Identification of Host Genes Involved in Geminivirus Infection Using a Reverse Genetics Approach (original) (raw)
- Loading metrics
Open Access
Peer-reviewed
Research Article
- Tábata Rosas-Díaz ,
- Ana P. Luna,
- Eduardo R. Bejarano
Identification of Host Genes Involved in Geminivirus Infection Using a Reverse Genetics Approach
- Rosa Lozano-Durán,
- Tábata Rosas-Díaz,
- Ana P. Luna,
- Eduardo R. Bejarano
x
- Published: July 26, 2011
- https://doi.org/10.1371/journal.pone.0022383
Figures
Abstract
Geminiviruses, like all viruses, rely on the host cell machinery to establish a successful infection, but the identity and function of these required host proteins remain largely unknown. Tomato yellow leaf curl Sardinia virus (TYLCSV), a monopartite geminivirus, is one of the causal agents of the devastating Tomato yellow leaf curl disease (TYLCD). The transgenic 2IRGFP N. benthamiana plants, used in combination with Virus Induced Gene Silencing (VIGS), entail an important potential as a tool in reverse genetics studies to identify host factors involved in TYLCSV infection. Using these transgenic plants, we have made an accurate description of the evolution of TYLCSV replication in the host in both space and time. Moreover, we have determined that TYLCSV and Tobacco rattle virus (TRV) do not dramatically influence each other when co-infected in N. benthamiana, what makes the use of TRV-induced gene silencing in combination with TYLCSV for reverse genetic studies feasible. Finally, we have tested the effect of silencing candidate host genes on TYLCSV infection, identifying eighteen genes potentially involved in this process, fifteen of which had never been implicated in geminiviral infections before. Seven of the analyzed genes have a potential anti-viral effect, whereas the expression of the other eleven is required for a full infection. Interestingly, almost half of the genes altering TYLCSV infection play a role in postranslational modifications. Therefore, our results provide new insights into the molecular mechanisms underlying geminivirus infections, and at the same time reveal the 2IRGFP/VIGS system as a powerful tool for functional reverse genetics studies.
Citation: Lozano-Durán R, Rosas-Díaz T, Luna AP, Bejarano ER (2011) Identification of Host Genes Involved in Geminivirus Infection Using a Reverse Genetics Approach. PLoS ONE 6(7): e22383. https://doi.org/10.1371/journal.pone.0022383
Editor: Miguel A. Blazquez, Instituto de Biología Molecular y Celular de Plantas, Spain
Received: April 17, 2011; Accepted: June 20, 2011; Published: July 26, 2011
Copyright: © 2011 Lozano-Durán et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was supported by a grant from the Spanish Ministerio de Ciencia y Tecnología (AGL2007-66062-C02-02/AGR and GEN2006-27770-C2). http://www.micinn.es/. R.L.D. was awarded a Predoctoral Fellowship from the Spanish Ministerio de Educación y Cultura. T.R.D. was awarded a Fellowship from the Fundación Carolina. A.P.L. was awarded a Predoctoral Fellowship from Junta de Andalucía. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Geminiviruses are a large family of plant viruses with circular, single stranded DNA genomes packaged within geminate particles [1]. The Geminiviridae family [2] is divided into four genera according to their genome organization and biological properties. The genus Begomovirus includes members that are transmitted by whiteflies, infect dicotyledonous plants, and may have either bipartite or monopartite genomes. Tomato yellow leaf curl Sardinia virus (TYLCSV) is a member of the Begomovirus genus, and is one of the causal agents of the Tomato yellow leaf curl disease (TYLCD), which can cause up to 100% yield losses in tomato fields [3], [4], [5]. TYLCSV has a monopartite genome of 2.8 kb in size, which encodes six proteins and contains an intergenic region (IR) comprising the origin of replication and viral promoters. The open reading frames (ORFs) in the complementary sense orientation encode a replication-associated protein (Rep, also known as C1), a transcriptional activator protein (TrAP, also known as C2), and a replication enhancer protein (REn, also known as C3); a small ORF, C4, is located within the Rep ORF but in a different reading frame. The virion strand contains two ORFs encoding the coat protein (CP) and a small protein named V2 [4], [5].
To establish a successful infection, viruses must create a proper environment for viral propagation, which involves hijacking the cellular machinery for viral functions and, at the same time, preventing or counteracting the plant defence mechanisms. To fulfil these requirements, viral proteins trigger changes in the cell at all levels: transcriptional, translational and posttranslational. Identifying the host genes involved in viral replication, movement, and generally all those processes that lead to the establishment of a successful infection, could provide valuable new targets to ultimately generate viral resistance.
The advances in high-throughput technologies and bioinformatics have made possible to assess gene expression massively, providing an insight into the host's transcriptional responses to viral infections in a genome-wide fashion. These transcriptomic studies, together with proteomic studies, are providing an unprecedented vision of the “host-side” of the plant-virus interaction, leading to the identification of host genes whose function or expression is altered as a consequence of the infection. Geminiviruses have also been recently the subject of this kind of study, unveiling host genes differentially expressed either during the infection [6], [7], [8] or upon expression of a viral protein [8], [9], [10]. However, despite all this information being available, it is still a daunting task to determine the exact role of these host genes in the infection process. Notably, this is particularly challenging in the case of monopartite geminiviruses, in which gene replacement with marker genes is not feasible, and thus are more tedious to monitor. In a previous work, we described the generation of Nicotiana benthamiana transgenic plants containing a GFP (Green fluorescence protein) expression cassette flanked by two repeats of TYLCSV IR as a tool to monitor TYLCSV replication [11]. These plants, named 2IRGFP, entail an important potential as a tool in reverse genetics studies to identify host factors involved in the viral infection, when used in combination with VIGS (Virus Induced Gene Silencing) technology. Although the feasibility of this approach was previously confirmed by silencing the Proliferating cellular nuclear antigen (PCNA) and Sumo conjugating enzyme (SCE1) genes [11], [12], its use in a larger screening required an optimization of the conditions.
In this work, we explore further the potential of 2IRGFP N. benthamiana plants in combination with VIGS to identify host genes with a role in geminivirus infection. We have achieved an accurate description of the dynamics of viral replication by monitoring GFP expression in both space and time, explored the limitations of the strategy to be used in a reverse-genetics screening, and unveiled the effect of silencing selected N. benthamiana genes, most of them previously identified in transcriptomic or protein-protein interaction studies, in geminivirus infection. Using this strategy, we have identified eighteen genes involved in several cellular processes whose silencing alters TYLCSV infection. Notably, for fifteen of these genes this is the first description of a role in viral infections. Hence, our results provide new insights into the molecular mechanisms underlying geminivirus infections, and at the same time reveal the 2IRGFP/VIGS system as a powerful tool for functional reverse genetics studies.
Results
Dynamics of Tomato yellow leaf curl Sardinia virus infection in transgenic 2IRGFP N. benthamiana plants is not altered by co-infection with Tobacco rattle virus
Traditionally, the development of geminivirus infections has been monitored by symptom evaluation and quantification of viral DNA by nucleic acid hybridization or PCR [13], [14]. These methods, however, have important limitations to monitor the infection in both space and time. Symptom evaluation is semi-quantitative at best, and does not necessarily correlate with viral accumulation. Hybridization or PCR studies, on the other hand, are destructive methods that are not able to discriminate if the viral molecules accumulated in a certain plant organ or tissue have been produced in situ or, on the contrary, have been originated elsewhere and subsequently transported. Due to these restrictions, a comprehensive study of the dynamics of the geminivirus infection, considering active replication and not merely virus accumulation, is still lacking.
In a previous work [11], we developed N. benthamiana transgenic plants that overexpress GFP in those cells where the virus is replicating. During TYLCSV infection, these plants, named 2IRGFP, display a Rep-dependent GFP overexpression driven by the generation of mGFP replicons. Since overproduction of GFP correlates with TYLCSV active replication, these plants provide an unprecedented opportunity to monitor TYLCSV infection. For this purpose, 2IRGFP plants were infected with TYLCSV (three independent experiments, 20 plants each), GFP expression was exhaustively monitored and samples were collected at different times post-infection. For each time point, three plants were sampled (one per independent experiment); for each of the sampled plants, the three most apical leaves were taken, and tissue printing was performed with the main root. Total DNA was extracted from the harvested leaves, and both mGFP replicons and viral DNA were detected by DNA hybridization.
