Repair of 8-oxoguanine in DNA is deficient in Cockayne syndrome group B cells (original) (raw)
Journal Article
,
Laboratory of Molecular Genetics, National Institute on Aging, NIH
,
5600 Nathan Shock Drive, Baltimore, MD 21224, USA
Search for other works by this author on:
,
Laboratory of Molecular Genetics, National Institute on Aging, NIH
,
5600 Nathan Shock Drive, Baltimore, MD 21224, USA
Search for other works by this author on:
,
Laboratory of Molecular Genetics, National Institute on Aging, NIH
,
5600 Nathan Shock Drive, Baltimore, MD 21224, USA
Search for other works by this author on:
Laboratory of Molecular Genetics, National Institute on Aging, NIH
,
5600 Nathan Shock Drive, Baltimore, MD 21224, USA
*To whom correspondence should be addressed. Tel: +1 410 558 8162; Fax:
+1 410 558 8157
; Email: bohr@grc.nia.nih.gov
Search for other works by this author on:
Also associated with the Institute for Molecular and Structural Biology, Aarhus University, Aarhus, Denmark
Received:
09 November 1998
Revision received:
22 December 1998
Accepted:
04 January 1999
Cite
Grigory Dianov, Claus Bischoff, Morten Sunesen, Vilhelm A. Bohr, Repair of 8-oxoguanine in DNA is deficient in Cockayne syndrome group B cells, Nucleic Acids Research, Volume 27, Issue 5, 1 March 1999, Pages 1365–1368, https://doi.org/10.1093/nar/27.5.1365
Close
Navbar Search Filter Mobile Enter search term Search
Abstract
The incision of the 8-oxoguanine in DNA by normal and Cockayne Syndrome (CS) cell extracts has been investigated. The incision in extracts derived from CS cells was ∼50% of the incision level compared with extracts prepared from normal cells. In contrast, the incision rate of uracil and thymine glycol was not defective in CS cells. The deficiency in 8-oxoguanine incision was also demonstrated in a CS family. Whereas the proband had markedly less incision compared with the normal siblings, the parents had intermediate levels. The low level of 8-oxoguanine-DNA glycosylase in CS extracts correlates with the reduced expression of the 8-oxoguanine-DNA glycosylase gene (hOGG1) in CS cells. Both the levels of expression of the hOGG1 gene and the incision of 8-oxoguanine in DNA increased markedly after transfection of CS-B cells with the CSB gene. We suggest that the CSB mutation leads to deficient transcription of the hOGG1 gene and thus to deficient repair of 8-oxoguanine in DNA.
Introduction
Cockayne syndrome (CS) is a rare inherited human genetic disorder belonging to the category of segmental progeroid conditions. Afflicted individuals suffer from severe growth retardation, cachectic dwarfism, mental retardation, deafness and optic atrophy (1). Two complementation groups of CS (CS-A and CS-B) have been identified and the corresponding genes have been cloned (2,3). The cellular and molecular phenotypes of CS include a significantly increased sensitivity to a number of DNA damaging agents including ionizing irradiation (4) and UV radiation (5). The CSB protein is thought to play a pivotal role in transcription-coupled repair and CS cells are defective in the repair of the transcribed strand of active genes (6,7) both after exposure to UV and after treatment with agents that generate oxidative DNA damage (8). It has been speculated by several investigators that deficient repair of oxidative DNA damage might contribute to the CS phenotype (9,10). However, although there have been several studies of DNA repair in the general genome in CS cells (11), no defect has been reported.
