Plant Molecular Virology Research Papers (original) (raw)

- by
- •
- Mycology and Plant pathology, Plant Molecular Virology

Zucchini shoestring virus (ZSSV) has been proposed to be a putative potyvirus in the papaya ringspot virus (PRSV) cluster, based on the sequence similarity of its coat protein to those of related potyviruses. ZSSV has been associated with the outbreak of a damaging disease of baby marrow (Cucurbita pepo L.) that had been observed throughout the province of KwaZulu-Natal, in the Republic of South Africa (RSA). We report the genome sequence of ZSSV, determined by next-generation sequencing of total RNA extracted from an infected baby marrow (Cucurbita pepo L.). The ZSSV genome is 10,295 nucleotides long excluding the poly(A) tail and displays a typical potyvirus organization. Algerian watermelon mosaic virus (AWMV; EU410442.1) was identified as the closest relative of ZSSV, sharing the highest nucleotide sequence identity of 65.68%. The nucleotide and amino acid sequence identity values for each protein support the differentiation of ZSSV as a member of a distinct species in the genus Potyvirus. This taxonomic position was also confirmed using the Pairwise Sequence Comparison online tool from the National Center for Biotechnology Information. Phylogenetic analysis of the polyprotein coding sequence of ZSSV grouped ZSSV together with AWMV and Moroccan watermelon mosaic virus, but in different clusters. ZSSV is the second cucurbit-infecting virus in the PRSV cluster present in RSA.

- by Mark Laing and +1
- •
- Virus Taxonomy, Plant Virology, Potyviridae, Plant Molecular Virology
- by Siju Senan
- •
- Molecular Virology (Biology), Molecular Biology, Virology, Molecular virology

Abstract Tomatoes in Guatemala have been affected by a
new disease, locally known as ‘‘mancha de chocolate’’
(chocolate spot). The disease is characterized by distinct
necrotic spots on leaves, stems and petioles that eventually
expand and cause a dieback of apical tissues. Samples from
symptomatic plants tested negative for infection by tomato
spotted wilt virus, tobacco streak virus, tobacco etch virus
and other known tomato-infecting viruses. A virus-like
agent was sap-transmitted from diseased tissue to Nicotiana
benthamiana and, when graft-transmitted to tomato, this
agent induced chocolate spot symptoms. This virus-like
agent also was sap-transmitted to Datura stramonium and
Nicotiana glutinosa, but not to a range of non-solanaceous
indicator plants. Icosahedral virions *28–30 nm in diameter
were purified from symptomatic N. benthamiana plants.
When rub-inoculated onto leaves of N. benthamiana plants,
these virions induced symptoms indistinguishable from
those in N. benthamiana plants infected with the sap-transmissible
virus associated with chocolate spot disease.
Tomatoes inoculated with sap or grafted with shoots from
N. benthamiana plants infected with purified virions
developed typical chocolate spot symptoms, consistent with
this virus being the causal agent of the disease. Analysis of
nucleic acids associated with purified virions of the chocolate-
spot-associated virus, revealed a genome composed of
two single-stranded RNAs of*7.5 and*5.1 kb. Sequence
analysis of these RNAs revealed a genome organization
similar to recently described torradoviruses, a new group of
picorna-like viruses causing necrosis-associated diseases of
tomatoes in Europe [tomato torrado virus (ToTV)] and
Mexico [tomato apex necrosis virus (ToANV) and tomato
marchitez virus (ToMarV)]. Thus, the*7.5 kb and*5.1 kb
RNAs of the chocolate-spot-associated virus corresponded to
the torradovirus RNA1 and RNA2, respectively; however,
sequence comparisons revealed 64–83% identities with
RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV.
Together, these results indicate that the chocolate-spotassociated
virus is a member of a distinct torradovirus species
and, thus, another member of the recently established genus
Torradovirus in the family Secoviridae. The name tomato
chocolate spot virus is proposed.