According to the extension and intensity of GFP expression in leaves, we visually distinguished five phenotypes, which we named RAP (for Replication-Associated Phenotype) 0, 1, 2, 3 and 4, as depicted in Figure S1. Leaves from uninfected plants show a low expression of GFP extended through the whole leaf surface (RAP0). In RAP1, which corresponds to the first stage of the virus infection, GFP overexpression appears in some of the vascular bundles and the background GFP expression is not extensively silenced. RAP2 represents the stage of maximum GFP accumulation, in which an intense green fluorescence is observed as a continuous pattern through the leaf vascular bundles, and the GFP expression background in the leaf lamina has faded. RAP3 is the last stage in GFP expression, where GFP can only be detected in distinct areas of the leaf vascular bundles, before it completely disappears (RAP4). The average evolution of GFP expression in the leaves of TYLCSV-infected plants is depicted in Figure 1A. At 7 days post-infection (dpi), GFP over-expression associated to RAP1 phenotype can already be observed in some, but not most, plants, and accumulation of mGFP replicons and viral DNA is already detectable (Figure 1B). One week later, at 14 dpi, the maximum levels of viral replication, monitored as GFP overexpression (RAP2), are reached in the most apical leaves. As expected, this increase in GFP correlates with a higher accumulation of mGFP replicons and viral DNA. The RAP2 phenotype is maintained in the apical leaves up to 28 dpi, while GFP silencing is extensively detected from 21 dpi in the rest of the leaves. The decrease in GFP over-expression observed from 35 dpi onwards (Figure 1A) correlates to the reduction of mGFP replicons (Figure 1B); the viral accumulation, however, is high, most likely due to previous rounds of replication. As seen in this figure, TYLCSV is also replicating in the roots between 14 and 35 dpi, as indicated by GFP overexpression. The appearance of GFP in roots correlated with presence of viral DNA in the tissue printing (Figure 1C) until 42 dpi, when no GFP can be observed but accumulation of viral DNA is detected. This viral DNA is most likely the result of previous viral replication in the root, or even in the aerial parts of the plant. It is noteworthy that viral DNA could be detected in roots as early as 7 dpi, before GFP expression is clearly noticeable; bearing in mind that the root is a sink organ, this is probably the result of transport from leaves where the virus is actively replicating (Figure 1B).
Figure 1. Phenotypic and molecular analysis of TYLCSV-infected 2IRGFP N. benthamiana plants.
(A) Evolution of RAP phenotypes in TYLCSV-infected transgenic N. benthamiana 2IRGFP plants. The diagram displays the average RAP phenotypes of leaves and the induction of GFP in roots at different days post-infection (dpi). Leaves containing areas of two different colours indicate an equivalent coexistence of RAP phenotypes in the population. In roots, green colour indicates GFP overexpression. The depicted results are the average of 60 infected plants. The dashed line marks the inoculation point. (B) Detection of episomal replicons (mGFP) and virus (TYLCSV) in leaves of infected plants. DNA was extracted from the three most apical leaves of three independent plants infected with TYLCSV. Undigested DNA was blotted and hybridized with probes specific for mGFP or TYLCSV. Bands representing open circle (oc), supercoiled (sc) or single-stranded (ss) forms of DNA are indicated. (C) Detection of virus (TYLCSV) in roots of infected plants in tissue printing.
https://doi.org/10.1371/journal.pone.0022383.g001
Once an extensive description of the dynamics of TYLCSV infection has been achieved, detecting changes in the timing or pattern of GFP over-expression due to silencing of a given host gene should be easy and reliable. Tobacco rattle virus (TRV)-based silencing vectors have been widely used and offer several advantages over other viral vectors, such as their abilities to mediate VIGS in the absence of TRV-derived symptoms and to target host RNAs in the growing points of plants. To accurately evaluate the impact of TRV infection on the evolution of the RAP phenotype, we monitored the GFP expression in 2IRGFP plants co-infected with TRV and TYLCSV (three independent experiments, 20 plants each). TRV/TYLCSV co-infected plants showed the same pattern of RAP phenotypes described for TYLCSV infected plants; the only detectable difference between single and double infected plants is a slight delay of approximately two days in the appearance of RAP phenotypes.
TYLCSV infection does not revert TRV-induced gene silencing in N. benthamiana
Since several proteins encoded by TYLCSV can function as suppressors of gene silencing (A. P. Luna et al., in preparation), TYLCSV infection might interfere with the TRV-induced silencing. To test this possibility, we evaluated the effect of TYLCSV infection on the silencing of either a GFP transgene or the endogenous Sulfur (Sul) gene. To determine the impact of TYLCSV infection on the silencing of the GFP transgene, N. benthamiana plants constitutively expressing GFP (line 16c) [15], [16] were co-infected with TRV:GFP and TYLCSV or infected with TRV:GFP alone as a control. Infection with TRV:GFP triggered the silencing of the transgene, and this silencing was fully extended by 15 dpi (Figure 2A). Co-infection with TYLCSV did not alter this silencing phenotype, indicating that TYLCSV does not interfere with the TRV-induced GFP silencing (Figure 2A).
Figure 2. Effect of TYLCSV infection on TRV-induced silencing of GFP or Sul.
Leaves from N. benthamiana 16c (A) or 2IRGFP (B) transgenic N. benthamiana plants 15 days after inoculation with TRV:GFP or TRV:Sul, respectively, or co-inoculation with TRV or TRV:GFP/Sul and TYLCSV. (C) Relative amount of TYLCSV DNA determined by quantitative real-time PCR. Values are the mean of five replicates. Bars represent standard error.
https://doi.org/10.1371/journal.pone.0022383.g002
The Sul gene was chosen to evaluate the effect of TYLCSV infection on the silencing of an endogenous gene, for it produces a readily visible phenotype when silenced, derived from its involvement in chlorophyll synthesis [17]. 2IRGFP N. benthamiana plants were co-infected with TRV:Sul and TYLCSV or infected with TRV:Sul alone as a control. Once again, co-infection with TYLCSV did not affect the silencing phenotype of TRV:Sul infected plants (Figure 2B), indicating that TYLCSV does not alter the TRV-induced silencing of this endogenous gene.
Quantification of TYLCSV accumulation using quantitative real-time PCR shows that TRV-induced silencing of either GFP or Sul does not affect TYLCSV accumulation (Figure 2C).
Simultaneous TRV-induced silencing of multiple genes in N. benthamiana plants
One drawback to VIGS is that it very often does not produce a uniform silencing throughout the plant. If the silencing of the gene does not generate a readily visible phenotype, it will be very difficult to distinguish silenced from non-silenced tissues, what would dramatically complicate the interpretation of results. A strategy to compensate for the lack of uniformity of VIGS would incorporate an internal reference to monitor the level of silencing. This system would act as a control for the VIGS vector, marking the silenced areas with a visible phenotype. The use of internal markers for VIGS based in visual phenotypes has been implemented in several plant species and has proven very successful for empowering the method as a tool in reverse genetics. Some works have demonstrated that the simultaneous silencing of several genes is possible by including multiple gene sequences in the same silencing vector [18], [19], [20]. With the aim of developing a visual reporter system to mark silenced areas in N. benthamiana leaves, we decided to follow two different approaches: (i) Test if the silencing triggered by two distinct TRV constructs co-localize, and (ii) Test if the silencing triggered by two different gene sequences cloned in tandem in the same TRV vector co-localize. For these assays we used two gene sequences whose silencing produces a readily visible phenotype: the Sul gene and PCNA [11], [21].
The results obtained are presented in Figure S2. In our system, silencing of the two marker genes does not significantly co-localize when the two TRV clones are co-inoculated in the plant. Only 13.6% of the new leaves in co-inoculated plants displayed both phenotypes, and the percentages of leaves showing each phenotype considered separately are lower than in single inoculations, indicating that co-inoculation apparently leads to a decreased silencing efficiency. A similar effect is observed when both genes are cloned in tandem in the same TRV vector, although the percentage of leaves showing simultaneous Sul- and _PCNA_-silenced phenotypes is slightly higher (20%) (Figure S2). Segregation of the silencing phenotypes warns against the use of this strategy as a marker system for gene silencing in N. benthamiana leaves.