Living organisms are constantly exposed to oxidative stress from environmental agents and from endogenous metabolic processes. The most significant consequence of the oxidative stress is thought to be the DNA modifications, which can result in mutations and other types of genomic instability. Many different DNA base changes are seen following oxidative stress, and a very important lesion is 8-oxoguanine. This lesion is thought to cause transversion mutations if unrepaired (12). 8-Oxoguanine in DNA is repaired mainly via the process of base excision repair (13) and this process is initiated by a DNA glycosylase activity that recognizes and releases the damaged base from its deoxyribose moiety (13,14). The AP site is further recognized by AP endonuclease which introduces a DNA strand break 5′ to the baseless sugar and then DNA polymerase β catalyzes the β-elimination of the 5′ sugar-phosphate residue and fills the 1 nt gap. The nick is then sealed by DNA ligase (15). The reduced rate of recognition and excision of 8-oxoguanine may limit the processing of this lesion. We have assayed the incision step of 8-oxoguanine repair in CS and normal cells. Here we report reduced levels of 8-oxoguanine incision in CS cells. This represents the first report of a general genome DNA repair defect in CS cells. We show that the deficient excision of 8-oxoguanine is due to down-regulation of the hOGG1 gene in CS-B cells and that this deficiency can be complemented by transfection of the cells with the normal CSB gene.
Materials and Methods
Cells
Human primary fibroblasts, lymphoid cell lines and SV40-transformed human fibroblast cell lines were obtained from the Human Genetic Mutant Cell Repository (Coriell Institute, Camden, NJ). Cells were grown in the media recommended by the Repository. The following cell lines were used: normal human lymphoblasts AG9387; primary fibroblasts CM 38; CS-B primary fibroblasts CM739 and GM1428; primary fibroblasts derived from members of a family (mother, GM12494; father, GM12495; unaffected sister, GM12497) with a diagnosed CS patient (GM12496, unknown complementation group). The SV40-transformed human fibroblasts CS1AN and the derivative transfected with the pDR2 plasmid vector (CS1AN/vector) or with the same vector bearing the CSB gene (CS1AN/CSB) were kindly provided by Dr E. C. Friedberg (Southwestern University Medical Center, Dallas, TX).
Oligonucleotides
The oligonucleotides used in this study were purchased from Midland Certified Reagent Co. (Midland, TX). The following oligonucleotides were employed: ATATACCGCGGUCGGCCGATCAAGCTTAT; ATATACCGCG[8oxoG]CCGGCCGATCAAGCTTAT; CCAGCGCACGACGCATGCACGACGACCGGG (T, thymine glycol). All oligonucleotides were gel purified on a 20% polyacrylamide gel, 32P-5′-end-labeled and annealed with the complementary strand as previously described (16). To generate an oligonucleotide duplex containing a single thymine glycol lesion, 2 µg of 32P-5′-end-labeled oligonucleotide containing a unique thymine residue was incubated in 100 µl of 50 mM osmium tetroxide containing 2% pyridine for 30 min at room temperature. The oligonucleotide was purified from the reaction mixture by gel filtration on a 1 ml Sephadex-G25 (Pharmacia) column and annealed with the complementary strand.
Figure 1
DNA glycosylase activities in normal and CS cell extracts. (A) Schematic representation of the in vitro incision assay. An aliquot of 25 µg protein of whole cell extract prepared from normal lymphoblasts (AG9387) and from SV-40-transformed CS-B fibroblasts (patient CS1AN, complementation group B) were incubated with single lesion oligonucleotide constructs containing uracil (B), thymine glycol (C) or 8-oxoguanine (D) for 30 min (B) or 2 h (C and D) at 37°C. Reactions were terminated by addition of an equal volume of formamide and the products were analyzed on a 20% polyacrylamide gel.
Incision assay
Whole cell extracts were prepared by the method of Manley et al. (17). Incision reactions (15 µl) contained 0.5 nmol of oligonucleotide duplex, 45 mM HEPES-KOH, pH 7.8, 70 mM KCl, 1 mM DTT, 2 mM EDTA and the indicated amount of extract protein. After incubation at 37°C for 1–2 h, the reactions were terminated by the addition of 15 µl of formamide-dye (0.1% xylene cyanol, 0.1% bromophenol blue dissolved in 100% formamide), incubated for 5 min at 90°C and electrophoresed on a 20% polyacrylamide gel containing 7 M urea, 89 mM Tris-borate (pH 8.0) and 2 mM EDTA.