- by Margarita Palmieri
- •
- Plant Virology, Plant Molecular Virology
- by Nagendran Krishnan
- •
- Botany, Conservation Biology, Biological Control, Plant Virology

The objective of this study was to determine the extent of adoption of Salt
tolerant variety BRRI dhan 47 in Noakhali district. Data were collected
from randomly selected 100 farmers via pre-tested interview schedule
during September 20 to October 10, 2012. After data collection, were
coded for processing and analysis. SPSS was used to perform the data
analysis. Percentage, mean, standard deviation were calculated.
Coefficients of correlation (r) were computed to find out the relationship
between adoption of BRRI dhan 47 and the selected socio-economic
characteristics of farmers. Majority of the respondents were middle aged
(48%), having primary level education (46%), medium family size (60%),
small farm size (51%), medium annual income (66%), very low
organizational participation (65%), low innovativeness (72%), medium
extension contact (64%), and medium knowledge on rice cultivation
(70%). Majority (53%) of the respondents had low adoption of BRRI dhan
47 whereas 42 % medium and only 5% under high adoption category.
Farmers’ education, farm size, annual income, innovativeness, extension
contact, and knowledge on rice cultivation showed significant and positive
relationship with adoption of BRRI dhan 47. Shattering problem, cost on
irrigation, natural calamities were the major problems faced by the farmers
in cultivating BRRI dhan 47. Proper extensions activities are needed to
disseminate BRRI dhan 47 to bring the uncultivated areas under rigorous
cultivation for ensure a better livelihood on the coastal farmers.

Onion (Allium cepa L.), an important edible species of genus Allium cultivated both in rabi and kharif season in Indian Punjab. It is planted directly by seeds or by bulb sets for table purpose and seed production. Onion is reported to be attacked by many viruses among these, Onion yellow dwarf virus (OYDV), Leek yellow stripe virus(LYSV),Garlic common latent virus, Shallot latent virus and Garlic virus X have been reported from India. These virus(es) attack onion either singly or in combination and causes severe losses. Present study was carried out to study the effect of virus (es) on symptoms and yield parameter. Serological and molecular detection from infected samples confirmed the association of OYDV and LYSV in onion. The virus symptoms associated with onion were categorized in three category (i) Symptomless plant with flattened older leaves (ii) Yellow stripping on leaves, flattening and stunting of plant (iii )Severe twisting, thinning, partial and complete yellowing of leaves, stunting of plant and such plant did not bolt. The first category symptoms are more prominent in crops raised by seeds, whereas, the other two categories are prominent in crop raised by bulb sets. Growth parameter such as plant height, leaf diameter, number of leaves were recorded both in infected and healthy control. Severe reduction in growth parameter i.e. 16.89, 12.24, 1.50 per cent reduction in height of plant, no of leaves per plant and diameter of leaves, respectively, were recorded over healthy control. Yield parameter viz. bulb weight, seed weights were also recorded. Reduction in bulb weight by 56.16% and seed weight by 7.50% over healthy control was observed. This data revealed that virus complex of onion is responsible for drastic reduction in bulb and seed production in north-western part of India.

- by Irfan khan
- •
- Mycology and Plant pathology, Plant Virology, Plant Molecular Virology, Plant Virus

mosaic cucumovirus (CMV) is a known devastating pathogen and menace threat to several important vegetables worldwide including Pakistan. This study was conducted to determine the incidence, distribution and genetic variability of CMV isolates infecting cucurbits and solanaceous vegetables in the Pothwar region of Pakistan, a rich region for vegetable production. Symptomatic leaf and fruit samples were subjected to double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) using polyclonal antibodies for CMV. Moreover, it was further characterized by Triple Antibody Sandwich ELISA (TAS-ELISA), molecular assays and genetic recombination. The pathogen was prevalent in all districts and detected in all 10 tested vegetables i.e. cucumber, round gourd, watermelon, melon, pumpkin, bitter gourd, ridge gourd, smooth gourd, chilli and tomato, with an average incidence ranging from 11.85% to 25.89%, with the highest incidence in district Attock (25.17%) followed by Rawalpindi (23.04%), Jhelum (18.57%), Chakwal (18.30%) and Islamabad (14.45%). Cucumber, tomato, watermelon and chilli were found to be most affected by CMV with an average disease incidence (D.I.) of 45.38%, 21.15%, 19.39% and 19.05%, respectively. Capsid protein (CP) cistron nucleotides based In silico restriction and Phylogenetic analyses revealed that among 10 Pakistani CMV under studied isolates; the four viz., AAJAC, AARpCu, AAHAWM and AACCu isolates were grouped as member of CMV subgroup IB and they shared 94.96% identity with each other while rest of the six isolates viz., AARCF, AARwCu, AARTF, AAHAPu, AAICu and AAJABG grouped in to CMV subgroup II with 92.8% identity among themselves. In recombination detection analysis, the Pakistani CMV isolate AAICu (MH119070) was found likely to be a recombinant between the Indian (X89652) and Pakistani (MH119068) isolates with recombinant breakpoints between 370th and 630th nucleotides. Further research is needed to comprehend the economic impact of the virus and breeding programs for screening of resistant genotypes as per recombinant strains and there is also a need to focus on training of farmer communities to manage disease through adaption of resistant cultivars and controlling vector populations.
Keywords: RNA viruses, CMV, Coat protein, Serotyping, Subgroup I and II, Vegetables.