Selection and cloning of candidate genes
As a first step in the identification of host genes required for TYLCSV infection, we made a selection of candidate genes following several criteria: (i) Genes encoding proteins known to physically interact with geminivirus proteins; (ii) Genes exclusively or preferentially expressed in phloematic tissues; (iii) Genes transactivated by the C2 homologue from the geminiviruses Mungbean yellow mosaic virus and African cassava mosaic geminivirus; (iv) Genes involved in cellular processes potentially required for geminivirus infection (Table 1). A total of 114 genes were initially included as candidate genes.
silencing could be reached by expressing a DNA fragment of 21 to 23 nucleotides bearing 100% identity to the target gene [22], this is often not efficient at triggering silencing and longer sequences must be used [22], [23]. The highest efficiency of VIGS appears to be achieved using fragments in the range of 300–500 nucleotides with multiple stretches of more than 23 nucleotides identity [24], [25]. Because of their different sources, our candidate genes belong to different species. Cloning 300–500 bp fragments of the N. benthamiana homologous gene would be the strategy of choice; unfortunately, the N. benthamiana genome has not been sequenced yet and thus the gene sequences are in most cases not available. To circumvent this difficulty, we carried out homology analyses in all selected genes to identify sequences of 300–500 bp conserved in different plant species, including Arabidopsis and tomato. The use of heterologous gene sequences to silence their respective orthologs in N. benthamiana has been previously reported [26]. Chosen sequences were further analysed with Invitrogen Block-iT™ RNAi designer (https://rnaidesigner.invitrogen.com/rnaiexpress/) to localize potential efficient siRNAs within the sequence: the fragment of choice was that containing the largest number of proposed siRNA molecules. The selection process is depicted in the flow diagram in Figure 3.
After this analysis, 54 out of the initial 114 genes were maintained as candidate genes (Table 1). Since the sequence of these selected genes was highly conserved, we decided to use the Arabidopsis cDNAs to generate the VIGS constructs, with the aim of rendering this strategy faster and more homogeneous. We ordered the 42 Arabidopsis cDNA clones that were available at NASC (European Arabidopsis Stock Centre) (Table S1) and the selected 300–500 bp fragment for each cDNA was PCR-amplified and cloned in the TRV RNA2-based VIGS vector pTV00 [27]. The primers used to amplify each fragment are included in Table S1.
Screening of candidate genes in N. benthamiana 2IRGFP plants
Once the time course of TYLCSV infection in 2IRGFP plants had been established, we followed the strategy depicted in Figure 4A to test the potential effect of candidate gene silencing on TYLCSV infection (Table 1). Summing up, we induced gene silencing for each candidate host gene in 2IRGFP plants using TRV constructs, and subsequently infected these plants with TYLCSV. Plants infiltrated with the empty TRV vector and infected with TYLCSV were used as a control; plants infiltrated with the _Sul_-containing TRV vector were used as a control of VIGS efficiency. GFP overexpression was monitored daily from 9 to 15 dpi under UV light.
Figure 4. Screening of candidate genes in 2IRGFP transgenic N. benthamiana plants.
(A) Plants were co-inoculated with a TRV:Gene construct and TYLCSV. GFP expression was monitored daily from 9 to 15 dpi. Five plants were used per construct; experiments were repeated at least twice. (B) GFP expression in the four most apical leaves of 2IRGFP transgenic plants co-infected with TYLCSV and representative TRV constructs. (C) Relative amount of TYLCSV DNA in leaves of plants co-infected with TYLCSV and TRV constructs to induced the silencing of either Coatomer delta subunit (deltaCOP), Heat shock cognate 70 (HSC70), SKP1-like 2 (ASK2), Ubiquitin activating enzyme 1 (UBA1), Lactoylglutathione lyase (GLO1), Putative shikimate kinase (SKL2), RUB-activating enzyme subunit (ECR1), Replication associated protein A (RPA32), Sulfur (Sul) or no gene (empty vector, as control). Viral DNA was quantified by quantitative real-time PCR. Values are the mean of five replicates. Bars represent standard error. The sample of TYLCSV and pTV00 co-infected plants was used as the calibrator, with the expression level of the TYLCSV capsid protein gene set to 1.
https://doi.org/10.1371/journal.pone.0022383.g004
According to the effect of their silencing on TYLCSV infection, measured as time of appearance and intensity of GFP expression, we grouped the tested host genes into three classes: those whose silencing did not cause changes in GFP expression (group A), or those whose silencing promoted earlier (group B) or later/lower/null (group C) GFP expression (Table 1; examples of each class are shown in Figure 4B).
Representative genes belonging to groups A (SKL2, ECR1), B (UBA1, GLO1 and RPA32) and C (HSC70, ASK2, and deltaCOP) were chosen to evaluate the impact of their silencing on TYLCSV infection, measured as viral DNA accumulation. For this purpose, 2IRGFP N. benthamiana plants were co-inoculated with the TRV derivative clones and TYLCSV. At 15 dpi, total DNA was extracted from the pooled three most apical leaves of each plant and the relative amount of viral DNA was determined using quantitative real-time PCR (two independent experiments, 5 plants each**)**. The mean values of TYLCSV accumulation are represented in Figure 4C. As expected from the GFP overexpression data, silencing of UBA1 or GLO1 and silencing of RPA32 tripled and doubled TYLCSV accumulation, respectively. On the other hand, silencing of HSC70 and ASK2 reduced TYLCSV accumulation by 70 and 30%, respectively. Strikingly, silencing of the deltaCOP subunit completely abolished TYLCSV accumulation.
Discussion
Replication dynamics of TYLCSV
Transgenic 2IRGFP N. benthamiana plants have proven to be an accurate and sensitive tool that allows monitoring TYLCSV infection real-time and in a non-destructive manner. Using these transgenic plants, we have been able to describe the dynamics of TYLCSV infection in great detail, determining in which tissues the virus is replicating on an average infection at a certain time. To our knowledge, this is the first description of the replication dynamics of a geminivirus infection in both space and time, as most of the previous studies reflect viral DNA accumulation but not active replication.
According to our results, TYLCSV replication can be detected in leaves placed above the inoculation point at 7 dpi. One week later (14 dpi), viral replication is taking place in the apical leaves of all inoculated plants, where it is maintained at a high level until 28 dpi. From that moment onwards, the rate of viral replication decreases, and eight weeks after the inoculation it is only detectable in limited areas of apical leaves. These observations suggest that the virus is able to maintain the replication of its genome, in the aerial parts of the host plant, only in certain leaves and during a limited period of time. Additionally, the virus is also able to replicate in roots between 14 and 35 dpi. Interestingly, while we observe a direct correlation between the changes in GFP expression and the accumulation of episomal replicons (mGFP), the amount of viral DNA seems to be maintained even when viral replication can no longer be detected. These data suggest that, although both DNA molecules are produced by the same mechanism, mGFP replicons must be degraded whereas the viral DNA is not, maybe as a result of its encapsidation.
Double infection with TYLCSV and TRV does not significantly affect TYLCSV infection or TRV-induced silencing
We have demonstrated that co-infection with TRV does not dramatically affect TYLCSV infection in N. benthamiana. This fact makes it feasible to use TYLCSV in combination with TRV-mediated VIGS as a tool in reverse genetics studies to identify host factors involved in the geminivirus infection. We observed, however, a slight delay in the development of TYLCSV infection when in combination with TRV. This delay makes the use of appropriate controls (co-infection with the empty TRV vector) of special importance for this type of analysis. Although TYLCSV, like all geminiviruses, encodes suppressors of gene silencing (A. P. Luna et al., in preparation), it does not noticeably affect TRV-induced gene silencing in N. benthamiana plants. In agreement with these results, TRV-mediated VIGS has been successfully used in combination with geminiviral infections in tomato in a recent work [28].
