Widespread occurrence of chromosomal aneuploidy following the routine production of Candida albicans mutants (original) (raw)
Journal Article
,
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Search for other works by this author on:
,
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Department of Biology, McGill University, Montreal, QC, Canada
Search for other works by this author on:
,
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Search for other works by this author on:
,
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Department of Anatomy and Cell Biology, McGill University, Montreal, QC, Canada
Search for other works by this author on:
,
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Department of Anatomy and Cell Biology, McGill University, Montreal, QC, Canada
Search for other works by this author on:
,
Department of Sciences, John Jay College of Criminal Justice, New York, NY, USA
Search for other works by this author on:
,
Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA
Search for other works by this author on:
,
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Department of Biology, McGill University, Montreal, QC, Canada
Search for other works by this author on:
Biotechnology Research Institute, National Research Council of Canada, Montreal, QC, Canada
Department of Anatomy and Cell Biology, McGill University, Montreal, QC, Canada
Correspondence: André Nantel, Biotechnology Research Institute, National Research Council of Canada, 6100 Royalmount Ave., Montreal, QC, Canada H4P 2R2. Tel.: +1 514 496 6370; fax: +1 514 496 9127; e-mail: andre.nantel@nrc-cnrc.gc.ca
Search for other works by this author on:
Revision received:
27 July 2009
Published:
01 November 2009
Cite
Mélanie Arbour, Elias Epp, Hervé Hogues, Adnane Sellam, Celine Lacroix, Jason Rauceo, Aaron Mitchell, Malcolm Whiteway, André Nantel, Widespread occurrence of chromosomal aneuploidy following the routine production of Candida albicans mutants, FEMS Yeast Research, Volume 9, Issue 7, November 2009, Pages 1070–1077, https://doi.org/10.1111/j.1567-1364.2009.00563.x
Close
Navbar Search Filter Mobile Enter search term Search
Abstract
It has come to our attention that approximately 35% of > 100 published microarray datasets, where transcript levels were compared between two different strains, exhibit some form of chromosome-specific bias. While some of these arose from the use of strains whose aneuploidies were not known at the time, in a worrisome number of cases the recombinant strains have acquired additional aneuploidies that were not initially present in the parental strain. The aneuploidies often affected a different chromosome than the one harboring the insertion site. The affected strains originated from either CAI-4, RM1000, BWP17 or SN95 and were produced through a variety of strategies. These observations suggest that aneuploidies frequently occur during the production of recombinant strains and have an effect on global transcript profiles outside of the afflicted chromosome(s), thus raising the possibility of unintended phenotypic consequences. Thus, we propose that all Candida albicans mutants and strains should be tested for aneuploidy before being used in further studies. To this end, we describe a new rapid testing method, based on a multiplex quantitative PCR assay, that produces eight bands of distinct sizes from either the left or right arms of each C. albicans chromosome.
Introduction
We wish to warn the Candida albicans research community that cases of aneuploidy in C. albicans laboratory strains, first identified by Chen (2004) and reviewed extensively by Rustchenko (2007), are commonly exacerbated following routine genetic manipulations such as gene insertions and inactivations.
Candida albicans is an opportunistic fungal pathogen with a diploid genome and an incomplete sexual cycle. While its genome sequence was first released in 2000, published in 2004 (Jones, 2004) and annotated in 2005 (Braun, 2005), the lack of detailed physical and genetic maps have delayed the production of a final chromosomal assembly by several years (Nantel, 2006). Nevertheless, researchers using techniques such as pulse-field gel electrophoresis and contour-clamped homogeneous electrical field (CHEF) gels were already amassing a significant body of evidence demonstrating chromosomal instability in C. albicans under laboratory conditions (Rustchenko, 2007). For example, cells whose sole source of carbon was l-sorbose tended to lose a copy of chromosome 5 (Chr 5) while growth in d-arabinose promoted Chr 6 trisomy (Rustchenko, 1994; Kabir, 2005). Chen (2004) observed the loss of one copy of Chr 1 in strains exposed to 5-fluoroorotic acid. They also demonstrated that the commonly used laboratory strains CAI-4 and SGY-243 carried an extra copy of Chr 1 and that this triploidy had a negative effect on virulence. Comparative genome hybridization (CGH) studies conducted by Selmecki (2005) identified an additional, albeit unstable, Chr 2 aneuploidy in CAI4 as well as a heterozygous deletion in the right arm of Chr 5 in RM1000 and its derivative BWP17. The recent release of the C. albicans genome assembly by van het Hoog (2007) has permitted more detailed studies including the identification of a Chr 5 isochromosome linked to azole resistance (Coste, 2006; Selmecki, 2006). Finally, it was suggested by Ahmad (2008) that different stock of the same C. albicans laboratory strain may harbor different types of chromosomal aberrations. All of these results suggest that the C. albicans genome has enough plasticity to support a wide variety of different chromosomal aneuploidies and that changes in chromosome copy numbers often arise as a response to stress.
Materials and methods
Analysis of microarray data
Candida albicans transcriptional profiling data were extracted from a variety of sources and visualized using the genespring gx v7.3 (Agilent Technologies) physical view. Alternatively, fluorescence data on target genes were sorted in Microsoft Excel according to their chromosomal map coordinates and visualized on a scatter plot.
CGHs
Candida albicans genomic DNA was isolated from a saturated overnight culture with the Qiagen Genomic DNA Extraction kit and labeled with either Cy3 or Cy5 dyes with the Bioprime CGH Labeling (Invitrogen). Unincorporated nucleotides were removed with Qiagen PCR columns and the labeled probes were then hybridized as described to DNA microarrays spotted with 6354 70mer oligonucleotide probes representing most of the genes identified in Genome Assembly 19 (Nantel, 2006). Normalization and data analysis were performed in genespring gx v7.3 (Agilent Technologies). When used to validate suspected aneuploidies, most GCH experiments needed to be performed only once. Because our microarray probes are randomly distributed, it is impossible for noise, dye bias or probe localization artifacts to produce a fluorescence ratio bias that is specific only to certain chromosomes. Thus, even a very weak change in median fluorescence ratio becomes very obvious when viewed in this chromosomal context.
Multiplex PCR
The genomic DNA was purified by the Yeast Smash & Grab DNA miniprep method as described by Rose (1990). For multiplex PCR, we used the Qiagen multiplex PCR kit. PCR reaction mixtures (total volume, 50 μL) contained 1 × Qiagen multiplex PCR master mix, 0.125 μM equimolar primers mixture (either A or B, see Table 1) and 1–50 ng of purified genomic DNA (the specific amount must be evaluated by each individual lab). Thermal cycling was carried out in a Thermocycler 9600 (Perkin-Elmer) with a denaturation step of 95 °C for 15 min, 23 cycles with 30 s denaturation at 94 °C, 30 s annealing at 57 °C, 45 s elongation at 72 °C and the last elongation step at 72 °C for 7 min. When performed to validate an already known aneuploidy, the PCR assays needed to be performed only once to validate the results. When used for screening, replicate experiments on several individual colonies are advisable.