Northern blots
Total RNA was extracted from cells using RNA STAT-60™ Reagent (Tel-Test Inc.) according to the manufacturer's procedures and poly(A) RNA was purified using an mRNA Separator Kit from Clontech (Clontech Laboratories Inc.). After electrophoresis on 1.5% agarose-formaldehyde gels, RNA was blotted onto Hybond+ nylon membrane and hybridized with 32P-end-labeled 60mer oligonucleotides complementary to the 5′-end of hOGG1 mRNA (18) or a randomly labeled 720 bp fragment of the actin gene obtained from Dr Z. Wang (National Institute on Aging, NIH). Hybridization was carried out for 4 h at 45°C in Hybrisol and filters were washed twice in 2× SSPE, 0.1% SDS and once in 1× SSPE, 0.1% SDS and quantified with a PhosphorImager.
Figure 2
8-Oxoguanine-DNA glycosylase activity in extracts from normal human cells and from CS cells. (A) An aliquot of 25 µg protein of whole cell extract prepared from normal primary fibroblasts (GM38) and normal lymphoblasts (AG9387) or from primary fibroblasts from a CS patient (GM739 and GM1428) and SV-40-transformed fibroblasts from the same patient (CS1AN, complementation group B) were incubated with 8-oxoguanine-containing oligonucleotide duplex for 2 h at 37°C. Reactions were terminated by addition of an equal volume of formamide and the products were analyzed on a 20% polyacrylamide gel. (B) An aliquot of 12.5 or 25 µg protein of whole cell extract prepared from normal (AG9387) or CS (CS1AN) cells were incubated with the mixture of 8-oxoguanine- and TG-containing oligonucleotide duplexes for 2 h at 37°C and the excision products were analyzed as described above.
Results
To determine the capacity of CS cells to repair 8-oxoguanine in DNA the activity of human 8-oxoguanine-DNA glycosylase was monitored in cell extracts prepared from normal and CS cells. Oligonucleotide duplex substrates containing a damaged base in a defined position were incubated with cell extracts. A DNA glycosylase, specific for the lesion, recognizes and removes the damaged base from the oligonucleotide by hydrolysis of the _N_-glycosylic bond that covalently links the base to the sugar moiety of the deoxyribose-phosphate DNA backbone. The resulting abasic site is then recognized and cleaved by AP lyase activity from the same glycosylase or from a separate AP endonuclease. This incision results in the conversion of a 30mer 5′-end-labeled substrate into a product of a smaller size (Fig. 1A). In addition to the 8-oxoguanine glycosylase, we also monitored the activity of two other DNA glycosylases, thymine glycol-DNA glycosylase (hNTH) and uracil-DNA glycosylase (hUDG) (Fig. 1A). We did not observe any differences in hUDG and hNTH activities between normal and CS extracts (Fig. 1B and C), but the 8-oxoguanine incision was 40–50% lower in the CS-B cell line CS1AN than in normal cells (Fig. 1D). This decrement in 8-oxoguanine glycosylase activity was also seen in CS primary fibroblasts (GM739 and GM1428) and in SV40-transformed CS fibroblasts (CS1AN) (Fig. 2A). Normal human cell lines used for these comparisons were primary fibroblasts (GM38) and lymphoblasts (AG9387) (Fig. 2A). The incision of oligonucleotide duplexes containing 8-oxoguanine or thymine glycol (TG) single lesions can be measured simultaneously in a cell extract. The appearance of a 15mer is the result of incision at TG whereas the 10mer appears after incision at 8-oxoguanine. We observed the difference in 8-oxoguanine-DNA glycosylase activity, but not in thymine glycol-DNA glycosylase activity between normal and CS cell extracts at the protein concentration range between 10 and 30 µg/reaction (Fig. 2B). At the higher protein concentration nucleases and/or phosphatases present in cell extracts interfere with the reaction (data not shown).