Despite our efforts, the attempt to establish a visual reporter system based on the silencing of the Sulfur gene has been fruitless. Although simultaneous silencing of two genes is achieved by both co-infiltration of independent TRV-based constructs or by infiltration with a TRV construct harbouring multiple gene sequences (Figure S2), silencing does not significantly co-localize in any case, and the extension of the silencing of each gene considered independently diminishes (Figure S2). Even though the reasons for this outcome remain obscure, the absence of significant co-localization makes it impractical to use this co-silencing approach as a marker for VIGS. A similar effect of simultaneous silencing in N. benthamiana had been previously described [21].
Identification of host genes involved in TYLCSV infection
Using our reverse genetics approach, based on the use of transgenic 2IRGFP N. benthamiana plants, we have been able to demonstrate that silencing of 18 out of 37 analysed host genes alters TYLCSV infection.
Bearing in mind the limitations of VIGS, and since we have not tested the silencing of those candidate genes in which no effect on TYLCSV infection could be detected (group A), we cannot rule out the possibility that we may have false negatives: some of the tested genes might not have been efficiently silenced, and thus their potential impact on the viral infection would go unnoticed. For this reason, we cannot assess that those tested candidate genes without an obvious effect on TYLCSV infection do not play a role in the viral infection. False positive results, on the other hand, would be more difficult to obtain in our experimental system, and as long as the proper controls are being used we consider the positive results as reliable. In this context, a reasonable concern would be the possibility of silencing unwanted host genes as a consequence of sequence homology with the target host gene. In order to evaluate this undesired effect, we performed a BLAST homology search with every sequence used for VIGS, confirming that the only hit in each case was the selected target gene. However, and since the N. benthamiana genome has not been sequenced yet, this is a possible risk that should be kept in mind.
Additionally, it is noteworthy that this screening method tests the candidate gene in the context of the infection, and consequently those genes identified should be biologically relevant.
Out of the eighteen genes whose silencing alters TYLCSV infection, seven have a potential anti-viral effect, since TYLCSV replication is enhanced when they are silenced (group B), whereas the expression of the other eleven is required for a full infection, for their silencing negatively impacts this process (group C).
Among the genes affecting TYLCSV infection, there are three (NSI, GRAB2 and RPA32) whose deregulation was previously shown to modify the geminivirus infection or replication [29], [30], [31], [32].
An earlier work showed that overexpression of the nuclear acetyltransferase NSI, a protein that interacts with the Nuclear shuttle protein (NSP) of the geminivirus Cabbage leaf curl virus (CaLCuV), enhances the efficiency of infection [30], suggesting a role for protein acetylation in coordinating replication of the viral genome with its export from the nucleus. This positive effect of NSI in the geminivirus infection is supported by the data obtained with TYLCSV, which demonstrate that silencing of NSI negatively affects viral infection. On the other hand, silencing of the Geminivirus RepA binding gene (GRAB2) during TYLCSV infection has an opposite effect on viral propagation to that previously reported for a different geminivirus species [29]. This gene encodes a NAC-containing protein isolated in wheat for its interaction with Wheat dwarf virus (WDV) RepA [29]. Even though GRAB2 overexpression inhibits WDV replication in wheat cells, the reason for this remains unclear, and could be ascribed to different roles of GRAB2 on the viral DNA cycle [29]. Our results show that reduction in gene expression of GRAB2 has a deleterious effect on TYLCSV infection, suggesting that correct GRAB2 expression is required for full infectivity. Replication Protein A (RPA32) has been shown to interact with Mungbean yellow mosaic India virus (MYMIV) Rep [32] and modulate the functions of Rep by enhancing its ATPase, but down-regulating its nicking and closing activities. Strikingly, even though RPA32 seems to promote the transient replication of a plasmid bearing MYMIV origin of replication in planta [32], in our system its silencing seems to enhance the viral infection. We do not have a feasible explanation for this contradictory phenotype at the moment, and further work will be needed to decipher it.
The roles of other host genes whose silencing affects TYLCSV infection might be deduced from their known cellular functions. Therefore, we will briefly discuss below the potential roles of a group of identified host factors with known cellular functions in postranslational modifications, stress responses, metabolism or intracellular transport.
It is noteworthy that 8 out of these 18 genes are involved in processes related to protein modifications or protein metabolism, such as ubiquitination, rubylation, phosphorylation, acetylation or protein folding.
Four of these genes encode components or regulators of the ubiquitin or ubiquitin-like pathways: Ubiquitin activating enzyme (UBA1), RING-type E3 ubiquitin ligase (RHF2A), SKP1-like 2 (ASK2) and a subunit of the de-rubylating CSN complex (CSN3).
Ubiquitination has been shown to contribute to multiple levels of plant defence, including resistance to viruses (reviewed in [33] and [34]). Specifically, several recent works have suggested the existence of links between ubiquitination and geminivirus infection [6], [10], [35], [36]. Since the tomato UBA1 interacts with TYLCSV C2 (F. Hèricourt et al., in preparation), the finding that silencing of this host gene leads to an earlier TYLCSV infection suggests that the interaction with the viral C2 protein might lead to the inhibition of the enzyme, which would be consistent with the previously described general negative impact of C2 on the ubiquitination in the host [10]. On the other hand, the expression of the RING-type E3 ubiquitin ligase RFH2A silenced in this work is up-regulated following CaLCuV infection [6] or infiltration with virulent Pseudomonas syringae (Arabidopsis eFP browser: http://esc4037-shemp.csb.utoronto.ca/efp/cgi-bin/efpWeb.cgi), which may indicate an involvement in plant defence. Such a hypothetical role would explain why the silencing of this gene promotes the viral infection.
The SCF complex seems to be an important target during geminivirus infection, since several geminiviral proteins interfere with or hijack the SCF function [10], [37]. The fact that three of the genes whose silencing alters TYLSCV infection are components or regulators of these complexes supports this idea. ASK2 is a member of a gene family encoding SKP1-like proteins that can be assembled into distinct SCF complexes, and plays a role in a large number of cellular processes such as cell division, development, osmotic stress or drought tolerance [38], [39], [40]. ASK2 expression is down-regulated by challenge with bacteria, fungi or elicitors (Arabidopsis eFP browser) but transactivated by geminivirus C2 in Arabidopsis protoplasts [9], suggesting a possible involvement in plant defence acting as a negative regulator. If this is the case, it could explain the adverse effect of its silencing on TYLCSV infection.
CSN3 is one of the eight subunits of the CSN complex, which derubylates cullins and thus regulates the activity of ubiquitin Cullin RING Ligases (CRLs). Recently, geminivirus C2 protein was shown to interfere with the activity of this complex over CULLIN1, most likely through the interaction with CSN5, the catalytic subunit, therefore altering ubiquitination in the host cell [10]. Given that geminivirus infection on Arabidopsis csn5a mutant plants takes place less efficiently that in wild-type plants (Lozano-Durán and Bejarano, submitted), it might be feasible that geminiviruses could be redirecting the activity of the CSN complex, rather that generally impairing it. Since depletion of any of the CSN subunits results in the loss of the complex (reviewed in [41]), it would not be surprising that silencing of CSN3 results in a hindered infection.
Among the host genes that seem to be required for the viral infection, since their silencing delay or suppress TYLCSV replication, we identified two encoding protein kinases that interact with TYLCSV C4 (Héricourt et al., in preparation): BAM1 (Barely any meristem 1) and SK4-1/SKK (Shaggy-related kinase kappa). BAM1 encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function, which is also involved in leaf and gametophyte development [42], [43], [44]. Interestingly, BAM1 expression is down-regulated after challenge with fungi, bacteria or elicitors (Arabidopsis eFP browser). In such a scenario, silencing of this gene might lead to an activation of defence responses in the plant. Alternatively, since this protein interacts with TYLCSV C4 (Héricourt et al., in preparation), this gene product might be required for some viral function.
Shaggy-like protein kinases like SK4-1/SKK have been shown to interact with other geminiviral C4 proteins, and this interaction is required to trigger disease symptoms [45], [46] and for C4 function to suppress gene silencing [46]. Our results confirm the previous idea that these kinases might be required for geminivirus infection, since silencing of SK41/SKK negatively impacts TYLCSV infection.
