A genome-wide microRNA screen identifies the microRNA-183/96/182 cluster as a modulator of circadian rhythms - PubMed (original) (raw)
A genome-wide microRNA screen identifies the microRNA-183/96/182 cluster as a modulator of circadian rhythms
Lili Zhou et al. Proc Natl Acad Sci U S A. 2021.
Erratum in
- Correction for Zhou et al., A genome-wide microRNA screen identifies the microRNA-183/96/182 cluster as a modulator of circadian rhythms.
[No authors listed] [No authors listed] Proc Natl Acad Sci U S A. 2025 Jan 7;122(1):e2424179121. doi: 10.1073/pnas.2424179121. Epub 2024 Dec 20. Proc Natl Acad Sci U S A. 2025. PMID: 39705320 Free PMC article. No abstract available.
Abstract
The regulatory mechanisms of circadian rhythms have been studied primarily at the level of the transcription-translation feedback loops of protein-coding genes. Regulatory modules involving noncoding RNAs are less thoroughly understood. In particular, emerging evidence has revealed the important role of microRNAs (miRNAs) in maintaining the robustness of the circadian system. To identify miRNAs that have the potential to modulate circadian rhythms, we conducted a genome-wide miRNA screen using U2OS luciferase reporter cells. Among 989 miRNAs in the library, 120 changed the period length in a dose-dependent manner. We further validated the circadian regulatory function of an miRNA cluster, miR-183/96/182, both in vitro and in vivo. We found that all three members of this miRNA cluster can modulate circadian rhythms. Particularly, miR-96 directly targeted a core circadian clock gene, PER2. The knockout of the miR-183/96/182 cluster in mice showed tissue-specific effects on circadian parameters and altered circadian rhythms at the behavioral level. This study identified a large number of miRNAs, including the miR-183/96/182 cluster, as circadian modulators. We provide a resource for further understanding the role of miRNAs in the circadian network and highlight the importance of miRNAs as a genome-wide layer of circadian clock regulation.
Keywords: circadian rhythms; genome-wide screen; miR-183/96/182 cluster; miRNA.
Conflict of interest statement
Competing interest statement: S.A.K. and C.B.G. are coauthors on a 2017 Guidelines article.
Figures
Fig. 1.
A cell-based genome-wide screen for miRNA modifiers of circadian rhythms. (A) A schematic diagram of the genome-wide miRNA screen. Bmal1-dLuc and Per2-dLuc reporter cells were transfected with miRNAs in 384-well plates. Bioluminescence was recorded and analyzed to obtain circadian parameters and select candidate hits. Validation was performed by measuring the dose-dependent effects of some candidate miRNAs on circadian phenotypes. (B) Distribution of circadian period lengths of the screen. The histogram shows a tail toward the long period. Gray dots in the bottom panel represent normalized period lengths. The period length of each well was divided by the negative control and indicated in Log2 space. The cutoff was −0.1 and +0.1 (red lines). Values above 0.5 (black dash line) were considered outliers. (C) Representative bioluminescence profiles for dose-dependent phenotypic validation of negative control, short-period positive control (siNR1D1), and long-period positive control (siCRY2). (D) Short-period candidate hits (miR-433, miR-365a-3p) and (E) long-period candidate hits (miR-1296-5p, miR-17). (F) The dose–response curve of the indicated candidate miRNAs and control RNAs. (G) The period length parameters of the indicated candidate miRNAs and control RNAs. Per2-dLuc U2OS cells were transfected with the indicated amount of miRNAs (six 4-fold dilution series from 0.039 to 40 nM/well). Data represent the mean ± SD (n = 4).
Fig. 2.
The cluster of miR-183/96/182 altered the circadian period length and amplitude at the cellular level. (A) Schematic diagram showing the miR-183/96/182 cluster on the chromosome. Members of the miR-183/96/182 cluster locate on the same chromosome and are cotranscribed through the same promoter. The gray blocks represent the primary miRNA. The inside color boxes (blue, green, and red) represent the sequences for miR-183-5p, miR-96-5p, and miR-182-5p, respectively. (B) The sequences of mature miRNA for members of the miR-183/96/182 cluster in human and mouse. The red region represents the seed region of each miRNA, which exhibits high similarity. (C) Representative bioluminescence profiles of U2OS Per2-dLuc reporter cells which were transfected with 10 nM synthetic miRNA mimics of each member of the miR-183/96/182. (D) The dose-dependent effects of members of the miR-183-/96/182 cluster on period length. U2OS Per2-dLuc reporter cells were transfected with the indicated amount of miRNAs (five 2-fold dilution series from 2.5 to 40 nM/well). The data represent the mean ± SD (n = 4). (E) Knockout of each member of the miR-183/96/182 cluster using a CRISPR-Cas9 approach. For each miRNA, the “wt” sequence represents the sequence of wild-type primary miRNA, and the “mt” sequence represents the mutant sequence of primary miRNA after deletion. The colored sequences (blue, green, and red) represent the 5′ miRNA, and the black sequences represent the 3′ miRNA. Deletions are marked by dashes. (F) The mature miRNA expression levels detected by qPCR confirmed the complete deletion of each miRNA. (G) Representative bioluminescence profiles for each CRISPR miRNA deletion cell line. (H) Period lengths of CRISPR miRNA deletion cell lines. (I) Amplitude of CRISPR miRNA deletion cell lines. Data represent the mean ± SEM (n = 3), *P < 0.05.
