Diverse, yet-to-be-cultured members of the Rubrobacter subdivision of the Actinobacteria are widespread in Australian arid soils (original) (raw)

Journal Article

,

Key Centre for Biodiversity and Bioresources, Department of Biological Sciences, Macquarie University, Sydney, N.S.W. 2109, Australia

Search for other works by this author on:

,

Key Centre for Biodiversity and Bioresources, Department of Biological Sciences, Macquarie University, Sydney, N.S.W. 2109, Australia

Search for other works by this author on:

,

Key Centre for Biodiversity and Bioresources, Department of Biological Sciences, Macquarie University, Sydney, N.S.W. 2109, Australia

Search for other works by this author on:

,

Key Centre for Biodiversity and Bioresources, Department of Biological Sciences, Macquarie University, Sydney, N.S.W. 2109, Australia

Search for other works by this author on:

,

Key Centre for Biodiversity and Bioresources, Department of Biological Sciences, Macquarie University, Sydney, N.S.W. 2109, Australia

Search for other works by this author on:

Key Centre for Biodiversity and Bioresources, Department of Biological Sciences, Macquarie University, Sydney, N.S.W. 2109, Australia

Search for other works by this author on:

Revision received:

20 May 2000

Published:

01 August 2000

• PDF
• Split View
• • Article contents
  • Figures & tables
  • Video
  • Audio
  • Supplementary Data
• Cite

Cite

Andrew J. Holmes, Jocelyn Bowyer, Marita P. Holley, Madeline O'Donoghue, Meg Montgomery, Michael R. Gillings, Diverse, yet-to-be-cultured members of the Rubrobacter subdivision of the Actinobacteria are widespread in Australian arid soils, FEMS Microbiology Ecology, Volume 33, Issue 2, August 2000, Pages 111–120, https://doi.org/10.1111/j.1574-6941.2000.tb00733.x
Close

Navbar Search Filter Mobile Enter search term Search

Abstract

Phylogenetic analyses of ribosomal RNA gene sequences (rDNAs) retrieved from an Australian desert soil sample (Sturt National Park) revealed the presence of a number of clones which branched deeply from the high GC Gram-positive division line of descent. The most abundant group of these clones were related to Rubrobacter. An oligonucleotide probe was designed to have broad specificity to Rubrobacter and relatives. This probe was used to interrogate eight rDNA libraries representing four distinct land forms within the Australian arid zone. Relative abundance of _Rubrobacter_-relatives in these samples ranged from 2.6 to 10.2%. Clones from these libraries were selected for sequence analysis on the basis of a heteroduplex mobility assay to maximise the diversity represented in the sample. Phylogenetic analyses of these rDNA clones and _Rubrobacter_-related clones reported in the literature show strong support for three distinct groups. Database-searching revealed ‘Rubrobacteria’ were relatively abundant in a number of published soil rDNA libraries but absent from others. A PCR assay for group-1 ‘Rubrobacteria’ was used to test for their presence in 21 environmental samples. Only marine and arid-zone soil samples gave positive PCR results. Taken together these results indicate ‘Rubrobacteria’ are a widespread group of variable abundance and diversity.

1 Introduction

Understanding the distribution and diversity of microbiota is arguably the most fundamental knowledge gap in biological science. Historically, microbial diversity assessment methods have not met the criteria for study of community structure. Culture-based approaches to assessing microbial diversity are not guaranteed to ‘capture’ a representative set of organisms for any system or process under study. This limitation has been largely overcome by use of PCR-mediated cloning of ribosomal RNA genes (rDNA) for assessment of bacterial diversity [1,2]. For the first time it is theoretically possible to obtain a representative sample of bacterial diversity. For the purposes of this paper we will refer to organisms known only from a rDNA sequence as ‘riboclones’.

The vast majority of rDNA diversity studies have found very high riboclone diversity. This diversity has included riboclones representative of ‘new’ microbiota at all scales, from high similarity with cultured strains to high divergence. In many cases new lineages within the bacterial domain have been reported [3]. An understanding of the ecological significance of riboclones (especially the ‘new’ lineages) is a major goal of microbiologists. Most strategies aimed at characterising these yet-to-be-cultured organisms have employed a comparative approach. Such approaches have included examination of the effects of manipulating nutrient supply or environmental conditions, and mapping distribution of members of a group along environmental gradients [4–7]. Adequate classification of riboclones is perhaps the greatest restriction to more widespread application of these approaches. The major limitations are the lack of suitable reference taxa (sequences) for phylogenetic tree construction, inability to compare sequenced regions for many clones, and relatively small sampling effort of most gene libraries.

The problems are exemplified by the case of the Acidobacterium division (kingdom). Divergent soil clones were reported in the first soil clone library by Liesack and Stackebrandt [8], and distant relatives of these have been reported from most subsequent molecular diversity studies. However it was not until recently that the relationship of these to Acidobacterium, and the delineation of at least six subdivisions within the group was clarified [3,9,10]. This improved knowledge of the phylogenetic relationships of the group has led to the ecologically significant observation that different subgroups occur in distinct habitats [11]. It is now clear that representatives of this division are an important component of soil microbiota, with at least one subgroup being present (and often abundant) in the majority of soil samples.