Figure 3
8-Oxoguanine-DNA glycosylase activity in whole cell extracts prepared from primary fibroblasts of members of a CS family. The activity of 8-oxoguanine-DNA glycosylase and thymine glycol-DNA glycosylase was measured in the same reaction mixture as described in Materials and Methods. The gels were quantified with a PhosphorImager and relative activity of 8-oxoguanine-DNA glycosylase, normalized to the activity of thymine glycol-DNA glycosylase, was calculated. An average of two independent experiments is shown.
To investigate the physiological relevance of the reduced incision of 8-oxoguanine in the context of clinical manifestation of CS, the 8-oxoguanine incision was measured in extracts prepared from primary fibroblasts obtained from a family with CS history. We found that an unaffected child had the highest activity, both parents had intermediate levels of incision and the CS patient had only 50% incision activity compared with the normal sibling. These data are summarized in Figure 3. Based on the 8-oxoguanine incision level observed in the individual members of this family we predict that both parents are heterozygous for the CSB allele, the unaffected child is a homozygote with two normal alleles and that the CS patient is a homozygote with two defective CSB alleles.
We next examined whether the defect in incision in the CS-B cells could be complemented by transfection with the normal CSB gene. The incision at 8-oxoguanine and thymine glycol was monitored in CS1AN cells transfected with vector (control) or with the intact CSB gene. In Figure 4A we demonstrate that in extracts prepared from CS-B cells transfected with the CSB gene there is a significant increase (∼60%) in the incision of the oligonucleotide containing 8-oxoguanine whereas there is no change in the incision of the TG-containing oligonucleotide. The function of the CSB protein has not previously been associated with a general DNA repair defect. The general, overall genome repair of a number of lesions has been studied and no defect has been reported. This includes the analysis of the repair of TG lesions in CS-B cells, which was found to be normal by other investigators (8) as well as in this study. The deficiency in 8-oxoguanine incision reported here thus represents the first detection of a general genome DNA repair defect in CS cells.
Figure 4
Transfection of CS-B cells with the CSB gene stimulates hOGG1 expression and 8-oxoguanine-DNA glycosylase activity. (A) 8-Oxoguaninecontaining oligonucleotide duplex and thymine glycol-containing oligonucleotide duplex were incubated in the same reaction mixture with 25 µg protein of whole cell extracts prepared from CS1AN fibroblasts (CS-B) or with 25 µg protein of whole cell extracts prepared from the CS1AN cells transfected with a plasmid vector (CS-B/vector) or with the same vector carrying the CSB gene (CS-B/CSB). Reactions were incubated for 2 h at 37°C, terminated by addition of an equal volume of formamide and the products were analyzed on a 20% polyacrylamide gel. (B) Northern blot analysis of poly(A) mRNA prepared from CS1AN fibroblasts transfected with a plasmid vector (CS-B/vector) or with the same plasmid bearing the CSB gene (CS-B/CSB) were carried out with probes complementary to human 8-oxoguanine-DNA glycosylase mRNA (hOGG1) and b-actin mRNA as described in Materials and Methods.
Recently, we reported a transcription deficit in a number of CS cell lines in vivo (19) and we have suggested that the CSB gene product is involved in regulation of transcription globally or in certain genes. We thus next explored whether the CSB protein had an effect on expression of hOGG1. We measured the level of hOGG1 mRNA in CS1AN cells before and after transfection with the normal CSB gene. The expression of β-actin was also determined. Transfection with the CSB gene was associated with a 50% increase in the level of hOGG1 mRNA whereas there was no change in β-actin mRNA levels (Fig. 4B). Thus, we conclude that the CSB protein affects the hOGG1 mRNA level.