Fig. 3.
Circadian behaviors were altered in the miR-183/96/182 cluster–deficient mice. (A_–_C) Representative wheel-running locomotor activity profiles of homozygous wild-type, heterozygous, and homozygous gene-trap mice (miR-183C +/+, n = 14; miR-183C GT/+, n = 22; miR-183C GT/GT, n = 10). Animals were maintained on LD12:12 entrained conditions for the first week, indicated by the yellow filled and open area in the records, and then were released to constant darkness (DD) for 3 wk to measure free-running periods. (D) Diurnal wheel-running activity profiles under the entrained condition. Wheel-running activities were normalized to the highest activity level of each animal and then averaged across 7 d prior to DD. (E) Free-running periods under constant darkness. The free-running period of heterozygous mice was significantly shorter than that of wild-type mice (t test: *P = 0.004). The miR-183C GT/GT mice became arrhythmic (AR) after release into DD. (F) Beam-break total activities of homozygous wild-type and gene-trap mice (miR-183C +/+, n = 4; miR-183C GT/GT, n = 4). Animals were maintained on LD12:12 for the first 7 d, indicated by the gray and white shading, and then released to DD for 14 d. The red and black curves denote the mean activities of mutant mice and wild-type mice, respectively. The light red and light gray vertical lines denote the SD of the mean activities of mutant mice and wild-type mice, respectively. (G) Circadian periodicity of the beam-break total activity DD condition was detected by Lomb–Scargle periodogram. Activity of miR-183C GT/GT in the second week of DD did not pass the threshold for period detection. PN on y-axis stands for normalized power. (H) Diurnal beam-break total activity profiles under the entrained condition. Activities were normalized to the highest activity level of each animal and then averaged across 7 d prior to DD. Data represent the mean ± SD.
Fig. 4.
The circadian phenotype of the miR-183/96/182 cluster was tissue-specific. The miR-183/96/182 cluster altered the circadian period length, amplitude, and phase in the retina (A_–_D), SCN (E_–_H), and lung (I_–_L) from Per2::Luc mice carrying homozygous wild-type or homozygous gene-trap alleles (miR-183C +/+, n = 14∼23; miR-183C GT/GT, n = 12∼19). Animals were maintained under an LD12:12 entrained condition before dissection. Tissue dissection was performed 2–3 h before lights off, and the tissue was immediately cultured for recording for 1 wk. Representative bioluminescence recording profiles of miR-183C +/+ and miR-183C GT/GT are on the Top (A, E, and I). Circadian period length (B, F, and J) and relative amplitude (C, G, and K) were calculated by the linear model fit (damped sin) method. The phase of each tissue (D, H, and L) was represented by the time of peak luminescence on the first day of constant conditions (first day in Lumicycle), *P < 0.05. Data represent the mean ± SD.
Fig. 5.
PER2 was a direct target of miR-96. (A) Sequence alignment between miR-96 and its putative binding sites (blue letters) in the PER2-3′ UTR. Red letters indicate canonical seed nucleotides. (B) HEK-293T cells were transfected with a luciferase reporter plasmid containing one of the following sequences: 1) no 3′ UTR; 2) a full-length wild-type PER2-3′ UTR; 3) a full-length PER2-3′ UTR with a targeted deletion at the predicted binding site of miR-96 (1992_2002 del: gcgcgTGCCAA; uppercase is the potential seed-binding site of miR-96); 4) a full-length PER2-3′ UTR with a deletion in a sequence (1712_1734 del: ttcataaacacaagaacacttta) predicted not to be bound by miR-96, *P < 0.05. (C) PER2 mRNA levels in U2OS cells that transfected with miRNA mimics of each member of the miR-183/96/182 cluster. RNA was sampled 18 h after medium change, every 4 h across 1 d. The mRNA levels were determined by qPCR (n = 3). (D) PER2 mRNA levels in miR-183/96/182 cluster knockout cells. RNA from U2OS cells with the deletion of each member of the miR-183/96/182 cluster was harvested 12 h after medium change, every 4 h across 1 d. The mRNA levels were determined by qPCR (n = 3). Data represent the mean ± SEM (E) U2OS cells were transfected with either control or miR-96 mimics, and PER2 protein levels were analyzed by Western blot 48 h posttransfection. (F) Quantification of PER2 protein band intensity compared with the negative control on Western blot.
References
- Hastings M. H., Maywood E. S., Brancaccio M., Generation of circadian rhythms in the suprachiasmatic nucleus. Nat. Rev. Neurosci. 19, 453–469 (2018). -PubMed
- Patke A., Young M. W., Axelrod S., Molecular mechanisms and physiological importance of circadian rhythms. Nat. Rev. Mol. Cell Biol. 21, 67–84 (2020). -PubMed
- Lim C., Allada R., Emerging roles for post-transcriptional regulation in circadian clocks. Nat. Neurosci. 16, 1544–1550 (2013). -PubMed
Publication types
MeSH terms
Substances
LinkOut - more resources
Full Text Sources
Molecular Biology Databases