p53 isoform delta113p53 is a p53 target gene that antagonizes p53 apoptotic activity via BclxL activation in zebrafish - PubMed (original) (raw)

p53 isoform delta113p53 is a p53 target gene that antagonizes p53 apoptotic activity via BclxL activation in zebrafish

Jun Chen et al. Genes Dev. 2009.

Abstract

p53 is a well-known tumor suppressor and is also involved in processes of organismal aging and developmental control. A recent exciting development in the p53 field is the discovery of various p53 isoforms. One p53 isoform is human Delta133p53 and its zebrafish counterpart Delta113p53. These N-terminal-truncated p53 isoforms are initiated from an alternative p53 promoter, but their expression regulation and physiological significance at the organismal level are not well understood. We show here that zebrafish Delta113p53 is directly transactivated by full-length p53 in response to developmental and DNA-damaging signals. More importantly, we show that Delta113p53 functions to antagonize p53-induced apoptosis via activating bcl2L (closest to human Bcl-x(L)), and knockdown of Delta113p53 enhances p53-mediated apoptosis under stress conditions. Thus, we demonstrate that the p53 genetic locus contains a new p53 response gene and that Delta113p53 does not act in a dominant-negative manner toward p53 but differentially modulates p53 target gene expression to antagonize p53 apoptotic activity at the physiological level in zebrafish. Our results establish a novel feedback pathway that modulates the p53 response and suggest that modulation of the p53 pathway by p53 isoforms might have an impact on p53 tumor suppressor activity.

PubMed Disclaimer

Figures

Figure 1.

Figure 1.

Δ113p53 is responsive to DNA-damaging signals. (A) Induction of Δ113p53 expression by sheared herring sperm DNA injection. Northern analysis using the p53 probe I (detecting both p53 and Δ113p53) and RT–qPCR using _Δ113p53_-specific primers showed that injection of 50 pg of sheared herring sperm DNA (lane 4) induced the expression of Δ113p53 in wild-type (WT) embryos, whereas injection of 50 pg of baker's yeast total RNA (lane 3) or buffer containing phenol red dye (lane 2) failed to do so when compared with the uninjected wild-type control (lane 1). (B, top panel) Northern analysis of p53 and Δ113p53 transcripts using the p53 probe I. (Third panel) RT–qPCR analysis of Δ113p53 using _Δ113p53_-specific primers. (Lane 1) Uninjected wild type. (Lane 2) Buffer-injected wild type. (Lane 3) pGEMT plasmid DNA-injected wild type. (C) Wild-type and the tp53M214K mutant embryos were treated with γ-ray, camptothecin (campt), or roscovitine (rosco). Northern analysis was performed using the p53 probe I (top panel), a _Δ113p53_-specific probe (second panel) and a _p53_-specific probe (third panel). Control: Untreated wild-type (lanes 1,5) and tp53M214K (lane 8) embryos.

Figure 2.

Figure 2.

Tg(Δ113p53:gfp) reporter fish faithfully recapitulate the response of Δ113p53 to both developmental and stress signals. (A) Diagram showing the genomic structure of the zebrafish p53 gene and the relative position of the 4.113-kb genomic DNA fragment cloned for the Δ113p53 promoter activity analyses. The zebrafish p53 gene (derived from BAC clone CH211-190-H10) has 10 exons (light-blue box) and nine introns (black lines linking exons). The start codon ATG of p53 is located in the second exon. The lengths of introns 1–4 of p53 are 637, 240, 92, and 2692 bp, respectively, as shown in the diagram. Transcription of Δ113p53 starts in intron 4 (dark-blue box ES), and the mature Δ113p53 transcript contains a 155-bp intron 4 sequence joined to exon 5 of p53 after splicing an intron of length 842 bp (intron 1 for Δ113p53). The start codon ATG of Δ113p53 is located in exon 5 of p53. The 4.113-kb genomic DNA fragment cloned is immediately upstream of the Δ113p53 start codon ATG and ends in exon 1 of p53. The 4.113-kb DNA fragment was cloned into the pEGFP-1 vector to generate the Δ113p53:gfp plasmid. (B) Diagram showing the main domains of p53 and Δ113p53. Each domain is represented by different bars with descriptions above or under the bar. (C) Δ113p53:gfp plasmid-injected wild-type embryos at 24 hpf. (D) Gfp fluorescence in a heterozygous defhi429 sibling (red arrow) and a defhi429 homozygote (yellow arrow) in the Tg(Δ113p53:gfp) background at 3 dpf. (in) Intestine; (lv) liver; (ex) exocrine pancreas. (E,F) gfp transcripts (E) and Gfp fluorescence (F) in Tg(Δ113p53:gfp) embryos untreated or treated with γ-ray, camptothecin, or roscovitine.

Figure 3.

Figure 3.

