(original) (raw)

## ----eval = FALSE------------------------------------------------------------- # crispr_set <- readsToTarget(reads, target = target, reference = reference, # target.loc = target.loc) # plotVariants(crispr_set) # # or use plotVariants(crispr_set, txdb) to additionally show the target # # location with respect to the transcripts if a Transcript Database # # txdb is available ## ----message=FALSE, warning=FALSE--------------------------------------------- library(CrispRVariants) library(sangerseqR) # List AB1 filenames, get sequence names, make names for the fastq files # Note that we only include one ab1 file with CrispRVariants because # of space constraints. All bam files are included data_dir <- system.file(package="CrispRVariants", "extdata/ab1/ptena") fq_dir <- tempdir() ab1_fnames <- dir(data_dir, "ab1$", recursive=TRUE, full=TRUE) sq_nms <- gsub(".ab1","",basename(ab1_fnames)) # Replace spaces and slashes in filename with underscores fq_fnames <- paste0(gsub("[\ |\\/]", "_", dirname(ab1_fnames)), ".fastq") # abifToFastq to read AB1 files and write to FASTQ dummy <- mapply( function(u,v,w) { abifToFastq(u,v,file.path(fq_dir,w)) }, sq_nms, ab1_fnames, fq_fnames) ## ----message=FALSE, warning = FALSE------------------------------------------- length(unique(ab1_fnames)) length(unique(fq_fnames)) ## ----message = FALSE, warning=FALSE, eval=FALSE------------------------------- # library("Rsamtools") # # # BWA indices were generated using bwa version 0.7.10 # bwa_index <- "GRCHz10.fa.gz" # bam_dir <- system.file(package="CrispRVariants", "extdata/bam") # fq_fnames <- file.path(fq_dir,unique(fq_fnames)) # bm_fnames <- gsub(".fastq$",".bam",basename(fq_fnames)) # srt_bm_fnames <- file.path(bam_dir, gsub(".bam","_s",bm_fnames)) # # # Map, sort and index the bam files, remove the unsorted bams # for(i in 1:length(fq_fnames)) { # cmd <- paste0("bwa mem ", bwa_index, " ", fq_fnames[i], # " | samtools view -Sb - > ", bm_fnames[i]) # message(cmd, "\n"); system(cmd) # indexBam(sortBam(bm_fnames[i],srt_bm_fnames[i])) # unlink(bm_fnames[i]) # } ## ----message=FALSE------------------------------------------------------------ # The metadata and bam files for this experiment are included with CrispRVariants library("readxl") md_fname <- system.file(package="CrispRVariants", "extdata/metadata/metadata.xls") md <- readxl::read_xls(md_fname, 1) md # Get the bam filenames from the metadata table bam_dir <- system.file(package="CrispRVariants", "extdata/bam") bam_fnames <- file.path(bam_dir, md$bamfile) # check that all files exist all( file.exists(bam_fnames) ) ## ----message=FALSE------------------------------------------------------------ library(rtracklayer) # Represent the guide as a GenomicRanges::GRanges object gd_fname <- system.file(package="CrispRVariants", "extdata/bed/guide.bed") gd <- rtracklayer::import(gd_fname) gd ## ----message=FALSE------------------------------------------------------------ gdl <- GenomicRanges::resize(gd, width(gd) + 10, fix = "center") ## ----eval=FALSE--------------------------------------------------------------- # system("samtools faidx GRCHz10.fa.gz") # # reference=system(sprintf("samtools faidx GRCHz10.fa.gz %s:%s-%s", # seqnames(gdl)[1], start(gdl)[1], end(gdl)[1]), # intern = TRUE)[[2]] # # # The guide is on the negative strand, so the reference needs to be reverse complemented # reference=Biostrings::reverseComplement(Biostrings::DNAString(reference)) # save(reference, file = "ptena_GRCHz10_ref.rda") ## ----------------------------------------------------------------------------- ref_fname <- system.file(package="CrispRVariants", "extdata/ptena_GRCHz10_ref.rda") load(ref_fname) reference ## ----tidy = FALSE------------------------------------------------------------- # First read the alignments into R. The alignments must include # the