Tahmineh Jalali - Academia.edu (original) (raw)

Papers by Tahmineh Jalali

SARS-CoV-2 genome surveillance projects provide a good measure of transmission and monitor the ci... more SARS-CoV-2 genome surveillance projects provide a good measure of transmission and monitor the circulating SARS-CoV-2 variants at regional and global scales. Iran is one of the most affected countries still involved with the virus circulating in at least five significant disease waves, as of September 2021. Complete genome sequencing of 50 viral isolates in an early phase of outbreak in Iran, shed light on the origins and circulating lineages at that time. As part of a genomic surveillance program, we provided an additional 319 complete genomes from October 2020 onwards. The current study is the report of complete SARS-CoV-2 genome sequences of Iran in the March 2020-May 2021 time interval. We aimed to characterize the genetic diversity of SARS-CoV-2 in Iran over one year. Overall, 35 different lineages and 8 clades were detected. Temporal dynamics of the prominent SARS-CoV-2 clades/lineages circulating in Iran is comparable to the global perspective and introduces the 19A clade (B....

Journal of Health Sciences and Surveillance System, 2019

Background: Crimean-Congo hemorrhagic fever (CCHF) is a neglected tick-borne viral zoonotic disea... more Background: Crimean-Congo hemorrhagic fever (CCHF) is a neglected tick-borne viral zoonotic disease. The aim was to detect CCHF virus (CCHFV) among wild ticks from Artiodactyla, Bos taurus, Ovis aries, and Capra hircus, in a previously declared CCHFV-free province of Kohgiluyeh Boyer-Ahmad, southwest Iran.<br /> Methods: From April to November 2015, hard ticks were collected in a cross-sectional study and checked by microscope for species identity from ungulates in 51 study villages. About 55% of the ticks were then subjected to reverse-transcription polymerase chain reaction (RT-PCR) to detect CCHFV genome.<br /> Results: Overall, 859 hard ticks were captured, from which 8 different species in two genera were identified. The genus Rhipicephalus was distributed in half (#26) of the study villages. It was the most frequent (≈60%) tick genus. Hyalomma anatolicum, H. asiaticum, H. excavatum, H. marginatum, H. scupense, Rhipicephalus sanguineus, R. turanicus, and R. bursa we...

Crimean-Congo hemorrhagic fever (CCHF) is a fatal zoonotic disease caused by a Nairovirus belongi... more Crimean-Congo hemorrhagic fever (CCHF) is a fatal zoonotic disease caused by a Nairovirus belonging to Bunyaviridae family [1]. Main routes of transmission to human are infected tick bites and direct exposure to blood and tissues of infected animals or other patients. After an incubation period of 1 to 7 days, a flu-like illness accompanying non-specific symptoms such as fever, chill, headache, myalgia, and digestive problems occurs. In severe cases, the primary symptoms followed by hemorrhagic manifestations including petechiae, ecchymosis, hematuria, and melena. Thrombocytopenia, leukopenia and elevated transaminase levels are the most frequent abnormal laboratory findings in CCHF patients [2].

Background: Crimean–Congo hemorrhagic fever (CCHF) is a fatal disease caused by Nairovirus classi... more Background: Crimean–Congo hemorrhagic fever (CCHF) is a fatal disease caused by Nairovirus classified within the Bunyaviridae family. The virus is transmitted to humans through the bites of infected ticks or direct contact with viremic animals or humans. The current study aimed to detect the virus genome in ticks from Khorasan Razavi Province. Methods: One hundred hard ticks were collected randomly from 100 sheep in four different areas of the province. Collected ticks were kept alive and identified. All the ticks were analyzed for the presence of CCHF virus genome using reverse transcriptase polymerase chain reactions (RT-PCR). Results: The identified ticks were belonging to Hyalomma marginatum (16% female and 6% male), Rhipicephalus turanicus (52% female and 25% male), and Dermacentor raskemensis (1%). The CCHF virus genome was found in Hyalomma marginatum (5% male from Taibad and Sabzevar region and 1% female from Taibad). Genetic analysis of the virus genome isolated from two re...

Iranian Journal of Virology, Mar 1, 2016

Background: Crimean Congo Haemorrhagic Fever (CCHF) is a zoonotic viral infection which caused by... more Background: Crimean Congo Haemorrhagic Fever (CCHF) is a zoonotic viral infection which caused by CCHF virus. The route of transmission is through the bite of infected ticks, handling of infected blood or organs of livestock and nosocomially. Localization of CCHF virus in tissues by immunohistochemistry has shown that mononuclear phagocytes and endothelial cells are also major targets of virus infection. Material and Methods: As National Reference Laboratory for Arboviruses and Viral Haemorrhagic Fevers, Pasteur Institute of Iran, we received 2384 serum samples from CCHF probable patients from different provinces of Iran during 2000 to 2012. Results: We confirmed by serologically and/ or molecularly the disease of 821 cases. Among confirmed cases, 123 were died. The dominant clinical signs were fever (99.5%), haemorrhagic presentations (42.91%), nausea (30.2%) and myalgia (24.9%). In those with haemorrhagic presentations, petechiae (46.42%), gastrointestinal (GI) bleeding (39.73%), ...