- by Prof. Dr. Tariq Mukhtar
- •
- Plant Molecular Virology

Four crop-infecting begomoviruses were found naturally affecting Charlock mustard (Sinapis arvensisL.) plants in Jordan andcharacterized at the molecular level. Symptoms included leaf curling and stunting. PCR analysis showed the presence... more

- by Mohammed Abu Obaida
- •
- Plant Molecular Virology

Citrus psorosis ophiovirus (CPsV)
was detected from naturally citrus cv. Navel
orange trees exhibited virus-like symptoms
(bark scaling and gum) at Qanater,
Qaluobia governorate, Egypt. CPsV isolate
was detected by serological assay
using monoclonal antibodies (Mabs) specific
to CPsV by double antibody sandwich-
enzyme linked immunosorbent assay
(DAS-ELISA), results showed that three
trees out of twenty eight trees gave positive
reactions with ELISA, values ranged
between 0.621 and 0.740 compared to the
negative (Healthy, 0.300) sample. The
results were biologically confirmed by
showing oak leaf pattern (OLP) on Dweet
tangor after 28 days of inoculation. These
plants were maintained as a suitable
propagative host for the CPsV. Molecular
detection was carried out by reverse transcription-
polymerase chain reaction (RTPCR)
with the extracted RNA from CPsV
infected trees and tissues virus-free as a
negative control and two sets of primers.
Four reactions of one-step RT-PCR were
done using the combination of the four
primers, i.e., CPsVR1 & CPsVR2,
CPsVN1 & CPsVR2, CPsVR1 &
CPsVN2 and CPsVN1 & CPsVN2. Results
showed that four DNA fragments of
1320, 1020, 540 and 240 bp were amplified
respectively

- by Reda Salem
- •
- Plant Virology, Plant Molecular Virology

Introduction – A variety of sample preparation protocols for plant proteomic analysis using two-dimensional gel electrophoresis (2-DE) have been reported. However, they usually have to be adapted and further optimised for the analysis of plant species not previously studied.Objective – This work aimed to evaluate different sample preparation protocols for analysing Carica papaya L. leaf proteins through 2-DE.Methodology – Four sample preparation methods were tested: (1) phenol extraction and methanol–ammonium acetate precipitation; (2) no precipitation fractionation; and the traditional trichloroacetic acid–acetone precipitation either (3) with or (4) without protein fractionation. The samples were analysed for their compatibility with SDS–PAGE (1-DE) and 2-DE. Fifteen selected protein spots were trypsinised and analysed by matrix-assisted laser desorption/ionisation time-of-flight tandem mass spectrometry (MALDI-TOF-MS/MS), followed by a protein search using the NCBInr database to accurately identify all proteins.Results – Methods number 3 and 4 resulted in large quantities of protein with good 1-DE separation and were chosen for 2-DE analysis. However, only the TCA method without fractionation (no. 4) proved to be useful. Spot number and resolution advances were achieved, which included having an additional solubilisation step in the conventional TCA method. Moreover, most of the theoretical and experimental protein molecular weight and pI data had similar values, suggesting good focusing and, most importantly, limited protein degradation.Conclusion – The described sample preparation method allows the proteomic analysis of papaya leaves by 2-DE and mass spectrometry (MALDI-TOF-MS/MS). The methods presented can be a starting point for the optimisation of sample preparation protocols for other plant species. Copyright © 2009 John Wiley & Sons, Ltd.