The high GC Gram-positive division (Actinobacteria) is well-represented in culture and is one of the better-defined phylogenetic groups of bacteria, allowing their ready recognition in environmental clone libraries [3,12]. The group does however include a number of poorly known genera, which are highly divergent with respect to all other members of the division and have been considered to represent separate subclasses [12]. Phylogenetic definition of these subclasses is more problematic. These subclasses include Rubrobacteridae, Acidimicrobidae, Sphaerobacteridae, and Coriobacteridae, each represented by a single, or very few, strain(s) [13–16].

In addition to these ‘atypical’ genera the phylogenetic structure of the Actinobacteria has been complicated by the discovery of riboclones which branch deeply from the Actinobacteria line of descent. Many of these deeply branching high GC riboclones show a moderate relationship to Acidimicrobium and _Rubrobacter_[17–20] but do not contain signature nucleotide pairs proposed to define these subclasses [12]. The available literature suggests a parallel with the case of the Acidobacteria [11]; widespread, numerically abundant groups of organisms are not readily recognised due to the limitations of the sequence database.

During a recent survey of bacterial diversity in Australian desert soils we recovered a large number of clones which branched deeply from the Actinobacteria line of descent. Many of the desert soil clones were found to show close relationship (>92% identity) to Rubrobacter. The abundance of similar riboclones in our soil samples prompted us to further examine the phylogenetic structure of Rubrobacter and relatives, their relationship to the Actinobacteria, and environmental distribution.

2 Materials and methods

2.1 Sample collection

Soil samples were taken from locations representing a variety of habitats within New South Wales, Australia. Eight samples were collected within four landforms in Sturt National Park (N.P.). For all Sturt N.P. samples a soil core (7×10 cm) was removed from the ground. From the wall of the hole a sample core (1×5 cm) was taken horizontally at 5 cm depth. The soil sample (ca 10 g) was frozen within 10 h and transported back to the laboratory in Sydney. The sample was homogenised in a sterile mortar and pestle before removal of 400 mg for DNA extraction. Water samples were collected from a freshwater Creek in the Macquarie University Ecology Reserve (MUER) and Shelley Beach, Manly, N.S.W., Australia. Two litres of seawater or one litre of freshwater were filtered onto a 0.22-μm membrane (Millipore, Bedford, MA, USA). Cells were recovered in 1 ml TE buffer and transferred to a multimix (Bio101, Vista, CA, USA) tube for DNA extraction.

Total DNA was extracted from 400 mg or 500 μl aliquots using the Fastprep procedure. Cell lysis in this method is achieved by a bead beating method and DNA purified by binding to a silica matrix. The protocol is described fully in Yeates and Gillings [21]. Final yield of DNA in 160 μl was estimated as 2.5 μg from soil samples and 1.5 μg from water samples. Average molecular mass of the DNA was >10 kb.

Additional samples representing sediments (Hunter river, Colo river), forest soil (Lidsdale Pine plantation, Lidsdale Eucalypt forest, MUER), and industrially contaminated soil (Balmain, Homebush bay) were obtained as purified nucleic acids from colleagues at Macquarie University. These samples were provided by Nanda Altavilla, (Colo and Hunter river sediment samples), Christine Yeates (Lidsdale, Balmain, Homebush bay), or teaching projects (MUER).

2.2 PCR and construction of 16S rDNA clone libraries

2.2.1 Total bacterial diversity libraries

Bacterial 16S rRNA genes were amplified from the soil samples using the primer set f27, r1492 [21]. Briefly, amplification mixes consisted of 5 ng template DNA, 50 pmol of each primer, 200 nM dNTP, 2 mM MgCl2, and 1 U of Red Hot DNA polymerase (Advanced Biotechnologies, Surrey, UK) in the reaction buffer supplied with the enzyme. After initial thermal denaturation, PCR was performed for 30 cycles of 94°C, 1 min; 60°C, 45 s; 72°C, 80 s. The PCR amplicons were ligated into the pCRII vector supplied with the T/A cloning kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturers instructions. Ligation mixtures were transformed into INVαF competent cells supplied with the T/A cloning kit and plated onto LB agar plates containing x-gal.

White colonies were picked directly into 100 μl LB broth (kanamycin/ampicillin, 50 μg ml−1) in 384-well microtitre trays (Nunc, Naperville, IL, USA) using toothpicks. Clones were stored by addition of 50 μl of 50% glycerol in LB medium and storage at −70°C. Approximately 10 000 clones were picked from the OD#0319 library and 1000 clones each from the remaining libraries. Clone designations are in the form: sample number/tray number-row number, column number (e.g. #0319/7-H,2).