Δ113p53 is a p53-target gene. (A) Diagram showing the details of each Δ113p53 promoter deletion construct. The Δ113p53:gfp plasmid is designated as P0 and the TSS of Δ113p53 as the position +1. The start positions of intron 4 (−1692) and exon 5 (+995) of p53 are also highlighted. The nucleotide position +1054 is immediately 5′ upstream of the start codon ATG of Δ113p53. (Red line) Internal deletions. Three putative p53-binding sites (site I: −1125 to −1106 bp, AGACATG

AA

TGGGCATGTTC; site II: −243 to −219 bp,

T

GACATGTT

A

TATTT

T

A

T

CAAGTCC; site III: −103 to −84 bp, GAACATGTCTGAACTTGTCC; underlined bases denote mismatches) are marked with red lined white boxes. (B) Gfp fluorescence in P0 to P9 plasmid-injected wild-type embryos at 24 hpf. (C, first and second panels) Northern analysis of gfp transcripts and 18S rRNA control in wild-type embryos (24 hpf) injected with P0 to P9 plasmids to assay their transcriptional activity. The longer transcripts in P0-, P1-, P2-, and P6-injected samples represent the unspliced product, and the lower band represents the mature mRNA in each case. (Third and fourth panels) RT–qPCR analysis of the endogenous Δ113p53 and elongation factor a gene (el1a) (control). (ctl) Uninjected wild-type control. (D) The _p53_-probe I (top panel) and the _Δ113p53_-specfic probe (middle panel) were used in Northern analysis. (Lane 1) tp53M214K def+/+ or defhi429/+ siblings. (Lane 2) defhi429 tp53M214K double mutant. (Lane 3) def+/+ or defhi429/+ siblings. (Lane 4) defhi429 single mutant. (E) Detection of Δ113p53 transcripts in p53-MOATG-injected γ-ray-treated embryos, in def-MO or p53-MOATG and def-MO-coinjected wild-type embryos. Morpholinos were injected at the one-cell stage, and the injected embryos were treated with γ-ray at 24 hpf and harvested for total RNA extraction 6 h after the γ-ray treatment. (F, top panel) gfp transcripts in the tp53M214K embryos injected with P0, P5, or P9 plasmids alone or together with p53 mRNA. (Third panel) The endogenous Δ113p53 expression was examined via RT–qPCR. Uninjected wild type (lane 1) and P0-injected wild type (lane 2) were used as the negative and positive controls, respectively. (G) ChIP down the HA-p53–DNA complex using an anti-HA antibody (α-HA Co-IP) from the input. Control: Uninjected embryos. (H) HA-p53–DNA complex obtained by ChIP and respective inputs (input panel) were used as the templates for PCRs using a pair of primers from exon 10 (negative control) (lanes 1,2), a pair for region −112 to +98 (p53-binding site III) (lanes 3,4), and a pair for the region −1086 to −1300 (p53-binding site I) (lanes 5,6).

Figure 4.

Figure 4.

Δ113p53 antagonizes p53's apoptotic activities. (A, panels 2–4) Injection of p53 mRNA into the tp53M214K mutant embryos caused death to the injected embryos in a dosage-dependent manner. (Panels 6–9) Coinjecting Δ113p53 mRNA with p53 mRNA antagonized p53's apoptotic activity and reversed the viability of the injected embryos in a dosage-dependent manner. Injection of 1 ng of Δ113p53 (panel 5) did not cause an overt effect on injected tp53M214K embryos when compared with the buffer-injected tp53M214K embryos (panel 1). The embryos shown were at 24 hpf. (B,C) Viability counting corresponding to panels in A. Viability of the tp53M214K embryos injected with buffer (panel 1), 0.01, 0.05, and 0.1 ng of p53 mRNA (panels 2–4), 1 ng of Δ113p53 mRNA alone (panels 5,5′), or coinjected with 0.1 ng of p53 mRNA with 0, 0.1, 0.5, and 1 ng of Δ113p53 mRNA (panels 6–9). Each test was repeated three times, and ∼100–200 embryos were counted in each test. Dead embryos are characterized by the presence of large, dark debris in the embryo. The high death rate in p53 mRNA-injected embryos was not caused by possible toxins released from dead embryos because when such egg water was reused to culture new embryos, the embryos grew normally without an abnormal death toll (data not shown). (D) Apoptosis TUNEL assay (red spots) in tp53M214K embryos at 10 hpf injected with p53 mRNA alone or coinjected with p53 and Δ113p53 mRNA. Controls: Uninjected or buffer-injected tp53M214K embryos.

Figure 5.

Figure 5.

Knockdown Δ113p53 enhances cell apoptosis specifically in the digestive organs in the def morphants. (A,B) Analysis of Gfp fluorescence (A) and Gfp protein (B) in Tg(Δ113p53:gfp) embryos injected with st-MO or Δ113p53-MO and treated with or without 50 nM camptothecin as indicated (>100 embryos were examined in each case). Lanes 1_–_3 in B correspond to samples 1–3 in A. (C–K) A def-MO morphant (C–E), a def-MO and Δ113p53-MO double morphant (F–H), and a Δ113p53-MO morphant (I–K). (C,F,I) TUNEL staining. (D,G,J) DAPI staining. (E,H,K) Superimposition of corresponding TUNEL and DAPI staining. (in) Intestine; (pa) pancreas. For the Δ113p53-MO and def-MO double morphants, out of 1965 cells counted (total 30 sections from four fish) in the liver, pancreas, and intestine, 66 apoptotic cells were identified. For def-MO morphants, out of 3019 cells counted (total 23 sections from three fish) in the liver, pancreas, and intestine, no apoptotic cell was found. For Δ113p53-MO morphants, out of 2195 cells counted (total 25 sections from three fish) in the liver, pancreas, and intestine, no apoptotic cell was found.