- by José Aires Ventura
- •
- Plant Molecular Virology, Carica papaya

The biosafety of fipronil 80 WG, chlorpyriphos 20 EC, dimethoate 30 EC and neem seed kernel extract (NSKE) 5
per cent to Trichogramma chilonis Ishii, Telenomus sp. and Cyrtorhinus lividipennis Reuter was studied under
laboratory condition. The result revealed that, NSKE 5% was safe to T. chilonis with higher rate of parasitization
(92.6%) and emergence (94.1%) followed by fipronil 80 WG @ 40 and 50g a.i.ha-1 which recorded 80 per cent
parasitization of eggs and emergence of adult parasitoid. The adult emergence of Telenomus sp., was maximum
in NSKE 5% (74.33%) followed by fipronil 80 WG @ 40 and 50g a.i.ha-1 with respective parasitoid emergence
of 59.33 and 55 per cent. Further, the mortality of mirid predator, Cyrtorhinus lividipennis Reuter was minimum
7.5 per cent in NSKE 5% treatment followed by fipronil 80 WG @ 40 and 50g a.i.ha-1 which recorded a mortality
of 37.5 and 40 per cent, respectively. The deleterious subtle effect of NSKE 5% and fipronil 80 WG egg
parasitoids and mirid predators showed their biosafety to natural enemies in rice ecosystem

- by Dr. M. Shanmuga Prema
- •
- Toxicology, Ecology, Agriculture, Insect Molecular Biology

Pepo aphid-borne yellows virus (PABYV) has been proposed as a putative representative of a new species in the genus Polerovirus in the family Luteoviridae. The genomes of two South African (SA) isolates of cucurbit-infecting PABYV were described in this record. Total RNA, extracted from a pattypan (Cucurbita pepo L.) and a baby marrow (C. pepo L.) leaf samples, was subjected to next-generation sequencing (NGS) on the HiSeq Illumina platform. Sanger sequencing was subsequently used to authenticate the integrity of PABYV’s genome generated from de novo assembly of the NGS data. PABYV genome of SA isolates consists of 5813 nucleotides and displays an organisation typical of poleroviruses. Genome sequence comparisons of the SA PABYV isolates to other poleroviruses support the classification of PABYV as a new species in the genus Polerovirus. Recombination analyses showed that PABYV and Cucurbit aphid-borne yellows virus (CABYV) shared the same ancestor for the genome part situated between breaking points. Phylogenetic analyses of the RNA-dependent RNA polymerase and the coat protein genes showed that SA PABYV isolates shared distant relationship with CABYV and Suakwa aphid-borne yellows virus. Based on our results, we propose that PABYV is a distinct species in the genus Polerovirus.

- by Jacques D Ibaba
- •
- Virus Taxonomy, Southern Africa, Plant Virology, Plant Molecular Virology

The presence of stolbur phytoplasma in many crops all over Egypt is increasing severely. This pathogen was broadly observed in tomato leaves in a field located at Alexandria. Effective and accurate techniques depend on the PCR analysis with M1/P8 primer pair that amplifies a stolbur-specific, non-ribosomal fragments of a 720 bp. Therefore, we strongly recommend the application of DNA hybridization method for rapid and accurate detection of such economic pathogen.

- by Azza Galal
- •
- Plant Molecular Virology

Cassava (Manihot esculenta Cranz) is an important food staple in Busia, Homabay, Siaya, Migori, Kwale, Kilifi and Marakwet Counties and is a secondary food crop for many Kenyans. The current yields of 3-4 tons/ha obtained in Western Kenya are far below world averages and this is largely attributed to pests and diseases. The usual practice of retaining some seed cuttings from the current ware crop or buying them from neighbours, leads to accumulation of viral diseases most important of which are caused by begomovirus infections. A survey for cassava mosaic disease (CMD) was carried out in main cassava growing areas of Western Kenya with a view to determine incidence and distribution of the causal viruses. A total of 33 cassava farms in seven sub-counties in Western Kenya were covered. Leaf samples were collected and analysed serologically and by molecular means. Cassava plants in most farms were severely affected by cassava mosaic disease. Disease incidence in farms ranged between 2% to 54%. Three cassava infecting begomoviruses, African Cassava Mosaic Virus (ACMV), East African Cassava Mosaic Virus (EACMV) and East African Cassava Mosaic Virus – Ugandan variant (EACMV-Ug) were found in the collected samples, with EACMV-Ug being most prevalent followed by EACMV. These are interesting findings given that in the past surveys, ACMV was the most abundant virus in the area. To increase cassava yields, it is recommended that cassava farmers be educated on cassava diseases and their control.