2.2.2 Rubrobacteria libraries

A nested PCR was performed to specifically target ‘Rubrobacteria’ in environmental samples. Near full-length 16S rDNA PCR products were amplified as described above. The PCR products were purified by ethanol precipitation and resuspended in TE buffer to 25 ng μl−1. 50 ng was used as template for amplification using the primer set f27/Rubro749r (CTTTCGCGTCTCAGCGTCAGG). PCR was 35 cycles of 94°C, 30 s; 65°C, 1 min; 72°C, 90 s with a final extension at 72°C for 5 min. The PCR product from selected samples was cloned using the T/A kit (Invitrogen, Carlsbad, CA, USA) as described above.

2.3 RFLP analysis of 16S rDNA clones

Digests were performed on PCR products amplified directly from soil as described above or on products amplified from cloned rDNA fragments of interest. The latter products were generated by direct amplification from glycerol stocks of selected clones using the primers PCRr (CGCCAGTGTGATGGATATCT) and PCRf (AACGGCCGCCAGTGTGCTGG). These primers target regions of the vector flanking the cloning site. Each reaction mix contained 5 μl cell suspension, 50 pmol of each primer, 2 mM MgCl2, and 1 U Red Hot DNA polymerase. In each case 10 μl of PCR product was digested with _Hin_fI (Promega, Madison, WI, USA) in a volume of 20 μl according to the manufacturers instructions. Digests were electrophoresed on 2% agarose gels and stained with ethidium bromide.

2.4 Sequencing of clone inserts

Plasmids were purified from overnight cultures of selected clones using Wizard minipreps (Promega, Madison, WI, USA). The DNA sequence was determined using cycle sequencing and dye-terminator chemistry. Primers for sequencing reactions were f27, r519, r1492 [22] and r910 (CCCCGTCAATTCMTTTGAG). Sequencing was done at the Westmead hospital facility or the Macquarie University facility.

2.5 Colony hybridisation to identify Rubrobacter clones

Clone libraries were inoculated from the 384-well glycerol stock trays directly onto Hybond-N membrane (Amersham, Piscataway, NJ, USA) using the Nunc replicator system. Nylon membranes were cut to size and overlaid on LB agar (containing kanamycin and ampicillin at 50 μg ml−1) trays. Three or four 384-well plates were inoculated onto a single membrane using a 384-pin replicator. The trays were incubated overnight at 37°C yielding up to 1536 colonies per membrane. Colonies were lysed by two treatments of laying the filters on 1 ml of lysis solution (0.5 M NaOH) for 10 min, followed by two treatments of laying filters on 1 ml neutralising solution (1 M Tris–HCl, pH 8) for 10 min. Filters were then air-dried and DNA fixed by exposure to UV light (254 nm) for 1 min.

Membranes were incubated in pre-hybridisation buffer (6×SSC, 0.1 mg ml−1 herring sperm DNA, 0.5% SDS, 0.1% Blotto) at 50°C for 30 min. 20×SSC stock solution (3 M NaCl, 0.3 M Sodium citrate, pH 7) and Blotto stock solution (5% skim milk powder, 0.02% Sodium azide in water). Pre-hybridisation buffer was then discarded and replaced with 30 ml of hybridisation buffer (6×SSC, 0.5% SDS). The Rubro749r oligonucleotide probe (30 pmol) was end-labelled with 32P, added to the tube and hybridised at 45°C for 1 h. Filters were washed once at 52°C for 30 min and once at 55°C for 30 min in wash buffer (2×SSC, 0.5% SDS) before autoradiography.

2.6 Heteroduplex mobility assay (HMA)

HMA experiments were performed with DNA fragments from two different regions of the 16S rDNA. Short (ca 350 bp) fragments of cloned 16S rDNA were amplified using the primer pairs f27/r339 (CTGCTGCCTCCCGTAGGAG) (partial 16S clones from _Rubrobacter_-specific PCR) or f536 (CAGCMGCCGCGGTAATAC)/r910 (full-length 16S clones). PCR products were purified by ethanol precipitation and resuspended in TE buffer to a final concentration of 50 ng μl−1. Heteroduplex annealing reactions consisted of 2 μl (100 ng) of each PCR product plus 16 μl of annealing buffer (50 mM KCl, 10 mM Tris–HCl, pH 8.5) overlaid with one drop of paraffin oil. The sample was denatured by heating to 98°C for 10 min in a thermocycler and then left to anneal for 1 h at room temperature. Annealed heteroduplex mix (2 μl) was loaded on a polyacrylamide gel (8% polyacrylamide (19:1), 4 M Urea, 1×TBE). Gels were cast in Mini Protean II system (Bio-Rad, Hercules, CA, USA). Gels were pre-electrophoresed for 20 min at 160 V before loading. Running conditions were 150 V for 100 min. DNA bands were visualised with a silver diamine stain [23].

A measure of heteroduplex mobility retardation (D) was calculated from the formula:

Where _d_He and _d_Ho are the electrophoretic migration distance for the heteroduplex and homoduplex bands respectively. In most cases two heteroduplex bands were observed. The mobility of the heteroduplex was taken as the average of the two heteroduplex bands. The percentage identity between heteroduplex pairs was estimated from a standard curve of D plotted against known sequence identity [23]. The same standard curve was used for both rDNA regions.