1
Primer sequences used in the multiplex PCR aneuploidy detection assay
Chr | Primer set A (left arm) | Primer set B (right arm) | ||||
---|---|---|---|---|---|---|
Sequences | Positions | Amplicon lengths | Sequences | Positions | Amplicon lengths | |
1 | Ca21Chr1_A_L acttgtacggctggaaaaact | 21272 | 301 | Ca21Chr1_B_L caactgccaaactagttccaa | 3155855 | 305 |
Ca21Chr1_A_R gccaagtatgagagggttgat | 21572 | Ca21Chr1_B_R tgttggtgttttaccgtgttt | 3156159 | |||
2 | Ca21Chr2_A_L cgagttaaactttcggtttcc | 15481 | 383 | Ca21Chr2_B_L tccttctggcccttctaagta | 2213805 | 375 |
Ca21Chr2_A_R attgagggattgaacaaggag | 15863 | Ca21Chr2_B_R aagagtgagcttgttctgggt | 2214179 | |||
3 | Ca21Chr3_A_L atgctcctgtaatacgctcct | 38238 | 478 | Ca21Chr3_B_L catgttttagttggtcgatgg | 1779058 | 471 |
Ca21Chr3_A_R gctcacacaatccaaccatag | 38715 | Ca21Chr3_B_R gtaaccgacaaactccatgtg | 1779528 | |||
4 | Ca21Chr4_A_L cacagagatgacagaacaccc | 6565 | 588 | Ca21Chr4_B_L gatttgcggtggtttattttt | 1614471 | 593 |
Ca21Chr4_A_R cttgatccccaccatagactt | 7152 | Ca21Chr4_B_R aaactagtctaccctgccgaa | 1615063 | |||
5 | Ca21Chr5_A_L tgacaacattggagatggtct | 28726 | 472 | Ca21Chr5_B_L cggtcatgtatttgattacgg | 1163697 | 741 |
Ca21Chr5_A_R agatttcgaatcacgcttttt | 29467 | Ca21Chr5_B_R tatctgcagacgactacccag | 1164437 | |||
6 | Ca21Chr6_A_L acatcatcctgtaacgccata | 13849 | 925 | Ca21Chr6_B_L tgcgtctagatacaacaaggc | 1014943 | 917 |
Ca21Chr6_A_R caggtcaactcaacttccaga | 14773 | Ca21Chr6_B_R acttggcatcaacttccttct | 1015859 | |||
7 | Ca21Chr7_A_L gtcattccgaatctcaaacct | 4219 | 1153 | Ca21Chr7_B_L aagtatgcaatttctttgggg | 931287 | 1151 |
Ca21Chr7_A_R tgaaaagtgcaggagaatcac | 5371 | Ca21Chr7_B_R tcctcagcctgtttgtagttg | 932437 | |||
R | Ca21ChrR_A_L ccaatataccccaatccaaac | 18490 | 1430 | Ca21ChrR_B_L atttggtagaagatcgatggg | 2287349 | 1438 |
Ca21ChrR_A_R aaagacttgttccacctcacc | 19919 | Ca21ChrR_B_R aagacaacaacgaagatgctg | 2288786 |
Chr | Primer set A (left arm) | Primer set B (right arm) | ||||
---|---|---|---|---|---|---|
Sequences | Positions | Amplicon lengths | Sequences | Positions | Amplicon lengths | |
1 | Ca21Chr1_A_L acttgtacggctggaaaaact | 21272 | 301 | Ca21Chr1_B_L caactgccaaactagttccaa | 3155855 | 305 |
Ca21Chr1_A_R gccaagtatgagagggttgat | 21572 | Ca21Chr1_B_R tgttggtgttttaccgtgttt | 3156159 | |||
2 | Ca21Chr2_A_L cgagttaaactttcggtttcc | 15481 | 383 | Ca21Chr2_B_L tccttctggcccttctaagta | 2213805 | 375 |
Ca21Chr2_A_R attgagggattgaacaaggag | 15863 | Ca21Chr2_B_R aagagtgagcttgttctgggt | 2214179 | |||
3 | Ca21Chr3_A_L atgctcctgtaatacgctcct | 38238 | 478 | Ca21Chr3_B_L catgttttagttggtcgatgg | 1779058 | 471 |
Ca21Chr3_A_R gctcacacaatccaaccatag | 38715 | Ca21Chr3_B_R gtaaccgacaaactccatgtg | 1779528 | |||
4 | Ca21Chr4_A_L cacagagatgacagaacaccc | 6565 | 588 | Ca21Chr4_B_L gatttgcggtggtttattttt | 1614471 | 593 |
Ca21Chr4_A_R cttgatccccaccatagactt | 7152 | Ca21Chr4_B_R aaactagtctaccctgccgaa | 1615063 | |||
5 | Ca21Chr5_A_L tgacaacattggagatggtct | 28726 | 472 | Ca21Chr5_B_L cggtcatgtatttgattacgg | 1163697 | 741 |
Ca21Chr5_A_R agatttcgaatcacgcttttt | 29467 | Ca21Chr5_B_R tatctgcagacgactacccag | 1164437 | |||
6 | Ca21Chr6_A_L acatcatcctgtaacgccata | 13849 | 925 | Ca21Chr6_B_L tgcgtctagatacaacaaggc | 1014943 | 917 |
Ca21Chr6_A_R caggtcaactcaacttccaga | 14773 | Ca21Chr6_B_R acttggcatcaacttccttct | 1015859 | |||
7 | Ca21Chr7_A_L gtcattccgaatctcaaacct | 4219 | 1153 | Ca21Chr7_B_L aagtatgcaatttctttgggg | 931287 | 1151 |
Ca21Chr7_A_R tgaaaagtgcaggagaatcac | 5371 | Ca21Chr7_B_R tcctcagcctgtttgtagttg | 932437 | |||
R | Ca21ChrR_A_L ccaatataccccaatccaaac | 18490 | 1430 | Ca21ChrR_B_L atttggtagaagatcgatggg | 2287349 | 1438 |
Ca21ChrR_A_R aaagacttgttccacctcacc | 19919 | Ca21ChrR_B_R aagacaacaacgaagatgctg | 2288786 |
1
Primer sequences used in the multiplex PCR aneuploidy detection assay
Chr | Primer set A (left arm) | Primer set B (right arm) | ||||
---|---|---|---|---|---|---|
Sequences | Positions | Amplicon lengths | Sequences | Positions | Amplicon lengths | |
1 | Ca21Chr1_A_L acttgtacggctggaaaaact | 21272 | 301 | Ca21Chr1_B_L caactgccaaactagttccaa | 3155855 | 305 |