- by Bonphace Collins Mangeni, PhD
- •
- Plant Molecular Virology, Crop Protection

Food security (a pressing issue for all nations) faces a threat due to population growth, land availability for growing crops, a changing climate (leading to increases in both abiotic and biotic stresses), heightened consumer awareness of the risks related to the use of agrichemicals, and also the reliance on depleting fossil fuel reserves for their production. Legislative changes in Europe mean that fewer agrichemicals will be available in the future for the control of crop pests and pathogens. The need for the implementation of a more sustainable
agricultural system globally, incorporating an integrated approach to disease management, has never been more urgent. To that end, the Valorizing Andean Microbial Diversity (VALORAM) project (http://valoram.ucc.ie), funded under FP7, examined the role of microbial
communities in crop production and protection to improve the sustainability, food security, environmental protection, and productivity for rural Andean farmers. During this work, microbial volatile organic compounds (mVOCs) of 27 rhizobacterial isolates were identified using gas chromatography/mass spectrometry (GC/MS), and their antifungal
activity against Rhizoctonia solani was determined in vitro and compared to the activity of a selection of pure volatile compounds. Five of these isolates, Pseudomonas palleroniana R43631, Bacillus sp. R47065, R47131, Paenibacillus sp. B3a R49541, and Bacillus simplex M3-4 R49538 trialled in the field in their respective countries of origin, i.e., Bolivia, Peru, and Ecuador, showed significant increase in the yield of potato. The strategy followed in the VALORAM project may offer a template for the future isolation and determination of putative biocontrol and plant growth-promoting agents, useful as part of a low-input integrated pest management system.

- by Siva Velivelli
- •
- Agricultural Engineering, Botany, Microbiology, Mycology

ABSTRACT
Effect of Virus Infection on Yield
and Oil Content of Three
Patchouli Varieties
Mosaic disease was reported as a limiting
factor in production of patchouli plants
(Pogostemon cablin). A study was
conducted to measure the effect of
mosaic disease on production and quality
of patchouli oil. Three varieties of
patchouli were involved in this study, i.e
Sidikalang, Lhokseumawe and Tapak
Tuan. Based on ELISA result, Potyvirus
was detected on Tapak Tuan and
Lhokseumawe associated in mosaic
symptoms. Measurement of fresh and
dry weight, oil and patchouli alcohol (PA)
content was conducted from six month
old plants and showed an indication of
fresh and dry weight, oil and patchouli
alcohol (PA) content declining up to
34,65, 40,42, 9,09 and 5,06% at most,
respectively.
Key words : Pogostemon cablin, Potyvirus,
Production, Oil content, Patchouli
alcohol

- by Rita Noveriza
- •
- Plant Molecular Virology

Plant viruses that are members of the Geminiviridae family have circular single-stranded DNA (ssDNA) genome and are responsible for major crop diseases worldwide. We have identified and characterized a novel monopartite geminivirus infecting tomato in Argentina. The full-length genome was cloned and sequenced. The genome-wide pairwise identity calculation that resulted in a maximum of 63% identity with all of other known geminiviruses indicated that it is a new geminivirus species. Biolistic infected plants presented interveinal yellowing, apical leaf curling and extreme root hypotrophy. Thus, the name proposed for this species is tomato apical leaf curl virus (ToALCV). The phylogenetic inferences suggested different evolutionary relationships for the replication-associated protein (Rep) and the coat protein (CP). Besides, the sequence similarity network (SSN) protein analyses showed that the complementary-sense gene products (RepA, Rep and C3) are similar to capulavirus while the viron-sense gene products (CP, MP and V3) are similar to topocuvirus, curtovirus and becurtovirus. Based on the data presented, ToALCV genome appears to have " modular organization " supported by its recombination origin. Analyses of the specificity-determining positions (SDPs) of the CP of geminiviruses defined nine subgroups that include geminiviruses that share the same type of insect vector. Our sequences were clustered with the sequences of topocuvirus, whose vector is the treehopper, Micrutalis malleifera. Also, a set of the highest scored amino acid residues was predicted for the CP, which could determine differences in virus transmission specificity. We predict that a treehopper could be the vector of ToALCV, but transmission assays need to be performed to confirm this. Given everything we demonstrate in this paper, ToALCV can be considered a type member of a new putative genus of the Geminiviridae family.