Background: Crimean-Congo Hemorrhagic Fever Virus (CCHFV) belongs to genus Nairovirus and family ... more Background: Crimean-Congo Hemorrhagic Fever Virus (CCHFV) belongs to genus Nairovirus and family Bunyaviridae. The main aim of this study was to investigate the extent of recombination in S-segment genome of CCHFV in Iran. Methods: Samples were isolated from Iranian patients and those available in GenBank, and analyzed by phyloge-netic and bootscan methods. Results: Through comparison of the phylogenetic trees based on full length sequences and partial fragments in the S-segment genome of CCHFV, genetic switch was evident, due to recombination event. Moreover, evidence of multiple recombination events was detected in query isolates when bootscan analysis was used by SimPlot software. Conclusion: Switch of different genomic regions between different strains by recombination could contribute to CCHFV diversification and evolution. The occurrence of recombination in CCHFV has a critical impact on epidemiological investigations and vaccine design.

Iranian Biomedical Journal, May 20, 2019

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease, with a mortality rate ... more Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease, with a mortality rate of 30-50%. There is no approved vaccine or any specific antiviral treatment for CCHF; therefore, the rapid diagnosis seems to be crucial for both efficient supportive therapy and control of infection spread. In this study, the potency of recombinant nucleoprotein of virus expressed in prokaryotic system was investigated for diagnosis of the infection.

Abstract. Ticks are hematophagous arthropods belonging to the class Arachnida. They are the major... more Abstract. Ticks are hematophagous arthropods belonging to the class Arachnida. They are the major vectors of pathogens in animals and humans. Injuries and diseases related to ectoparasites are more prevalent and severe than what is commonly perceived. Ticks cause widespread distress and morbidity and they act as vectors of diseases, and affect the economic conditions of camel-rearing. This survey was carried out in eleven towns and cities in the three provinces of Northeast Iran (Khorasan Razavi, Northern Khorasan, and Southern Khorasan) from May 2012 to January 2013 to identify the distribution of different tick species infesting camels and to evaluate the influence of sex and age of camels on the infestation rate of ticks. A total of 200 camels were examined and 480 ticks were collected (347 males and 133 females). Tick infestation was observed in 171 (85.5%) of camels. Hyalomma dromedarii was found to be the predominant tick species (90.7%). Other tick species were found in low n...

Scientific Reports

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geograp... more Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR techniqu...

Journal of vector borne diseases, 2014

of the most widely distributed viral hemorrhagic fevers occurring in Africa, the middle East, Asi... more of the most widely distributed viral hemorrhagic fevers occurring in Africa, the middle East, Asia and some parts of Europe1. CCHFV is generally transmitted between ticks and vertebrates by bites or by contact2. An infected tick remains infected throughout its life and transmits the infection to large vertebrates3. Livestock play a role in the amplification of the virus because the animals become viremic for seven days4. During the last decade, Turkey, Bosnia, and especially Iran still have the most frequent outbreaks of CCHF worldwide, with continued reports in the 21st century5. This study was performed to evaluate the status of CCHF in the camels of Khorasan provinces. The study was conducted in Khorasan, the largest province of Iran until it was divided into three provinces on 29 September 2004. These provinces are located at 55° 17′ to 61° 15′ E and 30° 24′ to 38° 17′ N in the northeastern Iran (Fig. 1). North Khorasan is a mountainous region with a temperate cold weather. Khor...

Iranian Red Crescent Medical Journal, 2017

Coronavirus disease 2019 (Covid‐19) is caused by severe acute respiratory syndrome‐coronavirus‐2 ... more Coronavirus disease 2019 (Covid‐19) is caused by severe acute respiratory syndrome‐coronavirus‐2 (SARS‐CoV‐2) which is responsible for a global pandemic that started in late 2019 in Wuhan, China. To prevent the worldwide spread of this highly pathogenic virus, development of an effective and safe vaccine is urgently needed. The SARS‐CoV‐2 and SARS‐CoV share a high degree of genetic and pathologic identity and share safety and immune‐enhancement concerns regarding vaccine development. Prior animal studies with first generation (whole virus‐based) preparations of SARS‐CoV vaccines (inactivated and attenuated vaccine modalities) indicated the possibility of increased infectivity or eosinophilic infiltration by immunization. Therefore, development of second and third generation safer vaccines (by using modern vaccine platforms) is actively sought for this viral infection. The spike (S) protein of SARS‐CoVs is the main determinant of cell entry and tropism and is responsible for facilita...

Health Policy and Technology

Biotechnology Letters

OBJECTIVES Serotype 2 of dengue virus (DENV-2) is the most prevalent cause of dengue fevers. In t... more OBJECTIVES Serotype 2 of dengue virus (DENV-2) is the most prevalent cause of dengue fevers. In this study, the C-prM gene was used for specific detection of DENV-2 by RT-LAMP assay. The RT-LAMP assay was optimized using the Taguchi design of experiments. RESULTS The efficiency of the assay in such optimal conditions resulted in 100% sensitivity, 100% specificity, and 100% overall accuracy for detection of 4 copies/μL of the genome of DENV-2. In addition, the detection of 2 copies/μL of the genome of DENV-2 was feasible, although the sensitivity was 50%. Considering the importance of the specific detection of the dengue virus serotypes, the cost-effective RT-LAMP approach can be used for rapid, specific, and sensitive detection of DENV-2. CONCLUSION RT-LAMP, as a cost-effective method, was optimized using Taguchi array approach for specific and rapid detection of DENV-2. Such methods can facilitate the diagnosis procedure in remote regions.