Ca21Chr1_A_R gccaagtatgagagggttgat | 21572 | Ca21Chr1_B_R tgttggtgttttaccgtgttt | 3156159 | |||
2 | Ca21Chr2_A_L cgagttaaactttcggtttcc | 15481 | 383 | Ca21Chr2_B_L tccttctggcccttctaagta | 2213805 | 375 |
Ca21Chr2_A_R attgagggattgaacaaggag | 15863 | Ca21Chr2_B_R aagagtgagcttgttctgggt | 2214179 | |||
3 | Ca21Chr3_A_L atgctcctgtaatacgctcct | 38238 | 478 | Ca21Chr3_B_L catgttttagttggtcgatgg | 1779058 | 471 |
Ca21Chr3_A_R gctcacacaatccaaccatag | 38715 | Ca21Chr3_B_R gtaaccgacaaactccatgtg | 1779528 | |||
4 | Ca21Chr4_A_L cacagagatgacagaacaccc | 6565 | 588 | Ca21Chr4_B_L gatttgcggtggtttattttt | 1614471 | 593 |
Ca21Chr4_A_R cttgatccccaccatagactt | 7152 | Ca21Chr4_B_R aaactagtctaccctgccgaa | 1615063 | |||
5 | Ca21Chr5_A_L tgacaacattggagatggtct | 28726 | 472 | Ca21Chr5_B_L cggtcatgtatttgattacgg | 1163697 | 741 |
Ca21Chr5_A_R agatttcgaatcacgcttttt | 29467 | Ca21Chr5_B_R tatctgcagacgactacccag | 1164437 | |||
6 | Ca21Chr6_A_L acatcatcctgtaacgccata | 13849 | 925 | Ca21Chr6_B_L tgcgtctagatacaacaaggc | 1014943 | 917 |
Ca21Chr6_A_R caggtcaactcaacttccaga | 14773 | Ca21Chr6_B_R acttggcatcaacttccttct | 1015859 | |||
7 | Ca21Chr7_A_L gtcattccgaatctcaaacct | 4219 | 1153 | Ca21Chr7_B_L aagtatgcaatttctttgggg | 931287 | 1151 |
Ca21Chr7_A_R tgaaaagtgcaggagaatcac | 5371 | Ca21Chr7_B_R tcctcagcctgtttgtagttg | 932437 | |||
R | Ca21ChrR_A_L ccaatataccccaatccaaac | 18490 | 1430 | Ca21ChrR_B_L atttggtagaagatcgatggg | 2287349 | 1438 |
Ca21ChrR_A_R aaagacttgttccacctcacc | 19919 | Ca21ChrR_B_R aagacaacaacgaagatgctg | 2288786 |
Chr | Primer set A (left arm) | Primer set B (right arm) | ||||
---|---|---|---|---|---|---|
Sequences | Positions | Amplicon lengths | Sequences | Positions | Amplicon lengths | |
1 | Ca21Chr1_A_L acttgtacggctggaaaaact | 21272 | 301 | Ca21Chr1_B_L caactgccaaactagttccaa | 3155855 | 305 |
Ca21Chr1_A_R gccaagtatgagagggttgat | 21572 | Ca21Chr1_B_R tgttggtgttttaccgtgttt | 3156159 | |||
2 | Ca21Chr2_A_L cgagttaaactttcggtttcc | 15481 | 383 | Ca21Chr2_B_L tccttctggcccttctaagta | 2213805 | 375 |
Ca21Chr2_A_R attgagggattgaacaaggag | 15863 | Ca21Chr2_B_R aagagtgagcttgttctgggt | 2214179 | |||
3 | Ca21Chr3_A_L atgctcctgtaatacgctcct | 38238 | 478 | Ca21Chr3_B_L catgttttagttggtcgatgg | 1779058 | 471 |
Ca21Chr3_A_R gctcacacaatccaaccatag | 38715 | Ca21Chr3_B_R gtaaccgacaaactccatgtg | 1779528 | |||
4 | Ca21Chr4_A_L cacagagatgacagaacaccc | 6565 | 588 | Ca21Chr4_B_L gatttgcggtggtttattttt | 1614471 | 593 |
Ca21Chr4_A_R cttgatccccaccatagactt | 7152 | Ca21Chr4_B_R aaactagtctaccctgccgaa | 1615063 | |||
5 | Ca21Chr5_A_L tgacaacattggagatggtct | 28726 | 472 | Ca21Chr5_B_L cggtcatgtatttgattacgg | 1163697 | 741 |
Ca21Chr5_A_R agatttcgaatcacgcttttt | 29467 | Ca21Chr5_B_R tatctgcagacgactacccag | 1164437 | |||
6 | Ca21Chr6_A_L acatcatcctgtaacgccata | 13849 | 925 | Ca21Chr6_B_L tgcgtctagatacaacaaggc | 1014943 | 917 |
Ca21Chr6_A_R caggtcaactcaacttccaga | 14773 | Ca21Chr6_B_R acttggcatcaacttccttct | 1015859 | |||
7 | Ca21Chr7_A_L gtcattccgaatctcaaacct | 4219 | 1153 | Ca21Chr7_B_L aagtatgcaatttctttgggg | 931287 | 1151 |
Ca21Chr7_A_R tgaaaagtgcaggagaatcac | 5371 | Ca21Chr7_B_R tcctcagcctgtttgtagttg | 932437 | |||
R | Ca21ChrR_A_L ccaatataccccaatccaaac | 18490 | 1430 | Ca21ChrR_B_L atttggtagaagatcgatggg | 2287349 | 1438 |
Ca21ChrR_A_R aaagacttgttccacctcacc | 19919 | Ca21ChrR_B_R aagacaacaacgaagatgctg | 2288786 |
Agilent 2100 Bioanalyzer microcapillary electrophoresis
Following amplification, 1 μL of the PCR reaction was loaded into the well of a Bioanalyzer chip prepared according to manufacturer's protocol for the DNA 7500 Lab Chips (Agilent Technologies). The aneuploidy of the mutant DNA was determined by the relative ratio of the peak height of the mutant and wild-type (SC5314) DNA fragments in the chromatogram. The ratio for each chromosome was then divided by the median of the ratio for all chromosomes. Alternatively, the elution profile graphics were scaled and overlapped in an image processing software such as abode photoshop.