- by Gastón Vaghi
- •
- Virology, Molecular virology, Plant Virology, Plant Molecular Virology

SUMMARY Co-infection of Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV) and Carrot red leaf virus associated RNA (CtRLVaRNA) causes Carrot motley dwarf (CMD) disease. This study examined the capacity of the aphid Myzus persicae at transmitting viruses associated with CMD. M. persicae exposed to CMD-infected chervil plants transmitted CtRLV-, CMoV-and CtRLVaRNA to disease-free chervil, fennel, celery, carrot, cilantro, and parsley, as shown by RT-PCR using specific primers. Recipient plants developed typical CMD symptoms. Sequence analysis of the amplified virus genes showed high sequence diversity with corresponding sequences available in GenBank. This study expands on Cavariella aegopodii, the only previously recognized aphid vector of CMD-causing viruses.

- by Muhammad Tayyib Naseem and +1
- •
- Plant Molecular Virology, Aphids, Insect Transmission of Plant Viruses

Cotton leaf curl geminivirus is a whitefly (Bemisia tabaci Genn.) transmitted Begomovirus (Family Geminiviridae) causing a serious disease of cotton in northern India. The very typical symptoms of present isolate (CLCuV-HS2) showed thickened veins, dark green discoloration of the leaves with upward curling and leaf like structure known as enation (one in number), which develops into cup-shaped on the reverse side of leaves. The polymerase chain reaction (PCR) based technique can detect the viral DNA in samples stored upto 3 days after the collection and have wide application for the field diagnosis. The complete nucleotide sequence of the Indian isolate of cotton leaf curl geminivirus (CLCuV-HS2) coat
protein (CP) gene component was determined using CP specific primers through PCR amplification from field infected cotton plants growing in Haryana, India. Comparison of the amino acid sequence of the putative CP with some other mono and bipartite geminiviruses revealed a maximum of 97.3% identity with Pakistan cotton leaf curl virus (CLCuV-62). A nuclear localization signal located close to the N-terminal of
CP gene was determined.

- by Narayan Rishi
- •
- Plant Virology, Plant Molecular Virology

In recent years leaf curl disease of cotton has become a major limiting factor in the production of cotton, which is an important fiber cash crop. In the last two decades or more, leaf curl disease in cotton took on epidemic proportions in Pakistan. In the early 1990’s cotton leaf
curl disease (CLCuD) appeared in the bordering parts of India in the states of Rajasthan and Punjab and spread to entire cotton growing areas in Rajasthan, Punjab and Haryana. The very early appearance of the disease devastated entire crops of susceptible varieties. This led to a ban on the cultivation of Barbadense cotton and the collapse of several popular cotton varieties. The characteristic symptoms of CLCuD are general stunting, upward or downward curling of leaves and thickening of veins which turn dark green. Enations of various
shapes and sizes numbering up to twelve develop on the thickened veins on the abaxial side of leaves. Fewer, smaller balls are formed which sometimes fail to open. In the field CLCuD is a complex problem that needs an integrated management approach. Six species of the genus Begomovirus, family Geminiviridae viz. Cotton leaf curl Alabad virus (CLCuAV), Cotton leaf curl Gezira virus (CLCuGV),
Cotton leaf curl Kokhran virus (CLCuKV), Cotton leaf curl Multan virus (CLCuMV), Cotton leaf curl Rajasthan virus (CLCuRV) and Tomato leaf curl Bangalore virus-Cotton [Fat] associated with DNA-β and DNA-1 (genus Nanovirus) are reported to induce CLCuD. All these begomoviruses are monopartite DNA-A, transmissible by the whitefly Bemisia tabaci. Begomoviruses are recognized as the most
abundant and most severe viral pathogens of cotton, worldwide. Yield losses due to CLCuD amount to 60% or more if the disease appears at a very early stage of the crop. The aim of this review is to discuss and understand our current knowledge of CLCuD complex of cotton, and epidemiology, management and future prospects.