Discussion
We have demonstrated reduced 8-oxoguanine incision in CS-B cell extracts. This reduced incision activity is correlated with the reduction in hOGG1 gene expression. We also find a good correlation of the 8-oxoguanine incision activity with clinical manifestation of CS features in the family with a CS patient. The CSB gene has been cloned (2) and mutations in this gene have been demonstrated for a number of CS patients (20). The CSB protein belongs to the SWI2/SNF2 subfamily of proteins involved in a variety of cellular functions, including regulation of transcription and chromatin remodeling (21). It was demonstrated that the CSB protein has ATPase activity but no helicase activity (22) and it has been reported that the CSB protein can function as a transcription elongation factor (23). It was also shown that the CSB protein binds to RNA polymerase II (24,25). We have reported a basal transcription defect in a number of CS cell lines in vivo, which can be complemented by transfection with the intact CSB gene (19). In vitro transcription experiments have shown reduced levels of RNA polymerase II transcription, but not RNA polymerase I or III transcription in extracts of CS and XP-B/CS cells (10).
There has been much discussion and interest in whether the primary defect in CS-B is in transcription, DNA repair or both (21). The function of the CSB protein has not previously been associated with a general DNA repair defect or with deficiencies in the removal of 8-oxoguanine. We suggest that the CSB protein can affect the regulation of transcription of various genes including some involved in DNA repair. This role of the CSB protein may be separate from its function in transcription-coupled repair. A mutation in CSB may lead to reduced 8-oxoguanine-DNA glycosylase activity and oxidative DNA damage accumulation. This DNA damage may be the primary factor responsible for the complicated and severe CS phenotype including many of the neurological defects, as has also been suggested by other investigators (9).
Although our results are best explained by a primary transcription defect, decreased transcription could also result from a defect in DNA repair. DNA damage, which would be expected to accumulate in a repair-deficient syndrome, can attract transcription factors including the TBP element of the basal transcription factor TFIIH (26). It was recently shown that DNA damage can lead to a decrease in transcription rate via its ‘titration’ of transcription factors (27). Thus transcription rates might be decreased under conditions where DNA damage accumulates and this may contribute to the CS phenotype.
Acknowledgements
We thank Dr E. C. Friedberg for comments. M.S. and C.B. were supported by the Danish Center for Molecular Gerontology.
References
1
,
Am. J. Med. Genet.
,
1992
, vol.
42
(pg.
68
-
84
)
2
,
Cell
,
1992
, vol.
71
(pg.
939
-
953
)
3
,
Cell
,
1995
, vol.
82
(pg.
555
-
566
)
4
,
Proc. Natl Acad. Sci. USA
,
1993
, vol.
90
(pg.
10499
-
10503
)
5
,
Mutat. Res.
,
1979
, vol.
59
(pg.
49
-
60
)
6
,
Proc. Natl Acad. Sci. USA
,
1990
, vol.
87
(pg.
4707
-
4711
)
7
,
Mutat. Res.
,
1994
, vol.
314
(pg.
221
-
231
)
8
,
Science
,
1997
, vol.
275
(pg.
990
-
993
)
9
,
Science
,
1994
, vol.
266
(pg.
1957
-
1958
)
10
,
Nucleic Acids Res.
,
1997
, vol.
25
(pg.
3636
-
3642
)
11
,
DNA Repair and Mutagenesis
,
1995
Washington, DC
ASM Press
12
,
Trends Genet.
,
1993
, vol.
9
(pg.
246
-
249
)
13
,
Nature
,
1993
, vol.
362
(pg.
709
-
715
)
14
,
Biochem. J.
,
1997
, vol.
325
(pg.
1
-
16
)
15
,
Phil. Trans. R Soc. Lond. B Biol. Sci.
,
1995
, vol.
347
(pg.
57
-
62
)
16
,
Nucleic Acids Res.
,
1991
, vol.
19
(pg.
3829
-
3833
)
17
,
Methods Enzymol.
,
1983
, vol.
101
(pg.
568
-
582
)
18
,
Proc. Natl Acad. Sci. USA
,
1997
, vol.
94
(pg.
7429
-
7434
)
19
,
Proc. Natl Acad. Sci. USA
,
1997
, vol.
94
(pg.
4306
-
4311
)
20
,
Am. J. Hum. Genet.
,
1998
, vol.
62
(pg.