Results
Following the completion of the C. albicans genome assembly (van het Hoog, 2007), we noticed that some of our transcriptional profiles exhibited chromosome-specific bias. Thus, we extended this analysis to >100 published and unpublished microarray experiments where two different strains, usually a mutant and its wild-type parent, were directly compared. As reported in Table 2, we observed cases of chromosomal bias in 22 out of 59 C. albicans strains (36.2%). For example, in Fig. 1, we can clearly see that the transcriptional profiles obtained by comparing a Δmkc1 recombinant strain (Oberholzer, 2006) to the SC5314 control strain show an enrichment in overexpressed genes that are located in Chr 1, 2, 5, 6 and 7 while the genes in Chr 3, 4 and R tend to be repressed. While the actual fold-change can be minor, the bias can be easily detected, as long as the probes are spotted in a random position on the microarray slides so that experimental noise and most changes in transcript abundance are evenly distributed. The second example, taken from Tsong (2003), is especially interesting because we can see both up- and downregulated chromosome bias; the general repression of Chr 2 genes is due to the use of the Chr 2 trisomic CAI4 strain as a control, while the increase in the fluorescence ratios of genes in Chr 6 is the probable result of a chromosome duplication event during the generation of this strain.
2
Identification of unexpected aneuploidies in microarray profiles
Mutation | Function | Gene locations | Aneuploidy | Mode of production (reference if different from array data) | Reference for array data |
---|---|---|---|---|---|
D9-330 | Antifungal resistance | N/A | Isochromosome 5 directed evolution | Cowen (2002) | |
D11-330 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-165 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-330 | Antifungal resistance | N/A | Gain of Chr 4 | Directed evolution | Cowen (2002) |
Δ_efg1/cph1_ | Transcription factors | Chr R and Chr 1 | Gain of Chr 7 | Ura-blaster (Lo, 1997) | Nantel (2002) |
35/65 profiles | Combinations of MTL transcriptional regulators in White and Opaque cells | Various | Mixed cell population, some with gain of either Chr 6 or 7. Use of CAI4 as control also caused Chr 2 bias in 33 of the comparisons | PCR disruption cassettes | Tsong (2003) |
Δ_cdc35_ | Adenylate Cyclase | Chr 7 | Gain of Chr 2 | Ura-blaster (Rocha, 2001) | Harcus (2004) |
Δ_ssn6_ | Transcription factor | Chr 3 | Gain of Chr 7 | Ura-blaster | Garcia-Sanchez (2005) |
Δ_mkc1_ | MAP kinase | Chr R | Loss of Chr 3, 4 and R | PCR disruption Cassette | Oberholzer (2006) |
Δ_sst2_ | GTPase activator | Chr 5 | Gain of Chr 6 | PCR disruption Cassette | Dignard & Whiteway (2006) |
Δ_tac1_ | Transcription factor | Chr 5 | Loss of Chr 5 | MPAR-flipping | Znaidi (2007) |
TAC1 replacements | Transcription factor | Chr 5 | Gain of Chr 5 and/or 7 | MPAR-flipping | Znaidi (2007) |
Δ_cph1_ | Transcription factor | Chr 1 | Gain of Chr 6 and 7 | Ura-blaster (Lo, 1997) | Huang (2008) |
Δ_ras1_ | Small GTPase | Chr 2 | Gain of Chr 4 and loss of Chr 5–6 | hph-URA3-hph disruption cassette (Feng et al., 1999) | B. Hube, GSE11490 |
Δ_ste4_ | G® subunit | Chr 2 | Loss of Chr 1-3 | Ura-blaster | |
Δ_rds2_ | Transcription factor | Chr R | Loss of Chr 1 | Ura-blaster | B. Turcotte (unpublished data) |
Δ_fun31_ | Ser/Thr protein kinase | Chr 3 | Loss of Chr R | PCR disruption Cassette | J. Rauceo and A. Mitchell (unpublished data) |
Δ_vma22_ | Membrane protein | Chr R | Loss of right arm of Chr R | PCR disruption Cassette | E. Epp and M. Whiteway (unpublished data) |
Δ_nrg1_ | Transcription factor | Chr 7 | Gain of Chr 2 and 4 | Ura-blaster (Murad et al., 2001) | C. Lacroix and A. Nantel (unpublished data) |
HA-Rfg1 | Tagged transcription factor | Chr 1 | Gain of Chr 1 and/or Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Nrg1-HA | Tagged transcription factor | Chr 1 | Gain of Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Mutation | Function | Gene locations | Aneuploidy | Mode of production (reference if different from array data) | Reference for array data |
---|---|---|---|---|---|
D9-330 | Antifungal resistance | N/A | Isochromosome 5 directed evolution | Cowen (2002) | |
D11-330 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-165 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-330 | Antifungal resistance | N/A | Gain of Chr 4 | Directed evolution | Cowen (2002) |
Δ_efg1/cph1_ | Transcription factors | Chr R and Chr 1 | Gain of Chr 7 | Ura-blaster (Lo, 1997) | Nantel (2002) |
35/65 profiles | Combinations of MTL transcriptional regulators in White and Opaque cells | Various | Mixed cell population, some with gain of either Chr 6 or 7. Use of CAI4 as control also caused Chr 2 bias in 33 of the comparisons | PCR disruption cassettes | Tsong (2003) |
Δ_cdc35_ | Adenylate Cyclase | Chr 7 | Gain of Chr 2 | Ura-blaster (Rocha, 2001) | Harcus (2004) |
Δ_ssn6_ | Transcription factor | Chr 3 | Gain of Chr 7 | Ura-blaster | Garcia-Sanchez (2005) |
Δ_mkc1_ | MAP kinase | Chr R | Loss of Chr 3, 4 and R | PCR disruption Cassette | Oberholzer (2006) |
Δ_sst2_ | GTPase activator | Chr 5 | Gain of Chr 6 | PCR disruption Cassette | Dignard & Whiteway (2006) |
Δ_tac1_ | Transcription factor | Chr 5 | Loss of Chr 5 | MPAR-flipping | Znaidi (2007) |
TAC1 replacements | Transcription factor | Chr 5 | Gain of Chr 5 and/or 7 | MPAR-flipping | Znaidi (2007) |
Δ_cph1_ | Transcription factor | Chr 1 | Gain of Chr 6 and 7 | Ura-blaster (Lo, 1997) | Huang (2008) |
Δ_ras1_ | Small GTPase | Chr 2 | Gain of Chr 4 and loss of Chr 5–6 | hph-URA3-hph disruption cassette (Feng et al., 1999) | B. Hube, GSE11490 |
Δ_ste4_ | G® subunit | Chr 2 | Loss of Chr 1-3 | Ura-blaster | |
Δ_rds2_ | Transcription factor | Chr R | Loss of Chr 1 | Ura-blaster | B. Turcotte (unpublished data) |
Δ_fun31_ | Ser/Thr protein kinase | Chr 3 | Loss of Chr R | PCR disruption Cassette | J. Rauceo and A. Mitchell (unpublished data) |
Δ_vma22_ | Membrane protein | Chr R | Loss of right arm of Chr R | PCR disruption Cassette | E. Epp and M. Whiteway (unpublished data) |
Δ_nrg1_ | Transcription factor | Chr 7 | Gain of Chr 2 and 4 | Ura-blaster (Murad et al., 2001) | C. Lacroix and A. Nantel (unpublished data) |
HA-Rfg1 | Tagged transcription factor | Chr 1 | Gain of Chr 1 and/or Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Nrg1-HA | Tagged transcription factor | Chr 1 | Gain of Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Note that the ‘loss’ of a chromosome might also be indicative of duplication of the remaining chromosomes or the presence of a trisomic chromosome in the control strain.