Five of the identified genes potentially involved in TYLCSV infection have a role in stress responses: HSC70-1 (Heat shock protein cognate 70), RD21 (responsive to dehydration 21), PLP2 (patatin-like protein), GLO1 (lactoylglutatione lyase) and AOC1 (allene oxide cyclase 1). HSC70-1 is one of the five cytosolic members of the heat shock protein 70 family in Arabidopsis [47]. Infection with several plant viruses, such as the geminivirus Beet curly top virus, induce the expression of members of this gene family in systemically infected tissues [48], [49] HSC70 is a major interactor of SGT1 [50], which has proven required for resistance to viruses [51], [52]. A chloroplastic HSC70 from Arabidopsis, CPHSC70-1 (At4g24280), has been recently shown to interact with Abutilon mosaic virus movement protein, and this interaction seems to be important for viral transport and symptom induction [53]. Although the role of HSC70 induction in plant-virus interaction is uncertain, it might be expected to fulfil a requirement for rapid protein maturation and turnover during a short virus multiplication cycle. Alternatively, there is evidence that HSC70 may play a role in virus cell-to-cell movement. Our results show that silencing of HSC70-1 results in an impaired TYLCSV infection, supporting that over-production of this protein is required for a full viral infection.
RD21 is a cysteine protease whose homologue in tomato is able to interact with TYLCSV V2 (F. Héricourt et al., in preparation). RD21 has been recently shown to be the target protease of the serpin AtSerpin1 [54]. In animals, serpins are protease inhibitors involved in several physiological processes, including innate immunity. The expression of RD21 is up-regulated following inoculation with Botrytis cinerea or Pseudomonas syringae (Arabidopsis eFP browser_)_, or upon CaLCuV infection [6], suggesting a possible role of RD21 in plant defence, which would in turn explain why the silencing of this gene promotes the viral infection.
PLP2 encodes a lipid acyl hydrolase that accumulates upon infection with CaLCuV [6], fungi and bacteria and negatively affects resistance to the last two types of pathogens [55]. On the contrary, it has been shown to contribute to resistance to Cucumber mosaic virus by inducing HR [56]. Since this gene product is proposed to positively regulate the biosynthesis of oxylipins providing fatty acid precursors [56], silencing of this gene might result in increased salicylic acid signalling, which could explain the impairment of TYLCSV infection.
GLO1 is part of the glyoxalase system, involved in detoxification of methylglioxal (MG), a cytotoxic byproduct of glycolysis (reviewed in [57]). Overexpression of the glyoxalase pathway in transgenic tobacco and rice plants has been found to keep in check the increase of ROS and MG under stress conditions by maintaining glutathione homeostasis and antioxidant enzyme levels (reviewed in [57]), and overexpression of GLO1 has been related to enhanced tolerance to abiotic stresses [58], [59]. A possible role for reactive oxygen species as a requirement for virus replication [60] and for antioxidative mechanisms as antagonizing viral infection [59] has been proposed. Moreover, viral infections have been shown to induce oxidative stress in plants [61], [62], [63], [64], [65], [66] and geminivirus infection alters the expression of oxidative stress-related genes [6]. Given that silencing of GLO1 triggers an earlier TYLCSV infection, it would be feasible that its interaction with C3 might be interfering with this enzyme to promote pathogenicity.
AOC1 is one of four genes that encode this enzyme in Arabidopsis, which catalyzes an essential step in jasmonic acid biosynthesis. This gene is repressed upon CaLCuV infection [6], maybe as a consequence of the opposite regulation between jasmonate and salicylic acid signalling pathways, since the latter is activated in this geminivirus-host interaction. Due to this counter-regulation, silencing of this gene might result in activation of the salicylic acid pathway in response to TYLCSV, explaining its negative effect on the viral infection.
Viruses heavily rely on cytoplasmic transport systems for their propagation. Among the host factors involved in TYLCSV infection, we have identified one gene required for vesicular trafficking (Coatomer delta subunit, deltaCOP) and another one involved in transport between the cytoplasm and the nucleus (Importin alpha isoform 4, IMPAA-4).
deltaCOP encodes a component of the polymeric coatomer coat complexes COPI. The precise role of the COPI remains unclear, although it has been associated with vesicular transport within the Golgi apparatus and from the Golgi apparatus to the ER [67]. Vesicular trafficking has been previously shown to play a role in geminivirus infection, since interaction with synaptotagmin SYTA has proven required for CaLCuV cell-to-cell movement and systemic spread [68]. Interestingly, silencing of this gene completely abolishes TYLCSV infection in our system, suggesting that vesicular trafficking in essential for viral infection.
IMPAA-4 is one of the members of the importin α gene family in eukaryotes. Importin α is a component of the nuclear pore-targeting complex (PTAC) that acts as an adaptor by recognizing the nuclear localization signal (NLS) sequences and binding to importin β. Importin β is the carrier component of PTAC, and targets the complex to the nuclear pore by binding to nuclear pore proteins [69], [70]. Importin α has been shown to interact with the CP from the geminivirus MYMV [71], and this interaction might serve for docking of viruses to the nucleus and facilitating nuclear localization of the CP during encapsidation. In this context, the finding that silencing of IMPA-4 favours the viral infection seems counterintuitive; however, the fact that this gene is overexpressed in response to several pathogens and elicitors (Arabidopsis eFP browser) suggests that this host factor might also play a role in plant defence, providing a possible explanation for the observed phenotype. Additionally, TYLCSV CP could rely on the interaction with a different host protein for its nuclear import.
Besides the aforementioned cellular processes, others seem to be involved in TYLCSV infection. Silencing of genes selected because of their specific expression or overexpression in phloem tissue and required for phenylpropanoid metabolism (4-coumarate:CoA ligase1, 4CL1) or secondary cell wall synthesis (Bearskin2B, BRN2) delay or promote TYLCSV infection, respectively. BRN2 is a member of the Class IIB NAC transcription factor family. In Arabidopsis, this protein has been suggested to regulate cell maturation in cells that undergo terminal differentiation with strong cell wall modifications [72]. 4CL1 is involved in the last step of the general phenylpropanoid pathway, channeling carbon flow into branch pathways of the phenylpropanoid metabolism. Interestingly, silencing of this gene leads to increased cellulose content and reduced amounts of total lignin [73].
As illustrated in the examples above, the use of this approach has allowed the identification of novel plant genes with a role in the geminivirus infection, which sheds light on the underlying biological processes, therefore paving the way for the development of strategies to counteract these devastating diseases. Given the previously mentioned advantages of this 2IRGFP/VIGS system, it can be considered an easy, fast and effective tool to determine the role of host genes in geminivirus infections, and might be of great assistance to speed up this kind of functional studies. However, using VIGS to target a specific gene requires information about its nucleotide sequence. This is a limitation when working with N. benthamiana, as there is only a relatively small sequence database available for this species (http://www.tigr.org). We have tried to circumvent this difficulty by using nucleotide sequence information from Arabidopsis and closely related species. In a genome era, full sequencing of the N. benthamiana genome should hopefully be fulfilled in the near future, providing full potential to the VIGS/2IRGFP strategy to identify host factors involved in geminivirus infection.
Materials and Methods
Microorganisms, plants and general methods
Manipulations of Escherichia coli and nucleic acids were performed according to standard methods [74], [75]. E. coli strain DH5-α was used for subcloning. All PCR-amplified fragments cloned in this work were fully sequenced. Agrobacterium tumefaciens GV3101 strain was used for the delivery of Tobacco rattle virus (TRV) RNA2-based vectors and TYLCSV infective clone; A. tumefaciens C58c1 was used for the delivery of the TRV RNA1-based construct pBINTRA6 [27].
2IRGFP N. benthamiana plants were grown in soil at 22°C in short day conditions (8 h light/16 h dark photoperiod).
Plasmids and cloning
cDNA clones of the selected candidate genes were obtained from the Arabidopsis Information Resource (TAIR) (Table S1). Fragments (300–500 bp) from the selected genes were generated by PCR with specific primers (Table S1) and cloned in pGEMT-easy (Promega). _Spe_I/_Apa_I fragments from the pGEMT clones containing the selected sequenced were subcloned into _Spe_I/_Apa_I sites of TRV RNA2-based vector pTV00 [27] to yield the correspondent TRV used to silencing the plants genes.