2.7 Sequence analysis

Sequence analyses were performed using programs available in the ARB software package, Ribosomal Database Project, and phylogeny inference package (PHYLIP). Sequence alignments were initially performed with the Sequence aligner v2.0 in ARB. Alignments were then ‘fine-tuned’ manually using the ARB editor. Phylogenetic analyses were performed using both distance matrix and parsimony methods with programs available in ARB [24] or PHYLIP [25]. Reference sequences in phylogenetic analyses included representatives of all subgroups within the high GC division, two to four representatives each of other bacterial divisions, and environmental clone sequences which gave significant BLAST matches to Rubrobacter sequence fragments (27–500 E. coli numbering).

2.8 Accession numbers

Sequences reported in this paper are included in a deposition to the GenBank database under the accession numbers AF234035–AF234156.

3 Results

3.1 Abundance of _Rubrobacter_-like clones in desert soil gene libraries

A bacterial 16S rDNA gene library was constructed from soil sample OD#0319 (Olive Downs landform, Sturt N.P., N.S.W., Australia). A random selection of 38 clones from the library was sequenced and characterised by phylogenetic analysis (Holmes et al., unpublished data). Four of these clones were found to show significant relationship to Rubrobacter radiotolerans. Sequence homology of these clones to R. radiotolerans over 400 bp ranged from 90 to 94%. Together with the two described species of Rubrobacter, these clones formed a very robust, phylogenetically distinctive group (data not shown), branching very deeply from the High G+C division line of descent (Actinobacteria, sensu Stackebrandt et al. [12]).

To confirm the high abundance of Rubrobacter in our desert soil samples we designed a phylogenetic group-specific probe for enumeration of members of this group within the gene libraries. Comparison of aligned Rubrobacter sequences with other 16S rRNA sequences revealed a number of sequence regions unique to Rubrobacter. In order to maximise the chance of identification of relatives of this group a _Rubrobacter_-specific region of high conservation index [26] was selected as the target site for a probe. Conditions for probe specificity were determined empirically by hybridisation against colony blots of a suite of cloned 16S rDNA genes from soil bacteria spanning the range of two to four mismatches. None of the negative control clones bound the probe at 51°C and the probe washed off the positive control #0319/7-H2 at 58°C.

Hybridisation of the Rubro749r probe to the high density filters of the OD#0319 16S rDNA gene library under stringent conditions detected 791 probe-positive clones. The universal probe U531f [22] was used as a control to correct for false positive clones which may have been transferred to the filters and clones which failed to grow on the filter. This probe bound 7997 clones, giving an estimated relative abundance of Rubrobacter and relatives within the OD#0319 gene library of 9.9%. The relative abundance of the Rubrobacter group was also assessed in libraries constructed from soil samples representing other soil and vegetation types within Sturt N.P. Relative abundance ranged from 2.6 to 10.2% (Table 1).

1

Relative abundance of Rubrobacter-group riboclones in Sturt desert soil gene libraries

aNo. of clones screened in Sturt N.P. samples represents the number of filter-bound clones positive with a universal probe (Eub 531f) control.

bProbe accuracy represents the percentage of probe-positive clones predicted to belong to the same phylogenetic group (division) as a Rubrobacter reference when tested by HMA.

1

Relative abundance of Rubrobacter-group riboclones in Sturt desert soil gene libraries

aNo. of clones screened in Sturt N.P. samples represents the number of filter-bound clones positive with a universal probe (Eub 531f) control.

bProbe accuracy represents the percentage of probe-positive clones predicted to belong to the same phylogenetic group (division) as a Rubrobacter reference when tested by HMA.

3.2 HMA screening of clone diversity

The specificity of the probe identification of clones in these gene libraries was assessed by HMA of representative probe-positive clones from each library. Estimated sequence identities between probe-positive clones and the Rubrobacter reference (OD#0319/7-H2) ranged from 69 to 100%, with the majority of clones (25/27) having predicted identities of >79% (Table 2). This is consistent with probing results across the eight libraries yielding highly specific detection of a broadly related, but phylogenetically coherent group of organisms.

2

Phylogenetic affiliation of Rubro749r positive clones retrieved from Sturt soil libraries

aFor the unsequenced clones this is predicted from HMA results.

2

Phylogenetic affiliation of Rubro749r positive clones retrieved from Sturt soil libraries

aFor the unsequenced clones this is predicted from HMA results.

To confirm the predictions of the HMA and expand the phylogenetic depth of our sequence collection, clones representing the predicted sequence divergence within the group were selected for sequencing and further analysis. The correlation between predicted sequence identity by HMA and the genuine value determined from sequence comparison was found to be very close (Table 2). All sequences with >79% identity to the Rubrobacter reference were found to be phylogenetically affiliated with the High GC division. One of these was found to be a member of the Actinobacteridae [12] while the remainder were branched deeply within the Actinobacteria showing closest relationship to the Rubrobacter group (see below). Of the 27 Rubro749r-positive clones screened by HMA only two (OD#0649/1-D14, RO#0425/2-L16) showed highly divergent sequences. These clones did not yield a product when retested with the Rubro749 probe in a PCR assay (data not shown). It is probable that the filter co-ordinates for these two colonies were incorrectly identified from the filter hybridisation experiments, resulting in retrieval of the wrong clones. This was not further tested.