Following a review of available data, profiles for the following mutants did not seem to exhibit obvious aneuploidies: Δace2, Δ_ada2_, Δ_als2_, Δ_als4_, Δ_bcr1_, Δ_bub2_, Δ_cdc5_, Δ_cdc53_, Δ_cdr1_Δ_cdr2_, Δ_cek1_, Δ_cka2_, Δ_crz1_, Δ_cph1_Δ_efg1_, Δ_cst20_, Δ_dfg16_, Δ_efg1_, Δ_efg1_Δ_efh1_, Δ_efh1_, Δ_gal4_, Δ_gcn2_, Δ_gcn4_, Δ_hog1_, Δ_hst7_, Δ_msn4_Δ_mnl1_, Δ_myo5_, Δ_myo5_Δ_hog1_, Δ_myo5_Δ_mkc1_, Δ_myo5_Δ_SH3_Δ_A_, Δ_rfg1_, Δ_rim101_, Δ_rlm1_, Δ_sit4_, Δ_sla2_, Δ_ssr1_, Δ_tup1_, D8-330, N4-330.
*
Observation validated by CGH (Selmecki, 2006; A. Selmecki, L.E. Cowen and J. Berman, unpublished data).
†
Observation validated by CGH in our lab.
‡
Observation validated by the PCR assay.
2
Identification of unexpected aneuploidies in microarray profiles
Mutation | Function | Gene locations | Aneuploidy | Mode of production (reference if different from array data) | Reference for array data |
---|---|---|---|---|---|
D9-330 | Antifungal resistance | N/A | Isochromosome 5 directed evolution | Cowen (2002) | |
D11-330 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-165 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-330 | Antifungal resistance | N/A | Gain of Chr 4 | Directed evolution | Cowen (2002) |
Δ_efg1/cph1_ | Transcription factors | Chr R and Chr 1 | Gain of Chr 7 | Ura-blaster (Lo, 1997) | Nantel (2002) |
35/65 profiles | Combinations of MTL transcriptional regulators in White and Opaque cells | Various | Mixed cell population, some with gain of either Chr 6 or 7. Use of CAI4 as control also caused Chr 2 bias in 33 of the comparisons | PCR disruption cassettes | Tsong (2003) |
Δ_cdc35_ | Adenylate Cyclase | Chr 7 | Gain of Chr 2 | Ura-blaster (Rocha, 2001) | Harcus (2004) |
Δ_ssn6_ | Transcription factor | Chr 3 | Gain of Chr 7 | Ura-blaster | Garcia-Sanchez (2005) |
Δ_mkc1_ | MAP kinase | Chr R | Loss of Chr 3, 4 and R | PCR disruption Cassette | Oberholzer (2006) |
Δ_sst2_ | GTPase activator | Chr 5 | Gain of Chr 6 | PCR disruption Cassette | Dignard & Whiteway (2006) |
Δ_tac1_ | Transcription factor | Chr 5 | Loss of Chr 5 | MPAR-flipping | Znaidi (2007) |
TAC1 replacements | Transcription factor | Chr 5 | Gain of Chr 5 and/or 7 | MPAR-flipping | Znaidi (2007) |
Δ_cph1_ | Transcription factor | Chr 1 | Gain of Chr 6 and 7 | Ura-blaster (Lo, 1997) | Huang (2008) |
Δ_ras1_ | Small GTPase | Chr 2 | Gain of Chr 4 and loss of Chr 5–6 | hph-URA3-hph disruption cassette (Feng et al., 1999) | B. Hube, GSE11490 |
Δ_ste4_ | G® subunit | Chr 2 | Loss of Chr 1-3 | Ura-blaster | |
Δ_rds2_ | Transcription factor | Chr R | Loss of Chr 1 | Ura-blaster | B. Turcotte (unpublished data) |
Δ_fun31_ | Ser/Thr protein kinase | Chr 3 | Loss of Chr R | PCR disruption Cassette | J. Rauceo and A. Mitchell (unpublished data) |
Δ_vma22_ | Membrane protein | Chr R | Loss of right arm of Chr R | PCR disruption Cassette | E. Epp and M. Whiteway (unpublished data) |
Δ_nrg1_ | Transcription factor | Chr 7 | Gain of Chr 2 and 4 | Ura-blaster (Murad et al., 2001) | C. Lacroix and A. Nantel (unpublished data) |
HA-Rfg1 | Tagged transcription factor | Chr 1 | Gain of Chr 1 and/or Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Nrg1-HA | Tagged transcription factor | Chr 1 | Gain of Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Mutation | Function | Gene locations | Aneuploidy | Mode of production (reference if different from array data) | Reference for array data |
---|---|---|---|---|---|
D9-330 | Antifungal resistance | N/A | Isochromosome 5 directed evolution | Cowen (2002) | |
D11-330 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-165 | Antifungal resistance | N/A | Gain of Chr 7 | Directed evolution | Cowen (2002) |
D12-330 | Antifungal resistance | N/A | Gain of Chr 4 | Directed evolution | Cowen (2002) |
Δ_efg1/cph1_ | Transcription factors | Chr R and Chr 1 | Gain of Chr 7 | Ura-blaster (Lo, 1997) | Nantel (2002) |
35/65 profiles | Combinations of MTL transcriptional regulators in White and Opaque cells | Various | Mixed cell population, some with gain of either Chr 6 or 7. Use of CAI4 as control also caused Chr 2 bias in 33 of the comparisons | PCR disruption cassettes | Tsong (2003) |
Δ_cdc35_ | Adenylate Cyclase | Chr 7 | Gain of Chr 2 | Ura-blaster (Rocha, 2001) | Harcus (2004) |
Δ_ssn6_ | Transcription factor | Chr 3 | Gain of Chr 7 | Ura-blaster | Garcia-Sanchez (2005) |
Δ_mkc1_ | MAP kinase | Chr R | Loss of Chr 3, 4 and R | PCR disruption Cassette | Oberholzer (2006) |
Δ_sst2_ | GTPase activator | Chr 5 | Gain of Chr 6 | PCR disruption Cassette | Dignard & Whiteway (2006) |
Δ_tac1_ | Transcription factor | Chr 5 | Loss of Chr 5 | MPAR-flipping | Znaidi (2007) |
TAC1 replacements | Transcription factor | Chr 5 | Gain of Chr 5 and/or 7 | MPAR-flipping | Znaidi (2007) |
Δ_cph1_ | Transcription factor | Chr 1 | Gain of Chr 6 and 7 | Ura-blaster (Lo, 1997) | Huang (2008) |
Δ_ras1_ | Small GTPase | Chr 2 | Gain of Chr 4 and loss of Chr 5–6 | hph-URA3-hph disruption cassette (Feng et al., 1999) | B. Hube, GSE11490 |
Δ_ste4_ | G® subunit | Chr 2 | Loss of Chr 1-3 | Ura-blaster | |
Δ_rds2_ | Transcription factor | Chr R | Loss of Chr 1 | Ura-blaster | B. Turcotte (unpublished data) |
Δ_fun31_ | Ser/Thr protein kinase | Chr 3 | Loss of Chr R | PCR disruption Cassette | J. Rauceo and A. Mitchell (unpublished data) |
Δ_vma22_ | Membrane protein | Chr R | Loss of right arm of Chr R | PCR disruption Cassette | E. Epp and M. Whiteway (unpublished data) |