- by Narayan Rishi
- •
- Plant Virology, Plant Molecular Virology

The beet necrotic yellow vein virus (BNYVV) RNA-5-encoded p26 protein is involved in the accentuation of symptoms expression of infected Chenopodium quinoa plants and is capable of transcription activation (TA) in yeast. TA was previously localized within the first 55 residues of the p26 protein. Interestingly, TA did not occur when C-terminally deleted forms of p26 were used. We used a genetic screen in the yeast one-hybrid system to select restored TA from randomly generated mutants. The TA domain was found to be located within the first 17 residues. Alanine replacement of aspartic acids 11, 16, and 17 within the full-length p26 prevented TA but did not impair subcellular localization and the symptom expression.

- by Laura Covelli
- •
- Plant Virology, Plant Molecular Virology

Chlorosis is one of the most common symptoms
of plant diseases, including those caused by viruses and
viroids. Recently, a study has shown that Peach latent
mosaic viroid (PLMVd) exploits host RNA silencing
machinery to modulate the virus disease symptoms through the silencing of chloroplast-targeted heat shock protein 90 (Hsp90C). To understand the molecular mechanisms of chlorosis in this viroid disease, we established an experimental system suitable for studying the mechanism underlying the chlorosis induced by the RNA silencing of Hsp90C in transgenic tobacco. Hairpin RNA of the Hsp90C-specific region was expressed under the control of a dexamethasone-inducible promoter, resulted in the silencing of Hsp90C gene in 2 days and the chlorosis along with growth suppression phenotypes. Time course study suggests that a sign of chlorosis can be monitored as early s 2 days, suggesting that this experimental model is
suitable for studying the molecular events taken place
before and after the onset of chlorosis. During the early
phase of chlorosis development, the chloroplast- and photosynthesis-related genes were downregulated. It should be noted that some pathogenesis related genes were upregulated during the early phase of chlorosis in spite of the absence of any pathogen-derived molecules in this system.

Recent studies with Y satellite RNA (Y-sat) of
cucumber mosaic virus have demonstrated that Y-sat
modifies the disease symptoms in specific host plants
through the silencing of the magnesium protoporphyrin
chelatase I subunit (CHLI), which is directed by the Y-sat
derived siRNA. Along with the development of peculiar
yellow phenotypes, a drastic decrease in CHLI-transcripts
and a higher accumulation of Y-sat derived siRNA were
observed. To investigate the molecular mechanisms
underlying the Y-sat—induced chlorosis, especially whether or not the reduced expression of CHLI causes the chlorosis simply through the reduced production of
chlorophyll or it triggers some other mechanisms leading to the chlorosis, we have established a new experimental system with an inducible silencing mechanism. This system involves the expression of artificial microRNAs targeting of Nicotiana tabacum CHLI gene under the control of chemically inducible promoter. The CHLI mRNA levels and total chlorophyll content decreased significantly in 2 days, enabling us to analyze early events in induced chlorosis and temporary changes therein. This study revealed that the silencing of CHLI did not only result in the decreased chlorophyll content but also lead to the downregulation of chloroplast and photosynthesis-related genes expression and the up regulation of defense related genes. Based on these results, we propose that the
reduced expression of CHLI could activate unidentified
signaling pathways that lead plants to chlorosis.

- by Sachin Bhor
- •
- Genomics, Plant biotechnology, Functional Genomics, Plant Molecular Virology

Moroccan watermelon mosaic virus (MWMV) has been prevalent in cucurbits in the Republic of South Africa (RSA) since it was first reported in 1987. However, full-genome studies of the South African isolates have never been conducted previously. The full genome of two MWMV isolates infecting cucurbits (Cucurbita pepo L.) in the province of KwaZulu-Natal, RSA, was compared with the genome of the Tunisian isolate in this communication. The genome sequences of the RSA MWMV isolates were elucidated using next-generation sequencing and Sanger sequencing. The analyses performed included nucleotide and amino acid sequence comparison, determination of the genetic distances, detection of potential recombination, and phylogeny. The genome sequences of the RSA MWMV isolates were found to be 9719 nucleotides long, excluding the poly(A) tail. Sequence homology, genetic distances, and phylogenetic analyses indicated close relationships between the RSA isolates. This record will contribute to building up the MWMV isolate sequences from the different countries where the virus occurs, a useful step toward understanding MWMV evolution.