Figure 6.

Figure 6.

Knockdown Δ113p53 sensitizes the zebrafish embryos to ionizing radiation treatment. (A) Photos showing Δ113p53-MO- or st-MO-injected wild-type or tp53M214K embryos 5 d after being treated or untreated with γ-ray as indicated. All surviving embryos after γ-ray treatments showed abnormal phenotype (body curving). (B) Wild-type embryos were injected with different reagents as indicated and treated with γ-ray at 6 hpf and were harvested 6 h after treatment for TUNEL assay. The embryos shown were at 12 hpf. (C) The γ-ray-induced apoptosis is p53-dependent. Embryos injected with st-MO, Δ113p53-MO, p53-MOATG, or Δ113p53-MO and p53-MOATG were treated with γ-ray at 24 hpf and harvested 6 h later for TUNEL assay. The embryos shown were at 30 hpf.

Figure 7.

Figure 7.

Bcl2L mediates the Δ113p53 anti-apoptotic activity. (A) Semiquantitative RT–PCR analysis of bcl2L and Northern analysis of p21, bax, and mdm2 in the uninjected tp53M214K control (lane 1), 1 ng of Δ113p53 mRNA alone injected (lane 2), 0.1 ng of p53 mRNA alone injected (lane 3), and Δ113p53 and p53 mRNA coinjected (lane 4) tp53M214K embryos. (B) defhi429 homozygous mutant (_def_−/−) and its def+/+ or defhi429/+ siblings (def+) were injected with buffer (as control) or Δ113p53-MO and were then genotyped (def panel) and harvested (pool of at least 20 embryos for each sample) for assessing bcl2L and Δ113p53 expression at 3 dpf. The el1a gene was used as the normalization control. Expression fold changes for bcl2 and Δ113p53 are shown below their corresponding panel. (C) The st-MO- or Δ113p53-MO-injected embryos were treated with γ-ray at 6 hpf and then harvested (pool of more than 100 embryos for each sample) 6 h later for total RNA extraction. Transcripts of bcl2L and Δ113p53 were examined via semiquantitative RT–PCR, and 18S RNA was used as the normalization control. Expression fold changes against the st-MO-injected embryos (set as 1) for bcl2 and Δ113p53 are shown under their corresponding panel. (D,E) Photos showing tp53M214K embryos at 24 hpf injected with various reagents as indicated. (D) bcl2L-MO (0.06 pmol) was injected per embryo. (E) TUNEL assay of embryos at 12 hpf treated as in D (marked with number).

Figure 8.

Figure 8.

A new feedback loop for p53 pathway. p53 and Mdm2 form a negative feedback regulation loop in that p53 activation induces the Mdm2 expression and the latter then triggers the degradation of p53 to remove p53. Here we show that p53 and Δ113p53 also form a negative feedback loop in that activation of p53 induces the expression of Δ113p53 that in turn acts specifically to antagonize p53's apoptotic activity without inactivating p53-promoted cell cycle arrest. We propose that Δ113p53 switches the p53 pathway to favor cell cycle arrest in response to developmental or stress signals.

Comment in

References

    1. Berghmans S., Murphey R.D., Wienholds E., Neuberg D., Kutok J.L., Fletcher C.D., Morris J.P., Liu T.X., Schulte-Merker S., Kanki J.P., et al. tp53 mutant zebrafish develop malignant peripheral nerve sheath tumors. Proc. Natl. Acad. Sci. 2005;102:407–412. - PMC - PubMed
    1. Boldrup L., Bourdon J.C., Coates P.J., Sjostrom B., Nylander K. Expression of p53 isoforms in squamous cell carcinoma of the head and neck. Eur. J. Cancer. 2007;43:617–623. - PMC - PubMed
    1. Bourdon J.C., Deguin-Chambon V., Lelong J.C., Dessen P., May P., Debuire B., May E. Further characterisation of the p53 responsive element identification of new candidate genes for trans-activation by p53. Oncogene. 1997;14:85–94. - PubMed
    1. Bourdon J.C., Fernandes K., Murray-Zmijewski F., Liu G., Diot A., Xirodimas D.P., Saville M.K., Lane D.P. p53 isoforms can regulate p53 transcriptional activity. Genes & Dev. 2005;19:2122–2137. - PMC - PubMed
    1. Chen J., Ruan H., Ng S.M., Gao C., Soo H.M., Wu W., Zhang Z., Wen Z., Lane D.P., Peng J. Loss of function of def selectively up-regulates Δ113p53 expression to arrest expansion growth of digestive organs in zebrafish. Genes & Dev. 2005;19:2900–2911. - PMC - PubMed

Publication types

MeSH terms

Substances

LinkOut - more resources