Δ_nrg1_ | Transcription factor | Chr 7 | Gain of Chr 2 and 4 | Ura-blaster (Murad et al., 2001) | C. Lacroix and A. Nantel (unpublished data) |
HA-Rfg1 | Tagged transcription factor | Chr 1 | Gain of Chr 1 and/or Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Nrg1-HA | Tagged transcription factor | Chr 1 | Gain of Chr 2 | Insertion in Rps1 site | C. Lacroix and A. Nantel (unpublished data) |
Note that the ‘loss’ of a chromosome might also be indicative of duplication of the remaining chromosomes or the presence of a trisomic chromosome in the control strain.
Following a review of available data, profiles for the following mutants did not seem to exhibit obvious aneuploidies: Δace2, Δ_ada2_, Δ_als2_, Δ_als4_, Δ_bcr1_, Δ_bub2_, Δ_cdc5_, Δ_cdc53_, Δ_cdr1_Δ_cdr2_, Δ_cek1_, Δ_cka2_, Δ_crz1_, Δ_cph1_Δ_efg1_, Δ_cst20_, Δ_dfg16_, Δ_efg1_, Δ_efg1_Δ_efh1_, Δ_efh1_, Δ_gal4_, Δ_gcn2_, Δ_gcn4_, Δ_hog1_, Δ_hst7_, Δ_msn4_Δ_mnl1_, Δ_myo5_, Δ_myo5_Δ_hog1_, Δ_myo5_Δ_mkc1_, Δ_myo5_Δ_SH3_Δ_A_, Δ_rfg1_, Δ_rim101_, Δ_rlm1_, Δ_sit4_, Δ_sla2_, Δ_ssr1_, Δ_tup1_, D8-330, N4-330.
*
Observation validated by CGH (Selmecki, 2006; A. Selmecki, L.E. Cowen and J. Berman, unpublished data).
†
Observation validated by CGH in our lab.
‡
Observation validated by the PCR assay.
1
Example of chromosomal bias in published transcriptional profiles. Each spot represents fluorescence ratio data (log 2) from genes that were ordered according to their position on the eight Candida albicans chromosomes. The top panel represents a comparison between a Δ_mkc1_ strain and its CAI4 parental strain (Oberholzer, 2006). The bottom panel shows the profile obtained from a comparison between a ‘white’ morphology strain expressing the α1, α2, a1 and a2 MTL transcriptional regulators and its CAI4 parental strain at 23°C (Tsong, 2003).
This analysis was conducted with transcriptional profiling data and not from CGH experiments, where genomic DNA from two strains is differently labeled and hybridized to microarrays. CGH on some strains has confirmed that the changes in transcript profiles are indeed the result of changes in gene copy number although it is difficult to determine precisely whether we are dealing with chromosome duplication, chromosome loss or some other type of karyotype rearrangement. In some cases, we noticed that individual transformed colonies can carry different aneuploidies. For example, Fig. 2 shows CGH data from two individual colonies of a strain, produced at the NRC-BRI, that express an HA-tagged version of the Rfg1p transcription factor. While both clones had the extra copy of Chr 2 normally found in the parental CAI4 strain, one of the clones also had an additional copy of Chr 1. Whether the extra Chr 1 arose from an independent duplication event or from a mixed population of Chr 2 and Chr 1/2 triploids in our CAI4 stocks has not been determined. Nevertheless, it should be noted that we failed to detect any Chr 1 bias in CGH experiments comparing our CAI4 and SC5314 stocks. Another case of colony-specific aneuploidy occurred during the production of Δ_fun31_ mutants at Columbia University. As illustrated in Fig. 3a, transcriptional profiling on three independently isolated strains revealed that two of them seem to be missing a copy of Chr R (or have an extra copy of Chr 1–7). This experiment is also used to illustrate that a chromosomal aneuploidy can also affect gene expression patterns in the nonamplified chromosomes. A mutant vs. wild-type comparison of the transcriptional profiles of genes located on the nonaneuploid Chr 1–7 showed that the two strains with the Chr R aneuploidies were more similar to each other than to the strain with the correct number of chromosome copies (Fig. 3b and c). These observations, along with those produced by Selmecki (2006), thus confirm that changes in the copy number of certain genes can result in compensatory changes in the expression profiles of other genes located outside of the afflicted chromosomes.
2
Example of different aneuploidies from two distinct colonies. These graphs represent the fluorescence ratios (log 2) from individual probes in a CGH comparing one of two colonies expressing the HA-Rfg1p transcription factor with a CAI4-pCaEXP empty-vector control strain that had previously been confirmed to have two copies of each chromosome. While the fold change in CGH should be expected to be at least 1.5-fold for a triploid vs. diploid comparison, we note that the quantarray software used to quantify our microarrays tends to underestimate fluorescence ratios.
3
Aneuploidies can affect transcriptional profiles outside of the afflicted chromosomes. (a) Fluorescence intensities in a transcriptional profiling experiment of one of three Δ_fun31_ mutants compared with a DAY185 control strain. Downregulation of Chr R genes is apparent. (b and c) Scatter plots showing the similarity of transcriptional profiles between the genes outside of Chr R in a comparison of two individual Δ_fun31_ mutants lacking a copy of Chr R (b), or a Δ_fun31_ mutant lacking a Chr R, when compared with a control strain without the Δ_fun31_ mutation and an equal number of chromosomes. Spots represent the fluorescence ratios of 486 genes in Chr 1–7 that had a 1.5-fold change or more in at least one experiment. _R_2 values represent the similarities in the profiles between the two strains and indicate that the aneuploid strains produce profiles that are more similar to each other.