To yield the TRV:GFP construct, a 383 bp _BamH_I-_Cla_I fragment from pSMGFP [76] was cloned into _BamH_I-Cla_I of pTV00. To yield the TRV:Sul construct, a 450 bp fragment of the Sulfur gene amplified from Arabidopsis cDNA using At_Sulfur primers (Table S1) was digested with _Kpn_I and cloned into the _Kpn_I site of pTV00. To yield the TRV:SulPCNA construct a 450 bp _Kpn_I fragment from TRV:Sul was subcloned into KpnI site of TRV:PCNA [11].
Geminivirus infection assays and detection of viral and mGFP DNA
Viral infections of 2IRGFP N. benthamiana plants were performed by the agroinoculation technique as previously described [77]. Plants were agroinoculated with plasmid pGreenTYA14 (binary vector containing a partial dimer of TYLCSV-ES[2] [10]) in the axilary bud of the fourth/fifth leaf of 3-week-old wild-type or transgenic 2IRGFP N. benthamiana plants. For control, plants were mock inoculated with A. tumefaciens culture harbouring the empty binary vector pGreen-0229 [78].
Viral and mGFP DNAs were detected by gel blot hybridization. Total plant DNA was extracted from N. benthamiana leaves at different days postinfection. Two micrograms of undigested total DNA per sample were used. As probe for TYLCSV detection, we used a _BamH_I DNA fragment from pGreenTYA14 [10] containing a full-length genome of TYLCSV-ES. For mGFP detection we used a _BamH_I-_Sac_I DNA fragment from pSMGFP comprising the complete GFP open reading frame [76].
For quantitative real-time PCR, total plant DNA was extracted from N. benthamiana leaves at 15 dpi. The reaction mixture consisted of approximately 10 ng total DNA, primer mix (3 µM each) and SYBR Green Master Mix (TaKaRa, Kyoto, Japan) in a total volume of 25 µl. The PCR conditions were: 10 minutes at 95°C, and 40 cycles of 30 seconds at 95°C and 30 seconds at 60°C. The reactions were performed using a Rotor-Gene real time cycler (QIAGEN, Hamburg Germany). A relative quantification real-time PCR method using the 2ΔΔCT method [79] was used to compare the amount of the TYLCSV capsid protein gene (amplified using primers GGAGGCTGAACTTCGACAGC and GGACTTTCAATGGGCCTTCAC) between different infections/experiments. The 25S ribosomal DNA interspacer (ITS) (amplified using primers ATAACCGCATCAGGTCTCCA and CCGAAGTTACGGATCCATTT) was used as the internal control.
Virus Induced Gene Silencing assay
Virus induced gene silencing with TRV in N. benthamiana plants were performed according the method described by [27]. Briefly, independent cultures of A. tumefaciens GV3101 carrying pTV00 or pTV00-based constructs and A. tumefaciens C58c1 carrying pBINTRA6 were grown overnight in LBroth medium plus appropriate antibiotics. Cultures were resuspended in VIGS buffer (10 mM morpholineethanesulfonic acid pH 5.6, 10 mM MgCl2, and 100 µM acetosyringone) adjusting optical density to OD600 = 1, and incubated overnight at room temperature in the dark. Cultures containing pBINTRA6 plasmid and pTV00 or pTV00-derived plasmid were mixed at a 1∶1 ratio. Approximately 1 mL of this mixed culture was used to infiltrate the underside of two leaves of each 3-week-old 2IRGFP N. benthamiana plant.
Supporting Information
Figure S1.
Phenotypes of TYLCSV-infected 2IRGFP N. benthamiana plants. Extension and intensity of GFP expression in the leaves of TYLCSV-infected plants corresponding to RAP phenotypes (for Replication-Associated Phenotype) 0, 1, 2, 3 and 4.
https://doi.org/10.1371/journal.pone.0022383.s001
(TIF)
Figure S2.
Simultaneous TRV-induced silencing of PCNA and Sul. Percentage of leaves located above the infiltration point displaying the silencing phenotype of either PCNA, Sul or both in N. benthamiana plants inoculated with TRV:Sul, TRV:PCNA or TRV:SulPCNA, or co-inoculated with TRV:Sul and TRV:PCNA. For each inoculation, n = 10 plants. The data correspond to leaves collected approximately 28 days after the infection.
https://doi.org/10.1371/journal.pone.0022383.s002
(TIF)
Acknowledgments
We thank Manuel Arroyo, Mayte Duarte and Silvia Hernández for excellent technical assistance, and the Sainsbury Laboratory, John Innes Centre, for providing us with the TRV vectors.
Author Contributions
Conceived and designed the experiments: RL-D TR-D ERB. Performed the experiments: RL-D TR-D APL. Analyzed the data: RL-D TR-D ERB. Contributed reagents/materials/analysis tools: ERB. Wrote the paper: RL-D TR-D ERB.
References
- 1.Rojas MR, Hagen C, Lucas WJ, Gilbertson RL (2005) Exploiting chinks in the plant's armor: evolution and emergence of geminiviruses. Annu Rev Phytopathol 43: 361–394.
- 2.Stanley J, Bisaro DM, Briddon RW, Brown JK, Fauquet CM, et al. (2005) Geminiviridae. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA, editors. In Virus Taxonomy VIIIth Report of the International Committee on Taxonomy of Viruses. London: Elsevier/Academic Press. pp. 301–326.
- 3.Moriones E, Navas-Castillo J (2000) Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res 71: 123–134.
- 4.Czosnek H (2007) Tomato Yellow Leaf Curl Disease. In: Czosnek H, editor. Management, molecular biologya, breeding for resistance. Dordretch: Spinger. 441 p.
- 5.Diaz-Pendon JA, Canizares MC, Moriones E, Bejarano ER, Czosnek H, et al. (2010) Tomato yellow leaf curl viruses: menage a trois between the virus complex, the plant and the whitefly vector. Mol Plant Pathol 11: 441–450.
- 6.Ascencio-Ibanez JT, Sozzani R, Lee TJ, Chu TM, Wolfinger RD, et al. (2008) Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. Plant Physiol 148: 436–454.
- 7.Sahu PP, Rai NK, Chakraborty S, Singh M, Chandrappa PH, et al. (2010) Tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus-specific short interfering RNA accumulation and defence-associated host gene expression. Mol Plant Pathol 11: 531–544.
- 8.Andleeb S, Amin I, Bashir A, Briddon RW, Mansoor S (2010) Transient expression of betaC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions. Virol J 7: 373.
- 9.Trinks D, Rajeswaran R, Shivaprasad PV, Akbergenov R, Oakeley EJ, et al. (2005) Suppression of RNA silencing by a geminivirus nuclear protein, AC2, correlates with transactivation of host genes. J Virol 79: 2517–2527.
- 10.Lozano-Duran R, Rosas-Diaz T, Gusmaroli G, Luna AP, Taconnat L, et al. (2011) Geminiviruses Subvert Ubiquitination by Altering CSN-Mediated Derubylation of SCF E3 Ligase Complexes and Inhibit Jasmonate Signaling in Arabidopsis thaliana. Plant Cell.
- 11.Morilla G, Castillo AG, Preiss W, Jeske H, Bejarano ER (2006) A versatile transreplication-based system to identify cellular proteins involved in geminivirus replication. J Virol 80: 3624–3633.
- 12.Castillo AG, Kong LJ, Hanley-Bowdoin L, Bejarano ER (2004) Interaction between a geminivirus replication protein and the plant sumoylation system. J Virol 78: 2758–2769.
- 13.Ber R, Navot N, Zamir D, Antignus Y, Cohen S, et al. (1990) Infection of tomato by tomato yellow leaf curl virus: suceptibility to infection, symptom development and accumulation of viral DNA. Arch Virology.
- 14.Czosnek H, Ber R, Navot N, Zamir D (1988) Detection of tomato yellow leaf curl virus in lysates of plants and insects by hybridization with a viral DNA probe. Plant disease 72: 949–951.
- 15.Voinnet O, Baulcombe DC (1997) Systemic signalling in gene silencing. Nature 389: 553.