3.3 Phylogenetic structure of the Actinobacteria

Riboclones for complete sequence determination were chosen on the basis of HMA similarity to OD#0319/7-H2. These included OD#0319/7-H2, RO#0425/2-M17 (79%), OD#0649/1-G9 (83%), and OD#0649/1-N15 (84%). Additional riboclones were partially sequenced. In all analyses based on near complete 16S rRNA sequences, the four completely sequenced riboclones clustered together with Actinobacteria. The Actinobacteria comprised at least four well-resolved subdivisions corresponding to the subclasses defined by Stackebrandt et al. [12]. These included Streptomyces and relatives (Actinobacteridae), Acidimicrobium and relatives (Acidimicrobidae), Atopobium and relatives (Coriobacteridae), and Rubrobacter and relatives (Rubrobacteridae). The ‘Rubrobacteria’ formed a discrete group which included: the described Rubrobacter species, riboclones retrieved from a German peat bog [17], and three of the desert soil riboclones. This group constituted the deepest branch of the Actinobacteria line of descent (Fig. 1). Clone RO#0425/2-M17 also clustered with the Actinobacteria but showed no significant relationship to any of the major subdivisions.

1

Neighbour-joining tree showing the relationship of deep-branching desert soil clones to the Actinobacteria. The tree was constructed from analysis of 1091 nucleotides corresponding to bases between E. coli positions 132 and 1399. Diamonds represent branches with >75% bootstrap support, open diamonds branches with >50% support and open circles are branches which appeared in all analyses, but with low bootstrap support. Sources of peat bog environmental clone sequences are described in Rheims et al. [17].

3.4 Environmental distribution of Rubrobacteria

To further expand the known diversity of ‘Rubrobacteria’ sequences we attempted to recover riboclones from a broad spectrum of environments; including soil, sediment, and water samples. A PCR assay designed to be specific for ‘Rubrobacteria’ was developed using the Rubro749r probe in conjunction with the bacteria-specific primer f27 [22]. The PCR assay was tested with a collection of soil clones retrieved from Sturt soil gene libraries, representing ribostrains with 0–4 mismatches to the Rubro749r target site.

The specificity of the PCR assay for recovery of Rubrobacter sequences directly from environmental samples was initially evaluated by restriction digestion of PCR products amplified from the Sturt soil DNA samples. The PCR products from these soil samples were dominated by _Hin_fI fragments of 410 and 340 bp, the same size fragments as produced from ‘Rubrobacteria’ riboclones retrieved from these samples (data not shown). In combination with the probing results (Table 1), these data suggested the PCR was highly specific. The _Rubrobacter_-specific PCR assay was then used to survey for the presence of ‘Rubrobacteria’ in a variety of other habitats. A PCR product was obtained from all habitats examined. _Hin_fI digests of the PCR products showed considerably greater variation in digest products than was observed for the products obtained from Sturt soil DNA samples.

To assess the specificity of the PCR assay in these new samples the PCR product was cloned from a marine (Shelley beach), a freshwater sediment (Hunter river), and a forest soil (Lidsdale pine) sample. A total of 45 clones, representative of diversity within these libraries, was analysed by the HMA to screen for the presence of Rubrobacter group members. Only the Shelley Beach marine library included sequences with high similarity to Rubrobacter (data not shown). Selected clones from each library were partially sequenced to establish the phylogenetic relationship of the cloned sequences.

3.5 Phylogenetic structure of the Rubrobacteria

A series of phylogenetic analyses were performed on partial 16S rRNA sequences; including all deep-branching Actinobacteria desert soil riboclones, the Rubrobacteria-specific PCR riboclones and published _Rubrobacter_-like riboclones from other workers. Gene libraries representing bacterial communities in agricultural soil [20], peat [17], pasture soil [19], forest soil [8], and a bioreactor [27] all contained Rubrobacteria. The results reveal three distinct sub-groups within the ‘Rubrobacteria’ and considerable diversity within the Actinobacteria (summarised in Table 3 and Fig. 2). These subgroups of the ‘Rubrobacteria’ are termed group-1 (type sequence: R. radiotolerans), group-2 (type sequence: peat clone TM36), and group-3 (type sequence: soil clone OD#0649-1G9). Interestingly the ‘Rubrobacteria’ subgroups were not evenly represented in published environmental clone libraries. The desert soil samples reported in this study overwhelmingly comprised group-1 Rubrobacteria, in contrast to the soil studies of Ueda et al. (group-3) [20], Rheims et al. (group-2) [17] and McCaig et al. (groups-2 and 3) [19].