In light of these results, we developed a multiplex PCR assay that can rapidly detect cases of chromosomal aneuploidy, the formation of isochromosomes or the loss of chromosome ends. Each assay consists of eight pairs of primers that are specific for unique regions near the left or the right arm of each chromosome (see Table 1). As illustrated in Fig. 4, the resulting PCR reactions produce eight amplicons of different sizes, one from each chromosome arm. The production of quantitative data requires some optimization specific for each lab and PCR machine, usually by varying the amount of template genomic DNA or the number of amplification cycles. For quantification purposes, we use an Agilent Bioanalyzer, a very precise capillary electrophoresis instrument that produces reproducible results in a very short amount of time. Identification of aneuploidies can be performed either by directly comparing the elution profiles (Fig. 4a) or by measuring normalized peak heights (Fig. 4b). In the examples shown in Fig. 4a, we can easily detect the extra Chr 2 and Chr 4 in the Δ_nrg1_ strain as well as the small deletion in the right arm of the BWP17 Chr 5. In Fig. 4b, we can discern the extra Chr 1 and Chr 6 in strain DkCa169 that were observed by Legrand (2008) as well as the additional Chr 5 and Chr 7 described by Znaidi (2007) in the _TAC1/tac1_Δ∷FRT SZY20 strain. We choose these strains because they represent examples of aneuploidies in seven out of the eight chromosomes, while BWP17 is an example of a deletion that only affects one arm.
4
Aneuploidy detection with a multiplex PCR assay. (a) Bioanalyzer profiles of multiplex PCR reactions using primer set A (left panel) or primer set B (right panel). We used as templates genomic DNA from either a validated SC5314 control strain, a Δ_nrg1_ strain (with extra copies of Chr 2 and 4) or the BWP17 strain carrying a heterozygous deletion on the right arm of Chr 5. Images of the profiles were scaled to similar sizes, thus allowing the identification of amplicons with a different abundance (arrowheads). In (b), the multiplex PCR assay was conducted with primer set A on genomic DNA from strains SC5314, DkCa169 (Legrand, 2008) and SZY20 (Znaidi, 2007). Graphs represent the mutant/SC5314 ratio of the median normalized peak heights on the _X_-axis and each chromosome on the _Y_-axis. A log2 ratio above 0.2 (in red) was considered to be significant and indicative of aneuploidy for these chromosomes.
Discussion
We present evidence that the routine genetic manipulation of C. albicans often results in the acquisition of unwanted chromosomal aneuploidies. We have observed chromosome duplications in any one of eight chromosomes of C. albicans, with recombinant derivatives originating from either the CAI-4, RM1000, BWP17 or SN95 strains, and with strains produced by a variety of techniques including long-term treatment with Fluconazole, Ura-blaster-mediated gene deletion, the insertion of disruption cassettes produced by PCR, MPAR-flipping or the insertion of genes encoding tagged transcription factors at the Rps1 site. Almost all the cases of chromosomal bias affected a different chromosome(s) than the actual site of the recombinant modification, which is to be expected because same-chromosome aberrations would have been easily detected as part of the regular Southern blotting controls that often follow strain production. Ever since we became aware of this problem, aneuploidy testing has been routinely applied in our lab and we have developed a rapid multiplex PCR assay that can cheaply identify chromosomal aberrations in less than a day. Although not every laboratory is expected to have access to a Bioanalyzer or similar equipment, band quantification from a regular gel is possible if the experimenter is skillful enough to detect a 50% increase in band intensity. Alternatively, the primer sequences included therein could easily be adapted into a quantitative PCR (qPCR) assay. In our hands, the PCR assay works fairly well in the detection of simple aneuploidies that affect one or even two chromosomes. Results with multichromosomal aneuploidies are much more difficult to interpret precisely; we can tell that something is wrong but matching peak heights to the afflicted chromosome is not always possible because we can not normalize the data. Finally, it should be noted that none of our assays can currently detect loss of heterozygocity (LOH). It would not surprise us if rates of unwanted LOH turned out to be as abundant as aneuploidies.
The phenotypic consequences of these chromosomal aberrations are difficult to assess without a direct comparison between an aneuploid and a nonaneuploid strain. The aneuploidy-dependent bias in transcriptional profiling data is generally very subtle, most notably because C. albicans is a diploid and an extra allele would thus increase gene dosage by 50%. Assuming an equivalent change in gene expression, this would only result in a 1.5-fold change in fluorescence ratio, which is the detection limit of most transcriptional profiling experiments. Consequently, we believe that most of the lists of significantly modulated genes are still valid. More worrisome and difficult to detect would be variations in gene expression patterns that would result from a change in transcription factor dosage, a phenomenon that was observed by Selmecki (2006) with the Tac1p transcription factor.
In conclusions, based on our global microarray data analysis and general observations by the Montreal Candida research community, we believe that we are dealing with a fairly common phenomenon with a significant impact on Candida research. In light of these observations, we propose the following recommendations:
- The affected transcriptional profiles listed in Table 2 should not be used in global data analysis. The data currently in public databases, such as CGD and GEO, should be tagged appropriately.
- Important Candida albicans mutants and strains should be tested for aneuploidy, either by CHEF, CGH on DNA microarrays or by qPCR, before being used in subsequent experiments. For example, our lab recently produced 31 strains that express TAP-tagged transcription factors. These control experiments allowed us to eliminate six additional cases of aneuploidies (19%).
- During the production of C. albicans strains, multiple colonies should be isolated after every transformation to facilitate the isolation of a strain with the standard background karyotype.
- Finally, researchers should pay close attention to the culture stocks used for the construction of their recombinant strains. Ahmad (2008) have identified CAF4-2 as a stable Ura− derivative while we have tested the SN76, SN95, SN152 and SN148 strains (Noble & Johnson, 2005) and have found them to be initially free of aneuploidies.
Acknowledgements
We thank Marco van het Hoog for assistance in bioinformatics, Alistair Brown and Martine Raymond for strains and Judith Berman for strain DKCa169 and for critically reading the manuscript. This research was funded by grant CTP79843 from the Canadian Institutes of Health Research (CIHR). This is NRC Publication number 50662.
Statement
Re-use of this article is permitted in accordance with the Terms and Conditions set out at: http://www3.interscience.wiley.com/authorresources/onlineopen.html
References
(
2008
)
Chromosome instability and unusual features of some widely used strains of Candida albicans
.