read sequences and the MD tag alns <- GenomicAlignments::readGAlignments(bam_fnames[[1]], param = Rsamtools::ScanBamParam(tag = "MD", what = c("seq", "flag")), use.names = TRUE) # Then reconstruct the reference for the target region. # If no target region is given, this function will reconstruct # the complete reference sequence for all reads. rfa <- refFromAlns(alns, gdl) # The reconstructed reference sequence is identical to the sequence # extracted from the reference above print(rfa == reference) ## ----message=FALSE------------------------------------------------------------ # Note that the zero point (target.loc parameter) is 22 crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22) crispr_set # The counts table can be accessed with the "variantCounts" function vc <- variantCounts(crispr_set) print(class(vc)) ## ----eval = FALSE------------------------------------------------------------- # # In R # library(GenomicFeatures) # gtf_fname <- "Danio_rerio.GRCz10.81_chr17.gtf" # txdb <- GenomicFeatures::makeTxDbFromGFF(gtf_fname, format = "gtf") # saveDb(txdb, file= "GRCz10_81_chr17_txdb.sqlite") ## ----echo=FALSE, message=FALSE------------------------------------------------ library(GenomicFeatures) txdb_fname <- system.file("extdata/GRCz10_81_ptena_txdb.sqlite", package="CrispRVariants") txdb <- loadDb(txdb_fname) ## ----message = FALSE---------------------------------------------------------- # The gridExtra package is required to specify the legend.key.height # as a "unit" object. It is not needed to call plotVariants() with defaults library(gridExtra) # Match the clutch id to the column names of the variants group <- md$Group ## ----ptena-plot, fig.width = 8.5, fig.height = 7.5, message = FALSE, fig.cap = "(Top) schematic of gene structure showing guide location (left) consensus sequences for variants (right) variant counts in each embryo."---- p <- plotVariants(crispr_set, txdb = txdb, gene.text.size = 8, row.ht.ratio = c(1,8), col.wdth.ratio = c(4,2), plotAlignments.args = list(line.weight = 0.5, ins.size = 2, legend.symbol.size = 4), plotFreqHeatmap.args = list(plot.text.size = 3, x.size = 8, group = group, legend.text.size = 8, legend.key.height = grid::unit(0.5, "lines"))) ## ----------------------------------------------------------------------------- # Calculate the mutation efficiency, excluding indels that occur in the "control" sample # and further excluding the "control" sample from the efficiency calculation eff <- mutationEfficiency(crispr_set, filter.cols = "control", exclude.cols = "control") eff # Suppose we just wanted to filter particular variants, not an entire sample. # This can be done using the "filter.vars" argument eff2 <- mutationEfficiency(crispr_set, filter.vars = "6:1D", exclude.cols = "control") # The results are the same in this case as only one variant was filtered from the control identical(eff,eff2) ## ----------------------------------------------------------------------------- sqs <- consensusSeqs(crispr_set) sqs # The ptena guide is on the negative strand. # Confirm that the reverse complement of the "no variant" allele # matches the reference sequence: Biostrings::reverseComplement(sqs[["no variant"]]) == reference ## ----------------------------------------------------------------------------- ch <- getChimeras(crispr_set, sample = "ptena 4") # Confirm that all chimeric alignments are part of the same read length(unique(names(ch))) == 1 # Set up points to annotate on the plot annotations <- c(resize(gd, 1, fix = "start"), resize(gd, 1, fix = "end")) annotations$name <- c("ptena_start", "ptena_end") plotChimeras(ch, annotations = annotations) ## ----------------------------------------------------------------------------- mutationEfficiency(crispr_set, filter.cols = "control", exclude.cols = "control", include.chimeras = FALSE) ## ----fig.width = 8.5, fig.height = 7.5, message = FALSE, warning = FALSE------ crispr_set_rev <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22, orientation = "opposite") plotVariants(crispr_set_rev) ## ----warning = FALSE---------------------------------------------------------- # We create a longer region to use as the "target" # and the corresponding reference sequence gdl <- GenomicRanges::resize(gd, width(gd) + 20, fix = "center") reference <- Biostrings::DNAString("TCATTGCCATGGGCTTTCCAGCCGAACGATTGGAAGGTGTTTA") # At this stage, target should be the entire region to display and target.loc should # be the zero point with respect to this region crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 10, verbose = FALSE) # Multiple guides are added at the stage of plotting # The boundaries of the guide regions must be specified with respect to the # given target region p <- plotVariants(crispr_set, plotAlignments.args = list(pam.start = c(6,35), target.loc = c(10, 32), guide.loc = IRanges::IRanges(c(6, 25),c(20, 37)))) p ## ----message = FALSE---------------------------------------------------------- # Setup for ptena data set library("CrispRVariants") library("rtracklayer") library("GenomicFeatures") library("readxl") # Load the guide location gd_fname <- system.file(package="CrispRVariants", "extdata/bed/guide.bed") gd <- rtracklayer::import(gd_fname) gdl <- resize(gd, width(gd) + 10, fix = "center") # The saved reference sequence corresponds to the guide # plus 5 bases on either side, i.e. gdl ref_fname <- system.file(package="CrispRVariants", "extdata/ptena_GRCHz10_ref.rda") load(ref_fname) # Load the metadata table, which gives the sample names md_fname <- system.file(package="CrispRVariants", "extdata/metadata/metadata.xls") md <- readxl::read_xls(md_fname, 1) # Get the list of bam files bam_dir <- system.file(package="CrispRVariants", "extdata/bam") bam_fnames <- file.path(bam_dir, md$bamfile) # Check that all files were found all(file.exists(bam_fnames)) crispr_set <- readsToTarget(bam_fnames, target = gdl, reference = reference, names = md$Short.name, target.loc = 22, verbose = FALSE) # Load the transcript database txdb_fname <- system.file("extdata/GRCz10_81_ptena_txdb.sqlite", package="CrispRVariants") txdb <- AnnotationDbi::loadDb(txdb_fname) ## ----fig.height = 5, warning = FALSE------------------------------------------ p <- plotVariants(crispr_set, txdb = txdb) ## ----fig.height = 5, warning = FALSE------------------------------------------ p <- plotVariants(crispr_set, txdb = txdb, row.ht.ratio = c(1,3)) ## ----fig.height = 5, message = FALSE, warning = FALSE------------------------- p <- plotVariants(crispr_set, txdb = txdb, col.wdth.ratio = c(4,1)) ## ----------------------------------------------------------------------------- # Load gol data set library("CrispRVariants") data("gol_clutch1") ## ----fig.height = 2.5, message = FALSE, warning = FALSE----------------------- library(GenomicFeatures) p <- plotVariants(gol, plotAlignments.args = list(top.n = 3), plotFreqHeatmap.args = list(top.n = 3), left.plot.margin = ggplot2::unit(c(0.1,0,5,0.2), "lines")) ## ----fig.height = 2.5, message = FALSE, warning = FALSE----------------------- plotVariants(gol, plotAlignments.args = list(top.n = 3), plotFreqHeatmap.args = list(top.n = 3, order = c(1,5,3)), left.plot.margin = ggplot2::unit(c(0.1,0,5,0.2), "lines")) ## ----fig.height = 2.5, warning = FALSE---------------------------------------- plotAlignments(gol, top.n = 3, ins.size = 6) ## ----fig.height = 2.5--------------------------------------------------------- plotAlignments(gol, top.n = 3, legend.symbol.size = 6) ## ----fig.height = 3, warning = FALSE------------------------------------------ plotAlignments(gol, top.n = 5, max.insertion.size = 25) ## ----fig.height = 3, warning = FALSE------------------------------------------ # Here we set a fairly high value of 50% for min.insertion.freq # As ambiguous nucleotides occur frequently in this data set, # there are no alleles passing this cutoff. plotAlignments(gol, top.n = 5, min.insertion.freq = 50) ## ----fig.height = 3, warning = FALSE------------------------------------------ plotAlignments(gol, top.n = 5, max.insertion.size = 25, min.insertion.freq = 50) ## ----fig.height = 2.5, warning = FALSE---------------------------------------- # No white space between rows plotAlignments(gol, top.n = 3, tile.height = 1) ## ----fig.height = 3, warning = FALSE------------------------------------------ # More white space between rows plotAlignments(gol, top.n = 3, tile.height = 0.3) ## ----fig.height = 2.5, warning = FALSE---------------------------------------- plotAlignments(gol, top.n = 3, highlight.guide = FALSE) ## ----fig.height = 3, message = FALSE------------------------------------------ library(IRanges) guide <- IRanges::IRanges(15,28) plotAlignments(gol, top.n = 3, guide.loc = guide) ## ----fig.height = 2.5--------------------------------------------------------- # Here we increase the size of the axis labels and make # two columns for the legend plotAlignments(gol, top.n = 5, axis.text.size = 12, legend.text.size = 12, legend.cols = 2) ## ----fig.height = 3, warning = FALSE------------------------------------------ # Don't highlight the PAM sequence plotAlignments(gol, top.n = 3, highlight.pam = FALSE) ## ----fig.height = 3, warning = FALSE------------------------------------------ # Highlight 3 bases upstream to 3 bases downstream of the target.loc plotAlignments(gol, top.n = 3, pam.start = 19, pam.end = 25) ## ----fig.height = 3, warning = FALSE------------------------------------------ plotAlignments(gol, top.n = 3, guide.loc = IRanges(5,10), pam.start = 8, pam.end = 13) ## ----fig.height = 3, warning = FALSE------------------------------------------ plotAlignments(gol, top.n = 3, line.weight = 3) ## ----fig.height = 3, warning = FALSE------------------------------------------ plotAlignments(gol, top.n = 3, codon.frame = 1) ## ----eval = FALSE------------------------------------------------------------- # plot_data <- plotAlignments(gol, top.n = 3, create.plot = FALSE) # names(plot_data) # # This data can be modified as required, then replotted using: # do.call(plotAlignments, plot_data) ## ----hmap-default, fig.height = 3, fig.width = 4, fig.align='center', fig.cap = "plotFreqHeatmap with default options"---- # Save the plot to a variable then add a title using ggplot2 syntax. # If the plot is not saved to a variable the unmodified plot is displayed. p <- plotFreqHeatmap(gol, top.n = 3) p + labs(title = "A. plotFreqHeatmap with default options") ## ----fig.height = 2.5, fig.width = 5, fig.align='center', fig.cap = "plotFreqHeatmap showing allele proportions"---- plotFreqHeatmap(gol, top.n = 3, type = "proportions") ## ----fig.height = 2.5, fig.width = 4, fig.align='center', fig.cap = "plotFreqHeatmap with X-axis labels coloured by experimental group and tiles coloured by count instead of proportion"---- ncolumns <- ncol(variantCounts(gol)) ncolumns grp <- rep(c(1,2), each = ncolumns/2) p <- plotFreqHeatmap(gol, top.n = 3, group = grp, as.percent = FALSE) p + labs(title = "B. coloured X labels with tiles coloured by count") ## ----fig.height = 2.5, fig.width = 5, fig.align='center', fig.cap = "plotFreqHeatmap with labels showing allele proportions, header showing counts per sample and modified legend position."