3

Rubrobacteridae signature nucleotides present in 16S rDNA clones known to be phylogenetically related to R. radiotolerans

aOnly partial sequence available – nucleotide at all signature positions not known.

bAs defined by Stackebrandt et al. [22]. The symbol ‘+’ indicates presence of the signature.

cThe clone is a probable chimaera.

3

Rubrobacteridae signature nucleotides present in 16S rDNA clones known to be phylogenetically related to R. radiotolerans

aOnly partial sequence available – nucleotide at all signature positions not known.

bAs defined by Stackebrandt et al. [22]. The symbol ‘+’ indicates presence of the signature.

cThe clone is a probable chimaera.

2

Neighbour-joining tree representing the phylogenetic diversity among known Rubrobacteria. The tree was constructed from analysis of 329 nucleotides corresponding to E. coli numbers 93–436. The sources of clones are described in the following references: peat bog [17], Sludge [27], Scottish soil [19], forest soil [8]. *Clone #0649/1-N,15 is a probable chimaera, the break point lying within the sequence fragment used to construct this tree. The 3′ portion of this sequence (ca 1100 nucleotides) forms a strongly supported branch with the group-2 ‘Rubrobacteria’ as shown in Fig. 1.

Signature nucleotide pairs for the subclass Rubrobacteridae had been tentatively proposed on the basis of positions which were uniquely present in the type species _R. radiotolerans_[12]. These signatures should be considered as diagnostic for group-1 ‘Rubrobacteria’. They have limited value in identification of Rubrobacteridae in environmental clone libraries as both group-2 and group-3 sequences showed several exceptions (Table 3).

OD#0649/1-N15 is potentially a chimeric clone. Analyses using the RDP Chimera-Check program did not give conclusive evidence, however this may reflect the paucity of complete sequences from ‘Rubrobacteria’ in the RDP. In trees constructed with different portions of the 16S rRNA, this riboclone branched with either group-1 or group-2 Rubrobacteria. Support for these relationships was much higher than when a full-length sequence was included in the analysis.

As predicted from HMA results, the marine clones showed relationship to group-1 Rubrobacteria. The clones retrieved from forest and sediment samples using group-specific PCR were not found to show any relationship to the Rubrobacteria. In both cases the riboclones showed a relationship to either the Actinobacteria or Planctomycetales divisions (data not shown).

4 Discussion

The high GC division (class Actinobacteria) of bacteria is a diverse group that encompasses strains with uncertain phylogenetic affiliation to other Actinobacteria. The vast majority of cultivated representatives of this division (including Streptomyces, Nocardia, Rhodococcus, Arthrobacter, and Mycobacterium) form a well-supported monophyletic group in 16S rRNA analyses [12]. This group has been proposed as a subclass, the Actinobacteridae. In contrast, the genera Atopobium, Acidimicrobium, Coriobacterium, ‘_Microthrix_’, and Rubrobacter are all represented by one, or a few strains, and diverge from the Actinobacteria line of descent before the main radiation. The paucity of strains and divergent nature of these organisms means their relationships to each other are not defined. The apparent abundance of _Acidimicrobium_- and _Rubrobacter_-like bacteria in some environments makes these groups of particular interest. In this study we used a combination of phylogenetic group-specific probes and heteroduplex mobility analysis to recover a representative collection of _Rubrobacter_-like riboclones. The HMA showed a very high correlation with sequence identity. The capacity to predict the level of phylogenetic affiliation from HMA data makes it a very efficient tool for screening diversity of gene libraries [23].

Phylogenetic analysis of sequence data from desert soil clones revealed the existence of a diverse, deep-branching monophyletic group which included the described strains R. radiotolerans and Rubrobacter xylanophilus. The ‘Rubrobacteria’ comprise three well-supported subgroups. The group-1 ‘Rubrobacteria’ fit the definition of the Rubrobacteridae proposed by Stackebrandt et al. [12]. Whilst studies from different continents have reported riboclones clustering with the ‘Rubrobacteria’ group, there are also a number of soil library studies in which representatives of this group appear to be absent, most notably the relatively extensive studies of Bornemann and colleagues [28,29]. In the present study, group-1 ‘Rubrobacteria’ were clearly a dominant group in the desert soil libraries and were also found in the seawater samples. In contrast, groups 2 and 3 ‘Rubrobacteria’, which have been widely reported at high relative abundance in other soil studies [17,19,20], were comparatively rare. Representatives of these latter groups were only found by screening large numbers of clones with a phylogenetic group-specific probe and HMA. It is unlikely they would have been detected by random sampling of our desert soil libraries. The ‘Rubrobacteria’ are a geographically widespread group but do not appear to be ubiquitous, at least at the level of resolution afforded by randomly sampling of approximately 100 clones from gene libraries.

