnormal accumulation of lipids in the brain. The accumulated lipids eventually damage the neurons lethally. This disease is fatal.
- Cystic fibrosis: Two frameshift mutations (one is the insertion of two nucleotides and the other deletion of one nucleotide) in the CFTR genes result in cystic fibrosis. The CFTR gene regulates the proper flow of ions, i.e., chloride and sodium, across the cell membranes of lungs and other organs. Frameshift mutation results in malfunctioning organs, persistent lung infections, and destruction of the pancreas in cystic fibrosis.
- Leigh disease: Frameshift mutation in the NADH dehydrogenase (ubiquinone) Fe-S protein 4 (NDUFS4) gene results in Leigh disease. Leigh disease is a mitochondrial mutational disease characterized by infantile-onset and progressive neurodegenerative disorder. Herein, the patient suffers from feeding difficulties, hypotonia, seizures, central respiratory compromise, and failure to thrive.
- Type A Niemann-Pick disease: Frameshift mutation in the acid sphingomyelinase gene (fsP330) has been implicated to be cause for Type A Niemann-Pick disease.
- Crohn’s disease: Frameshift mutation in the NOD2 gene results in susceptibility for Crohn’s disease. Cytosine insertion (3020insC) results in the truncated protein NOD2 that is implicated in Crohn’s disease.
- Certain cancers: frameshift mutation may lead to cancerous conditions, such as lung cancer, colorectal cancer, and hereditary breast, ovarian cancer, and pancreatic cancer.
- Hypertrophic cardiomyopathy: hypertrophic cardiomyopathy is one of the leading causes of abrupt mortality in young adults. Hypertrophic cardiomyopathy is a genetic disorder of cardiac myocytes. A frameshift mutation in Troponin C (c.363dupG or p.Gln122AlafsX30) results in hypertrophic cardiomyopathy.
- Smith–Magenis syndrome: this is a rare multiple congenital anomaly or mental retardation disorder that occurs due to interstitial deletion in the retinoic acid-induced 1 (RAI1) gene. Such patients exhibit mental retardation, craniofacial and skeletal anomalies, speech and developmental delay, distinctive behavioral features, and sleep disturbance.
- Hereditary polyneuropathy: hereditary polyneuropathy is caused by dominant-negative frameshift mutation of the LRSAM1 gene.
Effects of frameshift mutation: Frameshift mutations may be beneficial, deleterious, or lethal. For example, induction of frameshift mutation has been used to make certain bacteria capable of producing nylonase, an enzyme that can degrade nylon. Some cases of albinism have been attributed to the early termination of any of the enzymes necessary for the production of melanin. Tay Sachs disease is caused by various mutations, including frameshift mutations, in the HEXA gene, a gene on chromosome 15 that codes for the alpha-subunit of the lysosomal enzyme beta-N-acetylhexosaminidase A.
Point Mutation vs. Frameshift Mutation
Let us compare and understand the difference between point mutation and frameshift mutation. In point mutation, one base is replaced by another base in the nucleotide sequence. Thus, the sequence of the nucleotide or the reading frame of the nucleic acid remains unchanged. Due to this reason, point mutation is also known as single base substitution. The point mutation can be – transition and transversion. DNA is made up of purines and pyrimidines. Transition point mutation occurs when a purine base is substituted into another purine base whereas transversion occurs when a pyrimidine or vice versa substitutes a purine base.
In the case of frameshift mutation insertion or deletion of the base, it results in a modification in the reading frame of the nucleotide in a nucleic acid. Further differences between point mutation and frameshift mutation are enlisted in the table below.
| Table 1: Point mutation vs Frameshift mutation | |
|---|---|
| Point mutation | Frameshift mutation |
| Replacement of one base pair by another base pair in the nucleic acid | Insertion or deletion of base pairs in the nucleic acid |
| Change occurs only in a single nucleotide | Multiple nucleotide alterations can occur |
| The sequence of the nucleotide is not altered, i.e., the reading frame remains unaffected | The sequence of the nucleotide changes that eventually alters the reading frame |
| Only substitution of the base occurs in this mutation | Insertion or deletion of the base pair occurs in this type of mutation |
| Structure of the gene changes | Number of nucleotides in the gene changes |
| Two types- Transition and transversion | Two types- insertion and deletion |
| Sickle cell anaemia disease is caused by point mutation | Tay-Sachs disease is caused due to frameshift mutation |
Learn more about Mutations:
- Genetic Mutations – Biology Online Tutorial
- Chromosome Mutations – Biology Online Tutorial
- Polyploidy – Biology Online Tutorial
Based on the above details, let us attempt to answer a few questions by answering the quiz below.
References
- Lamont, R. E., Beaulieu, C. L., Bernier, F. P., Sparkes, R., Innes, A. M., Jackel-Cram, C., Ober, C., Parboosingh, J. S., & Lemire, E. G. (2017). A novel NDUFS4 frameshift mutation causes Leigh disease in the Hutterite population. American journal of medical genetics. Part A, 173(3), 596–600. https://doi.org/10.1002/ajmg.a.37983
- Iannuzzi, M. C., Stern, R. C., Collins, F. S., Hon, C. T., Hidaka, N., Strong, T., Becker, L., Drumm, M. L., White, M. B., & Gerrard, B. (1991). Two frameshift mutations in the cystic fibrosis gene. American journal of human genetics, 48(2), 227–231.
- Levran, O., Desnick, R. J., & Schuchman, E. H. (1993). Type A Niemann-Pick disease: a frameshift mutation in the acid sphingomyelinase gene (fsP330) occurs in Ashkenazi Jewish patients. Human mutation, 2(4), 317–319. https://doi.org/10.1002/humu.1380020414
- Streisinger, G., & Owen, J. (1985). Mechanisms of spontaneous and induced frameshift mutation in bacteriophage T4. Genetics, 109(4), 633–659.
©BiologyOnline.com. Content provided and moderated by Biology Online Editors.