77
-
85
)
21
,
Bioessays
,
1996
, vol.
18
(pg.
731
-
738
)
22
,
J. Biol. Chem.
,
1997
, vol.
272
(pg.
1885
-
1890
)
23
,
Proc. Natl Acad. Sci. USA
,
1997
, vol.
94
(pg.
11205
-
11209
)
24
,
EMBO J.
,
1997
, vol.
16
(pg.
5955
-
5965
)
25
,
J. Biol. Chem.
,
1998
, vol.
273
(pg.
27794
-
27799
)
26
,
EMBO J.
,
1997
, vol.
16
(pg.
7444
-
7456
)
27
,
Mol. Cell. Biol.
,
1998
, vol.
18
(pg.
2668
-
2676
)
Author notes
Also associated with the Institute for Molecular and Structural Biology, Aarhus University, Aarhus, Denmark
© 1999 Oxford University Press
I agree to the terms and conditions. You must accept the terms and conditions.
Submit a comment
Name
Affiliations
Comment title
Comment
You have entered an invalid code
Thank you for submitting a comment on this article. Your comment will be reviewed and published at the journal's discretion. Please check for further notifications by email.
Citations
Views
Altmetric
Metrics
Total Views 702
491 Pageviews
211 PDF Downloads
Since 1/1/2017
Month: | Total Views: |
---|---|
January 2017 | 2 |
February 2017 | 3 |
March 2017 | 1 |
April 2017 | 5 |
August 2017 | 2 |
September 2017 | 4 |
October 2017 | 2 |
November 2017 | 2 |
December 2017 | 6 |
January 2018 | 5 |
February 2018 | 6 |
March 2018 | 17 |
April 2018 | 5 |
May 2018 | 14 |
June 2018 | 12 |
July 2018 | 10 |
August 2018 | 2 |
September 2018 | 5 |
October 2018 | 4 |
November 2018 | 1 |
December 2018 | 7 |
January 2019 | 9 |
February 2019 | 11 |
March 2019 | 8 |
April 2019 | 11 |
May 2019 | 8 |
June 2019 | 5 |
July 2019 | 6 |
August 2019 | 11 |
September 2019 | 9 |
October 2019 | 9 |
November 2019 | 14 |
December 2019 | 5 |
January 2020 | 9 |
February 2020 | 5 |
March 2020 | 8 |
April 2020 | 9 |
May 2020 | 6 |
June 2020 | 14 |
July 2020 | 13 |
August 2020 | 8 |
September 2020 | 12 |
October 2020 | 8 |
November 2020 | 9 |
December 2020 | 2 |
January 2021 | 4 |
February 2021 | 7 |
March 2021 | 10 |
April 2021 | 3 |
May 2021 | 2 |
June 2021 | 5 |
July 2021 | 2 |
August 2021 | 7 |
September 2021 | 8 |
October 2021 | 8 |
November 2021 | 4 |
December 2021 | 11 |
January 2022 | 7 |
February 2022 | 15 |
March 2022 | 14 |
April 2022 | 5 |
May 2022 | 8 |
June 2022 | 7 |
July 2022 | 15 |
August 2022 | 7 |
September 2022 | 14 |
October 2022 | 6 |
November 2022 | 6 |
December 2022 | 4 |
January 2023 | 5 |
February 2023 | 9 |
March 2023 | 4 |
April 2023 | 8 |
May 2023 | 4 |
June 2023 | 2 |
July 2023 | 3 |
August 2023 | 2 |
September 2023 | 8 |
October 2023 | 15 |
November 2023 | 6 |
December 2023 | 14 |
January 2024 | 12 |
February 2024 | 4 |
March 2024 | 18 |
April 2024 | 13 |
May 2024 | 4 |
June 2024 | 13 |
July 2024 | 11 |
August 2024 | 17 |
September 2024 | 14 |
October 2024 | 12 |
November 2024 | 1 |
Citations
122 Web of Science
×
Email alerts
Citing articles via
More from Oxford Academic