---- grp_clrs <- c("red", "purple") p <- plotFreqHeatmap(gol, top.n = 3, group = grp, group.colours = grp_clrs, type = "proportions", header = "counts", legend.position = "bottom") p <- p + labs(title = "C. Modified plotFreqHeatmap") p ## ----fig.height = 2.5, fig.width = 4, fig.align='center'---------------------- plotFreqHeatmap(gol, top.n = 3, legend.key.height = ggplot2::unit(1.5, "lines")) ## ----eval = FALSE------------------------------------------------------------- # var_counts <- variantCounts(gol, top.n = 3) # # (additional modifications to var_counts can be added here) # plotFreqHeatmap(var_counts) ## ----fig.height = 2.5--------------------------------------------------------- barplotAlleleFreqs(crispr_set, txdb = txdb) ## ----fig.height = 2.5, message = FALSE---------------------------------------- barplotAlleleFreqs(crispr_set, txdb = txdb, palette = "bluered") ## ----fig.height = 2.5, message = FALSE---------------------------------------- barplotAlleleFreqs(crispr_set, txdb = txdb, include.table = FALSE) ## ----fig.height = 2.5--------------------------------------------------------- var_counts <- variantCounts(crispr_set) barplotAlleleFreqs(var_counts) ## ----fig.height = 2.5--------------------------------------------------------- rainbowPal10 <- c("#781C81","#3F479B", "#4277BD","#529DB7", "#62AC9B","#86BB6A", "#C7B944","#E39C37", "#E76D2E","#D92120") barplotAlleleFreqs(var_counts, classify = FALSE, bar.colours = rainbowPal10) ## ----fig.height = 2.5--------------------------------------------------------- # Classify variants as insertion/deletion/mixed byType <- crispr_set$classifyVariantsByType() byType # Classify variants by their location, without considering size byLoc <- crispr_set$classifyVariantsByLoc(txdb=txdb) byLoc # Coding variants can then be classified by setting a size cutoff byLoc <- crispr_set$classifyCodingBySize(byLoc, cutoff = 6) byLoc # Combine filtering and variant classification, using barplotAlleleFreqs.matrix vc <- variantCounts(crispr_set) # Select variants that occur in at least two samples keep <- names(which(rowSums(vc > 0) > 1)) keep # Use this classification and the selected variants barplotAlleleFreqs(vc[keep,], category.labels = byLoc[keep]) ## ----fig.height = 2.5--------------------------------------------------------- p <- plotAlignments(gol, top.n = 3) p + theme(legend.margin = ggplot2::unit(0, "cm")) ## ----fig.height = 1----------------------------------------------------------- # Get a reference sequence library("CrispRVariants") data("gol_clutch1") ref <- gol$ref #Then to make the plot: plotAlignments(ref, alns = NULL, target.loc = 22, ins.sites = data.frame()) ## ----message = FALSE, warning = FALSE----------------------------------------- library(Biostrings) library(CrispRVariants) library(rtracklayer) ## ----warning = FALSE---------------------------------------------------------- # This is a small, manually generated data set with a variety of different mutations bam_fname <- system.file("extdata", "cntnap2b_test_data_s.bam", package = "CrispRVariants") guide_fname <- system.file("extdata", "cntnap2b_test_data_guide.bed", package = "CrispRVariants") guide <- rtracklayer::import(guide_fname) guide <- guide + 5 reference <- Biostrings::DNAString("TAGGCGAATGAAGTCGGGGTTGCCCAGGTTCTC") cset <- readsToTarget(bam_fname, guide, reference = reference, verbose = FALSE, name = "Default") cset2 <- readsToTarget(bam_fname, guide, reference = reference, verbose = FALSE, chimera.to.target = 100, name = "Including long dels") default_var_counts <- variantCounts(cset) print(default_var_counts) print(c("Total number of reads: ", colSums(default_var_counts))) # With chimera.to.target = 100, an additional read representing a large deletion is # reported in the "Other" category. var_counts_inc_long_dels <- variantCounts(cset2) print(var_counts_inc_long_dels) print(c("Total number of reads: ", colSums(var_counts_inc_long_dels))) # This alignment can be viewed using `plotChimeras` ch <- getChimeras(cset2, sample = 1) plotChimeras(ch, annotations = cset2$target) ## ----------------------------------------------------------------------------- sessionInfo()