- 16.Ruiz MT, Voinnet O, Baulcombe DC (1998) Initiation and maintenance of virus-induced gene silencing. Plant Cell 10: 937–946.
- 17.Kjemtrup S, Sampson KS, Peele CG, Nguyen LV (1998) Gene silencing from plant DNA carried by a Geminivirus. Plant Journal 14: 91–100.
- 18.Orzaez D, Medina A, Torre S, Fernandez-Moreno JP, Rambla JL, et al. (2009) A visual reporter system for virus-induced gene silencing in tomato fruit based on anthocyanin accumulation. Plant Physiol 150: 1122–1134.
- 19.Spitzer B, Zvi MM, Ovadis M, Marhevka E, Barkai O, et al. (2007) Reverse genetics of floral scent: application of tobacco rattle virus-based gene silencing in Petunia. Plant Physiol 145: 1241–1250.
- 20.Chen J, Jiang C, Gookin T, Hunter D, Clark D, et al. (2004) Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Molecular Biology 55: 521–530.
- 21.Peele C, Jordan CV, Muangsan N, Turnage M, Egelkrout E, et al. (2001) Silencing of a meristematic gene using geminivirus-derived vectors. Plant J 27: 357–366.
- 22.Thomas CL, Jones L, Baulcombe DC, Maule AJ (2001) Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J 25: 417–425.
- 23.Ekengren SK, Liu Y, Schiff M, Dinesh-Kumar SP, Martin GB (2003) Two MAPK cascades, NPR1, and TGA transcription factors play a role in Pto-mediated disease resistance in tomato. Plant J 36: 905–917.
- 24.Burch-Smith TM, Anderson JC, Martin GB, Dinesh-Kumar SP (2004) Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J 39: 734–746.
- 25.Liu E, Page JE (2008) Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods 4: 5.
- 26.Senthil-Kumar M, Hema R, Anand A, Kang L, Udayakumar M, et al. (2007) A systematic study to determine the extent of gene silencing in Nicotiana benthamiana and other Solanaceae species when heterologous gene sequences are used for virus-induced gene silencing. New Phytol 176: 782–791.
- 27.Ratcliff F, Montserrat A, Martin-Hernandez , Baulcombe D (2001) Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal 25: 237–245.
- 28.Eybishtz A, Peretz Y, Sade D, Gorovits R, Czosnek H (2010) Tomato yellow leaf curl virus infection of a resistant tomato line with a silenced sucrose transporter gene LeHT1 results in inhibition of growth, enhanced virus spread, and necrosis. Planta 231: 537–548.
- 29.Xie Q, Sanz-Burgos AP, Guo H, Garcia JA, Gutierrez C (1999) GRAB proteins, novel members of the NAC domain family, isolated by their interaction with a geminivirus protein. Plant Mol Biol 39: 647–656.
- 30.McGarry RC, Barron YD, Carvalho MF, Hill JE, Gold D, et al. (2003) A novel Arabidopsis acetyltransferase interacts with the geminivirus movement protein NSP. Plant Cell 15: 1605–1618.
- 31.Carvalho MF, Turgeon R, Lazarowitz SG (2006) The geminivirus nuclear shuttle protein NSP inhibits the activity of AtNSI, a vascular-expressed Arabidopsis acetyltransferase regulated with the sink-to-source transition. Plant Physiol 140: 1317–1330.
- 32.Singh DK, Islam MN, Choudhury NR, Karjee S, Mukherjee SK (2006) The 32 kDa subunit of replication protein A (RPA) participates in the DNA replication of Mung bean yellow mosaic India virus (MYMIV) by interacting with the viral Rep protein. Nucleic Acids Res 35: 755–770.
- 33.Dreher K, Callis J (2007) Ubiquitin, hormones and biotic stress in plants. Ann Bot 99: 787–822.
- 34.Citovsky V, Zaltsman A, Kozlovsky SV, Gafni Y, Krichevsky A (2009) Proteasomal degradation in plant-pathogen interactions. Semin Cell Dev Biol 20: 1048–1054.
- 35.Eini O, Dogra S, Selth LA, Dry IB, Randles JW, et al. (2009) Interaction with a host ubiquitin-conjugating enzyme is required for the pathogenicity of a geminiviral DNA beta satellite. Mol Plant Microbe Interact 22: 737–746.
- 36.Lai J, Chen H, Teng K, Zhao Q, Zhang Z, et al. (2008) RKP, a RING finger E3 ligase induced by BSCTV C4 protein, affects geminivirus infection by regulation of the plant cell cycle. Plant J 57: 905–917.
- 37.Lozano-Durán R, Bejarano ER (2011) Geminivirus C2 protein might be the key player for geminiviral co-option of SCF-mediated ubiquitination. Plant Signaling & Behavior. In press.
- 38.Umezawa T, Yoshida R, Maruyama K, Yamaguchi-Shinozaki K, Shinozaki K (2004) SRK2C, a SNF1-related protein kinase 2, improves drought tolerance by controlling stress-responsive gene expression in Arabidopsis thaliana. Proc Natl Acad Sci U S A 101: 17306–17311.
- 39.Boudsocq M, Barbier-Brygoo H, Lauriere C (2004) Identification of nine sucrose nonfermenting 1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. J Biol Chem 279: 41758–41766.
- 40.Liu F, Ni W, Griffith ME, Huang Z, Chang C, et al. (2004) The ASK1 and ASK2 genes are essential for Arabidopsis early development. Plant Cell 16: 5–20.
- 41.Serino G, Deng XW (2003) The COP9 signalosome: regulating plant development through the control of proteolysis. Annu Rev Plant Biol 54: 165–182.
- 42.Guo Y, Han L, Hymes M, Denver R, Clark SE (2010) CLAVATA2 forms a distinct CLE-binding receptor complex regulating Arabidopsis stem cell specification. Plant J 63: 889–900.
- 43.DeYoung BJ, Bickle KL, Schrage KJ, Muskett P, Patel K, et al. (2006) The CLAVATA1-related BAM1, BAM2 and BAM3 receptor kinase-like proteins are required for meristem function in Arabidopsis. Plant J 45: 1–16.
- 44.Deyoung BJ, Clark SE (2008) BAM receptors regulate stem cell specification and organ development through complex interactions with CLAVATA signaling. Genetics 180: 895–904.
- 45.Piroux N, Saunders K, Page A, Stanley J (2007) Geminivirus pathogenicity protein C4 interacts with Arabidopsis thaliana shaggy-related protein kinase AtSKeta, a component of the brassinosteroid signalling pathway. Virology 362: 428–440.
- 46.Dogra SC, Eini O, Rezaian MA, Randles JW (2009) A novel shaggy-like kinase interacts with the Tomato leaf curl virus pathogenicity determinant C4 protein. Plant Mol Biol 71: 25–38.
- 47.Sung DY, Vierling E, Guy CL (2001) Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. Plant Physiol 126: 789–800.
- 48.Escaler M, Aranda MA, Thomas CL, Maule AJ (2000) Pea embryonic tissues show common responses to the replication of a wide range of viruses. Virology 267: 318–325.
- 49.Aparicio F, Thomas CL, Lederer C, Niu Y, Wang D, et al. (2005) Virus Induction of Heat Shock Protein 70 Reflects a General Response to Protein Accumulation in the Plant Cytosol. Plant Physiol 138: 529–536.
- 50.Noel LD, Cagna G, Stuttmann J, Wirthmuller L, Betsuyaku S, et al. (2007) Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. Plant Cell 19: 4061–4076.
- 51.Komatsu K, Hashimoto M, Ozeki J, Yamaji Y, Maejima K, et al. (2010) Viral-induced systemic necrosis in plants involves both programmed cell death and the inhibition of viral multiplication, which are regulated by independent pathways. Mol Plant Microbe Interact 23: 283–293.
- 52.Dielen AS, Badaoui S, Candresse T, German-Retana S (2010) The ubiquitin/26S proteasome system in plant-pathogen interactions: a never-ending hide-and-seek game. Mol Plant Pathol 11: 293–308.
