(original) (raw)
### R code from vignette source 'DesignProbes.Rnw' ################################################### ### code chunk number 1: DesignProbes.Rnw:46-48 ################################################### options(continue=" ") options(width=80) ################################################### ### code chunk number 2: expr0 (eval = FALSE) ################################################### ## system("hybrid-min -V") ################################################### ### code chunk number 3: startup ################################################### library(DECIPHER) ################################################### ### code chunk number 4: expr1 (eval = FALSE) ################################################### ## # specify the path to your sequence file: ## gb <- "<>" ## # OR find the example sequence file used in this tutorial: ## gb <- system.file("extdata", "Bacteria_175seqs.gen", package="DECIPHER") ################################################### ### code chunk number 5: expr2 (eval = FALSE) ################################################### ## require(RSQLite) ## # specify a path for where to write the sequence database ## dbConn <- "<>" ## # OR create the sequence database in memory ## dbConn <- dbConnect(dbDriver("SQLite"), ":memory:") ## ## # then import the sequences into the database ## Seqs2DB(gb, "GenBank", dbConn, "Bacteria") ################################################### ### code chunk number 6: expr3 (eval = FALSE) ################################################### ## ids <- IdentifyByRank(dbConn, level=Inf, add2tbl=TRUE) ################################################### ### code chunk number 7: expr4 (eval = FALSE) ################################################### ## tiles <- TileSeqs(dbConn, add2tbl="Tiles") ################################################### ### code chunk number 8: expr5 (eval = FALSE) ################################################### ## probes <- DesignProbes(tiles, identifier="Sphingopyxis", ## start=120, end=1450) ################################################### ### code chunk number 9: expr6 (eval = FALSE) ################################################### ## o <- order(probes$score, decreasing=TRUE) ## probes[o[1],] ################################################### ### code chunk number 10: expr7 (eval = FALSE) ################################################### ## ConsensusSequence(DNAStringSet(probes[o[1], "probe"][1:3])) ################################################### ### code chunk number 11: expr8 (eval = FALSE) ################################################### ## FA_range <- 0:70 # [FA] (%, v/v) ## probe <- probes$probe[o[1], 1:3] ## targets <- reverseComplement(DNAStringSet(probe)) ## f <- function(FA) ## CalculateEfficiencyFISH(probe, targets, ## temp=46, P=250e-9, ions=1, FA)[, "HybEff"] ## efficiency <- matrix(unlist(lapply(FA_range, f)), ncol=3, byrow=TRUE) ## matplot(FA_range, efficiency, ylim=c(0,1), ylab="Hybridization Efficiency", ## xlab=expression(paste("[Formamide] (%, v/v)", sep="")), ## type="l", lwd=2, col="Blue", main="Formamide Curve", lty=1) ## ## nontargets <- DNAStringSet(c("AGCGTTTGACATCCTGATCGCGG", ## "AGCTTTTGACATCCCGGTCGCGG")) ## f <- function(FA) ## CalculateEfficiencyFISH(probe[3:2], nontargets, ## temp=46, P=250e-9, ions=1, FA)[, "HybEff"] ## efficiency <- matrix(unlist(lapply(FA_range, f)), ncol=2, byrow=TRUE) ## matlines(FA_range, efficiency, col="Red", lwd=2, lty=3) ## ## abline(h=0.5, lty=2, lwd=2, col="Orange") ## abline(v=35, lty=2, lwd=2, col="Green") ## legend("topright", legend=c("Targets", "Non-Targets", "50% Efficiency", ## "Experimental [FA]"), col=c("Blue", "Red", "Orange", "Green"), ## lwd=c(2, 2, 2, 2), lty=c(1, 3, 2, 2)) ################################################### ### code chunk number 12: expr9 (eval = FALSE) ################################################### ## dbConn_ref <- dbConnect(dbDriver("SQLite"), "<>") ## # select the most common k-mers ## ref_tiles <- dbGetQuery(dbConn_ref, ## "select * from Tiles where groupCoverage > 0.2 and coverage > 0.01") ## dbDisconnect(dbConn_ref) ## ref_tiles$id <- paste("ref", ref_tiles$id, sep="_") ################################################### ### code chunk number 13: expr10 (eval = FALSE) ################################################### ## seqs <- DNAStringSet(ref_tiles$target_site) ## w <- which(!is.na(t(probes$probe))) ## probes_rc <- reverseComplement(DNAStringSet(t(probes$probe)[w])) ## p <- PDict(probes_rc, tb.start=1, tb.width=5) ## hits1 <- vwhichPDict(p, seqs, max.mismatch=5) ## l <- vapply(hits1, length, integer(1)) ## hits1 <- unlist(hits1, use.names=FALSE) ## names(hits1) <- rep(1:length(l), l) ## p <- PDict(probes_rc, tb.end=-1, tb.width=5) ## hits2 <- vwhichPDict(p, seqs, max.mismatch=5) ## l <- vapply(hits2, length, integer(1)) ## hits2 <- unlist(hits2, use.names=FALSE) ## names(hits2) <- rep(1:length(l), l) ## hits <- c(hits1, hits2) ################################################### ### code chunk number 14: expr11 (eval = FALSE) ################################################### ## Hyb_FA <- 35 # the default Hybridization [FA] (%; v/v) ## count <- 0L ## pBar <- txtProgressBar(style=3) ## for (i in 1:dim(probes)[1]) { ## # for each hit calculate the degree of cross-hybridization ## w <- which(!is.na(probes[i, "probe"])) ## results <- NULL ## for (j in 1:length(w)) { ## count <- count + 1L ## w <- which(hits==count) ## if (length(w) > 0) { ## ns <- as.integer(unique(names(hits[w]))) ## eff <- CalculateEfficiencyFISH(rep(probes$probe[i, j], ## length(ns)), ## ref_tiles$target_site[ns], ## 46, # temperature ## 250e-9, # [Probe] ## 1, # [NA] ## Hyb_FA) ## eff <- cbind(eff, ## data.frame(id=ref_tiles$id[ns], ## probe_rc=toString(probes_rc[count]), ## target=ref_tiles$target_site[ns], ## dFAm=eff[, "FAm"] - Hyb_FA, ## stringsAsFactors=FALSE)) ## results <- rbind(results, eff) ## } ## } ## ## w <- which(results$dFAm > -20) ## if (length(w) > 0) { ## # only record the strongest cross-hybridization in each group ## results <- results[w,] ## u <- unique(results$id) ## keep <- integer() ## for (j in 1:length(u)) { ## w <- which(results$id==u[j]) ## keep <- c(keep, w[which.max(results$dFAm[w])]) ## } ## results <- results[keep,] ## ## # append more non-targets to mismatches ## p <- AlignPairs(results$probe_rc, ## results$target, ## type="sequences", ## verbose=FALSE) ## probes$mismatches[i] <- paste(probes$mismatches[i], ## paste(results$id, ## " (", round(100*results$HybEff, 1), "%,", ## round(results$ddG1, 2), "kcal/mol,", ## round(results$dFAm, 1), "%;", ## substring(reverseComplement(DNAStringSet(p[[1]])), ## 1L), ## "/", substring(p[[2]], 1L), ")", ## sep="", ## collapse=" "), ## sep="") ## ## # score -= 0.2 + 1.2^dFAm ## probes$score[i] <- probes$score[i] - ## sum(ifelse(results$dFAm < -20, 0, 0.2 + ## 1.2^ifelse(results$dFAm > 0, 0, results$dFAm))) ## } ## ## setTxtProgressBar(pBar, i/dim(probes)[1]) ## } ################################################### ### code chunk number 15: expr12 (eval = FALSE) ################################################### ## # the original best scoring probe after searching the comprehensive database ## probes[o[1],] ################################################### ### code chunk number 16: expr13 (eval = FALSE) ################################################### ## # the new best scoring probe after searching the comprehensive database ## o <- order(probes$score, -1*probes$permutations, ## rowSums(as.matrix(probes$coverage[,]), na.rm=TRUE), ## decreasing=TRUE) ## probes[o[1],] ################################################### ### code chunk number 17: expr14 (eval = FALSE) ################################################### ## probes <- DesignProbes(tiles, identifier="Sphingopyxis", ## start=120, end=1450, ## numProbeSets=100) # note numProbeSets > 0 ################################################### ### code chunk number 18: expr15 (eval = FALSE) ################################################### ## dim(probes) # now there are 100 potential probe sets ################################################### ### code chunk number 19: expr16 (eval = FALSE) ################################################### ## numProbeSets <- 100 # number of probe sets to generate ## s <- ifelse(dim(probes)[1] > numProbeSets, numProbeSets, dim(probes)[1]) ## MMs <- strsplit(probes$mismatches[o[1:s]], "mol,", fixed=TRUE) ## ls <- unlist(lapply(MMs, length)) ## ls <- ifelse(ls > 0, ls - 1, 0) ## index <- rep(1:length(ls), ls) ## if (length(index) > 0) { ## MMs <- strsplit(unlist(MMs), "%;", fixed=TRUE) ## MMs <- unlist(strsplit(unlist(MMs), ") ", fixed=TRUE)) ## effs <- as.numeric(MMs[seq(2, length(MMs), 3)]) ## MMs <- MMs[seq(1, length(MMs), 3)] ## MMs <- unlist(strsplit(MMs, " (", fixed=TRUE)) ## MMs <- MMs[seq(1, length(MMs), 2)] ## } ## ## m <- matrix(0, nrow=s, ncol=s, dimnames=list(o[1:s], o[1:s])) # scores ## n <- matrix(0, nrow=s, ncol=s, dimnames=list(o[1:s], o[1:s])) # counts ## for (i in 1:(s - 1)) { ## w1 <- which(index==i) ## if (length(w1)==0) ## next ## for (j in (i + 1):s) { ## w2 <- which(index==j) ## if (length(w2)==0) ## next ## overlap_MMs <- match(MMs[w1], MMs[w2]) ## w <- which(!is.na(overlap_MMs)) ## n[i, j] <- length(w) ## if (length(w) > 0) ## m[i, j] <- sum(tapply(c(effs[w1[w]], effs[w2[overlap_MMs[w]]]), ## rep(1:length(w), 2), ## function(x) return(-1.2^ifelse(min(x) > 0, 0, min(x))))) ## } ## } ################################################### ### code chunk number 20: expr17 (eval = FALSE) ################################################### ## # plot the matrix of dual-probe scores ## m <- m + t(m) # make symmetric ## diag(m) <- probes$score[o[1:s]] ## O <- order(o[1:s]) # unsort ## cols <- colorRamp(rainbow(101, start=0, end=0.35, v=0.9), bias=0.1)(0:100/100)/255 ## cols <- mapply(rgb, cols[, 1], cols[, 2], cols[, 3]) ## image(m[O, O[dim(m)[2]:1]], yaxt='n', xaxt='n', col=cols, ## xlab="Probe #1 Target Site Position", ylab="Probe #2 Target Site Position") ## axis(1, seq(0, 1, 0.01), probes$start[o[1:s]][O[seq(1, s, length.out=101)]]) ## axis(2, seq(1, 0, -0.01), probes$start[o[1:s]][O[seq(1, s, length.out=101)]]) ################################################### ### code chunk number 21: expr18 (eval = FALSE) ################################################### ## # choose the best probe sets ## d <- dimnames(m) ## p <- outer(probes$permutations[o[1:s]], ## probes$permutations[o[1:s]], ## FUN="+") ## c <- -1*outer(rowSums(as.matrix(probes$coverage[o[1:s],]), na.rm=TRUE), ## ifelse(rep(s, s)==1, ## sum(probes$coverage[o[1:s],], na.rm=TRUE), ## rowSums(as.matrix(probes$coverage[o[1:s],]), na.rm=TRUE)), ## FUN="*") ## ss <- -1*outer(probes$score[o[1:s]], ## probes$score[o[1:s]], ## FUN="+") ## # order probes by dual-probe score, permutations, coverage, and individual scores ## o <- order(m + n/5, p, c, ss) # score = 0.2*n + 1.2^dFAm ## j <- 0 ## first <- second <- integer() ## scores <- numeric() ## mismatches <- character() ## for (k in 1:numProbeSets) { ## if ((j + 1) > length(o)) ## break ## for (j in (j + 1):length(o)) { ## w_o <- c((o[j] - 1) %% dim(m)[1] + 1, ## (o[j] - 1)%/% dim(m)[1] + 1) ## f <- as.numeric(d[[1]][w_o[1]]) ## r <- as.numeric(d[[2]][w_o[2]]) ## ## start_F <- probes$start[f] ## start_R <- probes$start[r] ## if (abs(start_F - start_R) > (50 + nchar(probes$probe[f][1]))) ## break # > 50 nt separation ## } ## ## if (abs(start_F - start_R) > (50 + nchar(probes$probe[f][1]))) { ## first <- c(first, f) ## second <- c(second, r) ## scores <- c(scores, -m[o[j]]/100) ## ## w_F <- which(index==w_o[1]) ## w_R <- which(index==w_o[2]) ## overlap_MMs <- match(MMs[w_F], MMs[w_R]) ## w_S <- which(!is.na(overlap_MMs)) ## if (length(w_S)==0) ## next ## EFFs <- tapply(c(effs[w_F[w_S]], effs[w_R[overlap_MMs[w_S]]]), ## rep(1:length(w_S), 2), ## min) ## # record set mismatches ## w1 <- which(EFFs >= -20) ## if (length(w1) > 0) ## mismatches <- c(mismatches, paste(MMs[w_F][w_S][w1], ## " (", formatC(EFFs[w1], digits=1, width=1, format="f"), ## "%)", sep="", collapse=", ")) ## } ## } ## ## pSets <- cbind(probes[first,], probes[second,]) ## ns <- names(pSets) ## ns[1:10] <- paste(ns[1:10], "one", sep="_") ## ns[11:20] <- paste(ns[11:20], "two", sep="_") ## names(pSets) <- ns ## pSets$score_set <- scores ## pSets$mismatches_set <- mismatches ## ## pSets[1, -which(names(pSets) %in% c("mismatches_one", "mismatches_two"))] ################################################### ### code chunk number 22: expr19 (eval = FALSE) ################################################### ## dna <- SearchDB(dbConn, nameBy="identifier", verbose=FALSE) ## dbDisconnect(dbConn) ## ## # move the target group to the top of the sequence set ## w <- which(names(dna)=="Sphingopyxis") ## dna <- c(dna[w], dna[-w]) ## ## BrowseSeqs(dna, colorPatterns=c(pSets$start_aligned_one[1], ## pSets$start_aligned_one[1] + nchar(pSets$probe_one[1]) - 1, ## pSets$start_aligned_two[1], ## pSets$start_aligned_two[1] + nchar(pSets$probe_two[1]) - 1), ## highlight=1) ################################################### ### code chunk number 23: sessinfo ################################################### toLatex(sessionInfo(), locale=FALSE)