This variability in detection could reflect differences in methodology, sequencing effort, or underlying variation in the relative abundance of ‘Rubrobacteria’. Studies in which ‘Rubrobacteria’ have been recorded have employed a variety of DNA extraction methods and amplification protocols [8,17,19,20]. The studies by Bornemann et al. [28,29] did not record Rubrobacteria and employed a different primer set to that used in most other studies, however available ‘Rubrobacteria’ sequences do represent suitable targets for these primers. Collectively these data do not suggest the recovery of ‘Rubrobacteria’ is dependent on any specific set of methods, but rather is more likely to reflect variability in the abundance of Rubrobacteria-derived PCR products and the sequencing effort. This is supported by the relative abundance of ‘Rubrobacteria’ in our Sturt soil libraries. In this respect the ‘Rubrobacteria’ differ from the group A Acidobacteria (subdivisions I and II), a group of similar phylogenetic breadth which is commonly abundant in soil gene libraries and apparently ubiquitous in soils [11].

A PCR assay for Rubrobacter relatives was developed to increase the sensitivity of detection for a more extensive environmental survey. On the basis of filter hybridisation results it was hoped the assay would target all members of the ‘Rubrobacteria’ subdivision. As more sequence data was collected and phylogenetic analyses were completed, it became clear that group-2 and group-3 ‘Rubrobacteria’ have a 3′ G:A mismatch to the Rubro749 probe. This mismatch is not sufficiently destabilising to prevent hybridisation of the probe to filter-bound DNA under the conditions used but does impair amplification of the target sequence. Therefore, the PCR assay described in this study selectively targets group-1 ‘Rubrobacteria’, despite the capacity of the Rubro749r probe to bind group-2 and 3 ‘Rubrobacteria’ in filter hybridisations at high stringency. The assay was demonstrated to be highly specific in the desert soil samples but not in other environments. The lack of specificity of the Rubro749 PCR assay in new samples highlights the dangers of application of phylogenetic group-specific probes to determine environmental distribution. The observation of non-specific amplification only in sediment and forest soil samples probably reflects a combination of absence of group-1 ‘Rubrobacteria’ from these samples and non-specific amplification due to use of a universal forward primer in the assay.

The data from the PCR survey indicate that there is also variation in the relative abundance of Rubrobacteria subgroups. This may reflect specialisation by ‘Rubrobacteria’ for niches which show greater soil-to-soil variation. Some notable distinctions between the four desert soils studied here and other soils are the comparative paucity of rhizosphere habitat and greater temperature variation in the sparsely vegetated desert soils. It would be of great interest to explore this further using phylogenetic group-specific probes resolving the different subgroups. At present this approach is limited by the paucity of full-length sequences for group-3 representatives from which to design subgroup-specific probes. This highlights the importance of adequate resolution of biological relationships and compilation of a representative sequence database before attempting comparative ecology.

In this study the phylogenetic relationships of deep-branching Actinobacteria riboclones has been explored. It is clear that deep-branching lineages of the Actinobacteria are under-represented in sequence databases and still remain to be fully circumscribed. It is probable that this group is at least as diverse as the known Proteobacteria in terms of phyletic depth if not also physiological mode. Autecological studies of these groups should consider phylogenetic structure within the groups to facilitate recognition of ecological patterns. The Rubrobacter line-of-descent includes three distinct subgroups, of which groups 2 and 3 are exclusively represented by riboclones. A hierarchical classification of the Actinobacteria has been proposed in which relatives of R. radiotolerans belong to the Rubrobacteridae [12]. Only group-1 ‘Rubrobacteria’ contain all proposed signature nucleotides for this subclass. Despite the relative abundance of group-1 ‘Rubrobacteria’ across a broad spectrum of Australian arid-zone soils, members of this group had not previously been reported in molecular sequence studies of bacterial diversity and were not detected in Australian soils from higher rainfall zones. The ‘Rubrobacteria’ are an intriguing group whose distribution may reveal previously unknown patterns in soil biology.

Acknowledgements

We thank Nanda Altavilla and Christine Yeates for provision of DNA samples and Ian Oliver, Andrew Beattie, Mark Dangerfield, Tony Pik, and the N.S.W. National Parks and Wildlife Service for assistance in collection of soil samples. This work was supported by an ARC Key Centre grant and the Resource and Conservation Assessment Council of N.S.W. This is publication 317 from the Key Centre for Biodiversity and Bioresources, Macquarie University.

References

[1]

(

1998

)

Microbial evolution, diversity and ecology: a decade of ribosomal RNA analysis of uncultivated microorganisms

.

Microb. Ecol.

35

,

1

–

21

.

[2]

(

1997

)

A molecular view of microbial diversity and the biosphere

.

Science

276

,

734

–

740

.

[3]

(

1998

)

Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity

.

J. Bacteriol.

180

,

4765

–

4774

.

[4]

(

1996

)

Molecular analysis of enrichment cultures of marine methane oxidising bacteria

.

J. Exp. Mar. Biol. Ecol.

203

,

27

–

38

.

[5]

(

1996

)

Distribution of sulfate-reducing bacteria in a stratified fjord (Mariager Fjord, Denmark) as evaluated by most-probable-number counts and denaturing gradient gel electrophoresis of PCR-amplified ribosomal DNA fragments

.