- 53.Krenz B, Windeisen V, Wege C, Jeske H, Kleinow T (2010) A plastid-targeted heat shock cognate 70kDa protein interacts with the Abutilon mosaic virus movement protein. Virology 401: 6–17.
- 54.Lampl N, Budai-Hadrian O, Davydov O, Joss TV, Harrop SJ, et al. (2010) Arabidopsis AtSerpin1, crystal structure and in vivo interaction with its target protease RESPONSIVE TO DESICCATION-21 (RD21). J Biol Chem 285: 13550–13560.
- 55.La Camera S, Geoffroy P, Samaha H, Ndiaye A, Rahim G, et al. (2005) A pathogen-inducible patatin-like lipid acyl hydrolase facilitates fungal and bacterial host colonization in Arabidopsis. Plant J 44: 810–825.
- 56.La Camera S, Balague C, Gobel C, Geoffroy P, Legrand M, et al. (2009) The Arabidopsis patatin-like protein 2 (PLP2) plays an essential role in cell death execution and differentially affects biosynthesis of oxylipins and resistance to pathogens. Mol Plant Microbe Interact 22: 469–481.
- 57.Yadav SK, Singla-Pareek SL, Sopory SK (2008) An overview on the role of methylglyoxal and glyoxalases in plants. Drug Metabol Drug Interact 23: 51–68.
- 58.Mustafiz A, Sahoo KK, Singla-Pareek SL, Sopory SK (2010) Metabolic engineering of glyoxalase pathway for enhancing stress tolerance in plants. Methods Mol Biol 639: 95–118.
- 59.Sun W, Xu X, Zhu H, Liu A, Liu L, et al. (2010) Comparative transcriptomic profiling of a salt-tolerant wild tomato species and a salt-sensitive tomato cultivar. Plant Cell Physiol 51: 997–1006.
- 60.Clarke SF, Guy PL, Burritt DJ, Jameson PE (2002) Changes in the activities of antioxidant enzymes in response to virus infection and hormone treatment. Physiol Plant 114: 157–164.
- 61.Garcia-Marcos A, Pacheco R, Martianez J, Gonzalez-Jara P, Diaz-Ruiz JR, et al. (2009) Transcriptional changes and oxidative stress associated with the synergistic interaction between Potato virus X and Potato virus Y and their relationship with symptom expression. Mol Plant Microbe Interact 22: 1431–1444.
- 62.Amari K, Diaz-Vivancos P, Pallas V, Sanchez-Pina MA, Hernandez JA (2007) Oxidative stress induction by Prunus necrotic ringspot virus infection in apricot seeds. Physiol Plant 131: 302–310.
- 63.Diaz-Vivancos P, Clemente-Moreno MJ, Rubio M, Olmos E, Garcia JA, et al. (2008) Alteration in the chloroplastic metabolism leads to ROS accumulation in pea plants in response to plum pox virus. J Exp Bot 59: 2147–2160.
- 64.Diaz-Vivancos P, Rubio M, Mesonero V, Periago PM, Barcelo AR, et al. (2006) The apoplastic antioxidant system in Prunus: response to long-term plum pox virus infection. J Exp Bot 57: 3813–3824.
- 65.Rimmer J, Singh A, Banwell P, Clarke PM, Rhys Evans P (2006) The use of octyl-2-cyanoacrylate (Dermabond) tissue adhesive for skin closure in head and neck surgery. Ann R Coll Surg Engl 88: 412–413.
- 66.Song XS, Wang YJ, Mao WH, Shi K, Zhou YH, et al. (2009) Effects of cucumber mosaic virus infection on electron transport and antioxidant system in chloroplasts and mitochondria of cucumber and tomato leaves. Physiol Plant 135: 246–257.
- 67.Lee MC, Miller EA, Goldberg J, Orci L, Schekman R (2004) Bi-directional protein transport between the ER and Golgi. Annu Rev Cell Dev Biol 20: 87–123.
- 68.Lewis JD, Lazarowitz SG (2010) Arabidopsis synaptotagmin SYTA regulates endocytosis and virus movement protein cell-to-cell transport. Proc Natl Acad Sci U S A 107: 2491–2496.
- 69.Cook A, Bono F, Jinek M, Conti E (2007) Structural biology of nucleocytoplasmic transport. Annu Rev Biochem 76: 647–671.
- 70.Terry LJ, Shows EB, Wente SR (2007) Crossing the nuclear envelope: hierarchical regulation of nucleocytoplasmic transport. Science 318: 1412–1416.
- 71.Guerra-Peraza O, Kirk D, Seltzer V, Veluthambi K, Schmit AC, et al. (2005) Coat proteins of Rice tungro bacilliform virus and Mungbean yellow mosaic virus contain multiple nuclear-localization signals and interact with importin alpha. J Gen Virol 86: 1815–1826.
- 72.Bennett T, van den Toorn A, Sanchez-Perez GF, Campilho A, Willemsen V, et al. (2010) SOMBRERO, BEARSKIN1, and BEARSKIN2 regulate root cap maturation in Arabidopsis. Plant Cell 22: 640–654.
- 73.Yang J, Chen F, Yu O, Beachy RN (2010) Controlled silencing of 4-coumarate:CoA ligase alters lignocellulose composition without affecting stem growth. Plant Physiol Biochem 49: 103–109.
- 74.Ausubel F, Brent R, Kingston R, Moore D, Seidman J, et al. (1998) Current protocols in molecular biology. New York, N.Y: John Wiley & Sons, Inc..
- 75.Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
- 76.Davis SJ, Vierstra RD (1998) Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants. Plant Mol Biol 36: 521–528.
- 77.Elmer JS, Sunter G, Gardiner WE, Brand L, Browing CK, et al. (1988) Agrobacterium-mediated inoculation of plants with tomato golden mosaic virus DNAs. Plant Mol Biol 10: 225–234.
- 78.Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42: 819–832.
- 79.Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408.
- 80.Shultz RW, Tatineni VM, Hanley-Bowdoin L, Thompson WF (2007) Genome-wide analysis of the core DNA replication machinery in the higher plants Arabidopsis and rice. Plant Physiol 144: 1697–1714.
- 81.Kong LJ, Hanley-Bowdoin L (2002) A geminivirus replication protein interacts with a protein kinase and a motor protein that display different expression patterns during plant development and infection. Plant Cell 14: 1817–1832.
- 82.Vilaine F, Palauqui JC, Amselem J, Kusiak C, Lemoine R, et al. (2003) Towards deciphering phloem: a transcriptome analysis of the phloem of Apium graveolens. Plant J 36: 67–81.
- 83.Selth LA, Dogra SC, Rasheed MS, Healy H, Randles JW, et al. (2005) A NAC domain protein interacts with tomato leaf curl virus replication accessory protein and enhances viral replication. Plant Cell 17: 311–325.
- 84.Ach RA, Durfee T, Miller AB, Taranto P, Hanley-Bowdoin L, et al. (1997) RRB1 and RRB2 encode maize retinoblastoma-related proteins that interact with a plant D-type cyclin and geminivirus replication protein. Mol Cell Biol 17: 5077–5086.
- 85.Kong LJ, Orozco BM, Roe JL, Nagar S, Ou S, et al. (2000) A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J 19: 3485–3495.
- 86.Woodward AW, Ratzel SE, Woodward EE, Shamoo Y, Bartel B (2007) Mutation of E1-CONJUGATING ENZYME-RELATED1 decreases RELATED TO UBIQUITIN conjugation and alters auxin response and development. Plant Physiol 144: 976–987.
- 87.Wang H, Hao L, Shung CY, Sunter G, Bisaro DM (2003) Adenosine kinase is inactivated by geminivirus AL2 and L2 proteins. Plant Cell 15: 3020–3032.
- 88.Lois LM (2010) Diversity of the SUMOylation machinery in plants. Biochem Soc Trans 38: 60–64.
- 89.Asano T, Masumura T, Kusano H, Kikuchi S, Kurita A, et al. (2002) Construction of a specialized cDNA library from plant cells isolated by laser capture microdissection: toward comprehensive analysis of the genes expressed in the rice phloem. Plant J 32: 401–408.
- 90.Schwechheimer C, Isono E (2010) The COP9 signalosome and its role in plant development. Eur J Cell Biol 89: 157–162.