Yeast
25
:
433
–
448
.
et al. . (
2005
)
A human-curated annotation of the Candida albicans genome
.
PLoS Genet
1
:
36
–
57
.
(
2004
)
Chromosome 1 trisomy compromises the virulence of Candida albicans
.
Mol Microbiol
51
:
551
–
565
.
(
2006
)
A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans
.
Genetics
172
:
2139
–
2156
.
(
2002
)
Population genomics of drug resistance in Candida albicans
.
P Natl Acad Sci USA
99
:
9284
–
9289
.
(
2006
)
SST2, a regulator of G-protein signaling for the Candida albicans mating response pathway
.
Eukaryot Cell
5
:
192
–
202
.
(
2005
)
Global roles of Ssn6 in Tup1- and Nrg1-dependent gene regulation in the fungal pathogen, Candida albicans
.
Mol Biol Cell
16
:
2913
–
2925
.
(
2004
)
Transcription profiling of cyclic AMP signaling in Candida albicans
.
Mol Biol Cell
15
:
4490
–
4499
.
(
2008
)
Transcript profiling of a MAP kinase pathway in C. albicans
.
Microbiol Res
163
:
380
–
393
.
et al. . (
2004
)
The diploid genome sequence of Candida albicans
.
P Natl Acad Sci USA
101
:
7329
–
7334
.
(
2005
)
Loss and gain of chromosome 5 controls growth of Candida albicans on sorbose due to dispersed redundant negative regulators
.
P Natl Acad Sci USA
102
:
12147
–
12152
.
(
2008
)
Haplotype mapping of a diploid non-meiotic organism using existing and induced aneuploidies
.
PLoS Genet
4
:
e1
.
(
1997
)
Nonfilamentous C. albicans mutants are avirulent
.
Cell
90
:
939
–
949
.
(
2006
)
The long hard road to a completed Candida albicans genome
.
Fungal Genet Biol
43
:
311
–
315
.
et al. . (
2002
)
Transcription profiling of Candida albicans cells undergoing the yeast-to-hyphal transition
.
Mol Biol Cell
13
:
3452
–
3465
.
(
2006
)
Microarrays for studying pathogenicity in Candida albicans
.
Medical Mycology: Cellular and Molecular Techniques
( ed), pp.
181
–
209
.
Wiley Press
,
Hoboken, NJ
(
2005
)
Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans
.
Eukaryot Cell
4
:
298
–
309
.
(
2006
)
Transcript profiles of Candida albicans cortical actin patch mutants reflect their cellular defects: contribution of the Hog1p and Mkc1p signaling pathways
.
Eukaryot Cell
5
:
1252
–
1265
.
(
2001
)
Signaling through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic fungus Candida albicans
.
Mol Biol Cell
12
:
3631
–
3643
.
(
1990
)
Methods in Yeast Genetics: A Laboratory Course Manual
.
Cold Spring Harbor Laboratory Press
,
York, NY
.
(
2007
)
Chromosome instability in Candida albicans
.
FEMS Yeast Res
7
:
2
–
11
.
(
1994
)
Chromosomal alterations of Candida albicans are associated with the gain and loss of assimilating functions
.
J Bacteriol
176
:
3231
–
3241
.
(
2005
)
Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains
.
Mol Microbiol
55
:
1553
–
1565
.
(
2006
)
Aneuploidy and isochromosome formation in drug-resistant Candida albicans
.
Science
313
:
367
–
370
.
(
2003
)
Evolution of a combinatorial transcriptional circuit: a case study in yeasts
.
Cell
115
:
389
–
399
.
et al. . (
2007
)
Assembly of the Candida albicans genome into sixteen supercontigs aligned on the eight chromosomes
.
Genome Biol
8
:
R52
.
(
2007
)
The zinc cluster transcription factor Tac1p regulates PDR16 expression in Candida albicans
.
Mol microbiol
66
:
440
–
452
.
Author notes
Editor: Frank Odds
© 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons.org/licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact journals.permissions@oup.com
Citations
Views
Altmetric
Metrics
Total Views 1,066
684 Pageviews
382 PDF Downloads
Since 2/1/2017
Month: | Total Views: |
---|---|
February 2017 | 5 |
March 2017 | 4 |
April 2017 | 7 |
May 2017 | 3 |
June 2017 | 2 |
July 2017 | 3 |
August 2017 | 3 |
September 2017 | 2 |
November 2017 | 4 |
December 2017 | 10 |
January 2018 | 14 |
February 2018 | 20 |
March 2018 | 21 |
April 2018 | 11 |
May 2018 | 17 |
June 2018 | 11 |
July 2018 | 10 |
August 2018 | 19 |
September 2018 | 28 |
October 2018 | 5 |
November 2018 | 12 |
December 2018 | 9 |
January 2019 | 6 |
February 2019 | 8 |
March 2019 | 19 |
April 2019 | 30 |
May 2019 | 26 |
June 2019 | 7 |
July 2019 | 6 |
August 2019 | 17 |
September 2019 | 8 |
October 2019 | 14 |
November 2019 | 17 |
December 2019 | 26 |
January 2020 | 17 |
February 2020 | 8 |
March 2020 | 11 |
April 2020 | 5 |
May 2020 | 12 |
June 2020 | 12 |
July 2020 | 12 |
August 2020 | 16 |
September 2020 | 11 |
October 2020 | 7 |
November 2020 | 9 |
December 2020 | 3 |
January 2021 | 11 |
February 2021 | 9 |
March 2021 | 12 |
April 2021 | 8 |
May 2021 | 6 |
June 2021 | 11 |
July 2021 | 12 |
August 2021 | 5 |
September 2021 | 5 |
October 2021 | 8 |
November 2021 | 6 |
December 2021 | 8 |
January 2022 | 17 |
February 2022 | 30 |
March 2022 | 13 |
April 2022 | 13 |
May 2022 | 12 |
June 2022 | 15 |
July 2022 | 11 |
August 2022 | 4 |
September 2022 | 15 |
October 2022 | 22 |
November 2022 | 13 |
December 2022 | 13 |
January 2023 | 7 |
February 2023 | 7 |
March 2023 | 9 |
April 2023 | 8 |
May 2023 | 12 |
June 2023 | 5 |
July 2023 | 6 |
August 2023 | 8 |
September 2023 | 19 |
October 2023 | 14 |
November 2023 | 9 |
December 2023 | 11 |
January 2024 | 9 |
February 2024 | 17 |
March 2024 | 24 |
April 2024 | 12 |
May 2024 | 17 |
June 2024 | 8 |
July 2024 | 23 |
August 2024 | 11 |
September 2024 | 11 |
October 2024 | 13 |
Citations
44 Web of Science
×
Email alerts
Citing articles via
More from Oxford Academic