Appl. Environ. Microbiol.

62

,

1405

–

1415

.

[6]

(

1999

)

Comparative diversity of ammonia oxidizer 16S rRNA gene sequences in native, tilled, and successional soils

.

Appl. Environ. Microbiol.

65

,

2994

–

3000

.

[7]

(

1998

)

A natural view of microbial diversity within hot spring cyanobacterial mat communities

.

Microbiol. Mol. Biol. Rev.

62

,

1353

–

1370

.

[8]

(

1992

)

Occurrence of novel groups of the domain bacteria as revealed by analysis of genetic material isolated from an Australian terrestrial environment

.

J. Bacteriol.

174

,

5072

–

5078

.

[9]

(

1997

)

Diverse uncultivated bacterial groups from soils of the arid southwestern United States that are present in many geographic regions

.

Appl. Environ. Microbiol.

63

,

3614

–

3621

.

[10]

(

1997

)

Detection and in situ identification of representatives of a widely distributed new bacterial phylum

.

FEMS Microbiol. Lett.

153

,

181

–

190

.

[11]

(

1999

)

Wide distribution and diversity of members of the bacterial Kingdom Acidobacterium in the environment

.

Appl. Environ. Microbiol.

65

,

1731

–

1737

.

[12]

(

1997

)

Proposal for a new hierarchic classification system, Actinobacteria classis nov

.

Int. J. Syst. Bacteriol.

47

,

479

–

491

.

[13]

(

1996

)

Candidatus Microthrix parvicella, a filamentous bacterium from activated sludge sewage treatment plants

.

Int. J. Syst. Bacteriol.

46

,

344

–

346

.

[14]

(

1996

)

Rubrobacter xylanophilus sp. nov., a new thermophilic species isolated from a thermally polluted effluent

.

Int. J. Syst. Bacteriol.

46

,

460

–

465

.

[15]

(

1996

)

Acidimicrobium ferrooxidans gen. nov., sp. nov. – mixed-culture ferrous iron oxidation with Sulfobacillus species

.

Microbiology

142

,

785

–

790

.

[16]

(

1997

)

16S rRNA gene sequence of Rubrobacter radiotolerans and its phylogenetic alignment with members of the genus Arthrobacter, Gram-positive bacteria, and members of the family Deinococcaceae

.

Int. J. Syst. Bacteriol.

47

,

684

–

686

.

[17]

(

1996

)

Molecular biological evidence for the occurrence of uncultured members of the actinomycete line of descent in different environments and geographical locations

.

Microbiology

142

,

2863

–

2870

.

[18]

(

1999

)

Molecular monitoring of an uncultured group of the class Actinobacteria in two terrestrial environments

.

J. Microbiol. Methods

36

,

65

–

75

.

[19]

(

1999

)

Molecular analysis of bacterial community structure and diversity in unimproved and improved upland grass pastures

.

Appl. Environ. Microbiol.

65

,

1721

–

1730

.

[20]

(

1995

)

Molecular phylogenetic analysis of a soil microbial community in a soybean field

.

Eur. J. Soil Sci.

46

,

415

–

421

.

[21]

(

1998

)

Rapid purification of DNA from soil for molecular biodiversity analysis

.

Lett. Appl. Microbiol.

27

,

49

–

53

.

[22]

(

1991

)

16S/23S rRNA sequencing

. In:

Nucleic acid techniques in bacterial systematics

, ( Eds.), pp.

115

–

175

.

John Wiley and Sons

,

Chichester

.

[23]

(

2000

)

Heteroduplex mobility assay as a tool for predicting phylogenetic affiliation of environmental ribosomal RNA libraries

.

J. Microbiol. Methods

, in press.

[24]

(

1996

)

ARB, a software environment for sequence data, 2.1.1 edn

.

Department of Microbiology, Technical University of Munich

,

Munich

.

[25]

(

1993

)

PHYLIP: phylogeny inference package

.

University of Washington

,

Seattle, WA

.

[26]

(

1996

)

A quantitative map of nucleotide substitution rates in bacterial rRNA

.

Nucleic Acids Res.

24

,

3381

–

3391

.

[27]

(

1995

)

Bacterial community structures of phosphate-removing and non-phosphate-removing activated sludges from sequencing batch reactors

.

Appl. Environ. Microbiol.

61

,

1910

–

1916

.

[28]

(

1996

)

Molecular microbial diversity of an agricultural soil in Wisconsin

.

Appl. Environ. Microbiol.

62

,

1935

–

1943

.

[29]

(

1997

)

Molecular microbial diversity in soils from eastern amazonia: evidence for unusual microorganisms and microbial population shifts associated with deforestation

.

Appl. Environ. Microbiol.

63

,

2647

–

2653

.

© 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.

Citations

Views

Altmetric

Metrics

Total Views 1,632

1,014 Pageviews

618 PDF Downloads

Since 1/1/2017

Citations

103 Web of Science

×

Email alerts

Citing articles via

• Latest

• Most Read

• Most Cited

More from Oxford Academic