- by Mark Laing and +1
- •
- Plant Virology, Potyviridae, Plant Molecular Virology, Next generation sequencing

Potato virus Y (PVY, genus Potyvirus, family Potyviridae) causes high economic losses worldwide, especially in the production of seed potatoes (Solanum tuberosum). In a recent study, we reported, for the first time in Jordan, the incidence of recombinant strains of PVY in the southern part of the country (Anfoka et al., 2014). In this study, we further investigated the incidence of the recombinant strains of the virus in the north and east regions of Jordan. Therefore, in August 2015, a total of 172 potato leaf samples were collected from 3 farms in Ramtha (north Jordan) and 56 samples from 2 farms in Mafraq (east Jordan) regions. All samples were obtained from symptomatic potato plants
showing leaf mottling and mosaic symptoms. To test for PVY infection, all samples were subjected to DAS-ELISA using the ELISA kit (monoclonal cocktail) developed by BIOREBA (Reinach, Switzerland) that can detect all PVY strains. ELISA results showed that 24 and 51 samples obtained from Mafraq and Ramtha, respectively were infected with the virus. To confirm these results, total RNA was extracted from ELISA-positive samples and used as template in RTPCR
using the coat protein gene specific primer pair (CPVBamH1
TCAAGGATCCGCAAATGACACAATTGATGCA / CpcEcoR1
AGAGAATTCATCACATGTTCTTGACTCC). PCR results showed that 18
samples obtained from Mafraq and 41 samples from Ramtha were infected with PVY. PCR positive samples were further analyzed for PVY strain identification by uniplex PCR using strain-specific primers as previously described (2). PCR data showed that 48.8% and 61% of samples from Ramtha and Mafraq, respectively were infected with PVY-NTN(A), while 12.2% of samples from Ramtha were infected with PVY-O. PVYNTN SYR-I could be detected in 9.8% and 11% of samples from Ramtha and Mafraq, respectively. One sample from Ramtha was also found infected with PVYNTN SYR-II. PCR fragments (441 bp and 853 bp),
specific to the Wilga strain PVYNW(B) (2), could be amplified from 10 samples (3 from Ramtha and 7 from Mafraq) using the primer pairs n2258/n2700 and S5585/06400, respectively (2). Both fragments were cloned into pGEM-T easy vector and sequenced. Sequences were deposited in the GenBank under accession numbers KX000919 for the 441 bp fragment and KX027299 for the 853 bp fragment. Sequence comparison with other Wilga isolates available in the
NCBI database revealed that the Jordanian isolate of PVYNW(B) (PVYNW(B-Jo)) has 100% nucleotide sequence identity with isolate MV99 (HE608963) from Germany. Furthermore, phylogenetic analysis indicated that PVYNW(B-Jo) shares common ancestral origin with the Wilga isolate (EF558545) previously reported in Poland. To our knowledge, this is the first report of the Wilga strain of
PVY in Jordan

- by Mohammed Abu Obaida
- •
- Plant Molecular Virology
- by Jacques D Ibaba
- •
- Technology, Africa, Biology, Plant Virology

Chlorosis or yellowing is a common feature in plant virus diseases. To study the mechanism underlying virus-induced chlorosis, we previously generated an inducible transgenic tobacco expressing Cauliflower mosaic virus Tav protein and suggested the involvement of host response in chlorosis development. In contrast, studies have shown that the silencing of chloroplast protein genes by antiviral siRNA has a role in chlorosis induction. To comparably analyze these mechanisms of chlorosis, we established Dexamethasone inducible silencing of chloroplast Hsp90 and Magnesium protoporphyrin chelatase subunit I genes by using hairpin RNA and artificial microRNA, respectively. Transgenic tobacco lines showed chlorosis on selection media containing Dexamethasone. RT-PCR analysis confirmed the decreased mRNA levels at 2 days, and visible chlorosis symptoms were observed in 7 days after Dexamethasone treatment in 3-week-old transgenic plants. Comparative analysis of these transgenic plants with iTav-tobacco is expected to promote our understanding on chlorosis symptom development.

- by Sachin Bhor
- •
- Bioengineering, Molecular Biology, Biotechnology, Plant Molecular Virology

This review focuses on virus-plant pathosystems, manipulation paradigms and alterations induced by viruses in their hosts and vectors. After forming a suitable cell environment viruses elude the defense mechanism of cell, having a transformative interaction with hosts and vectors urge the scientists to work on different molecular alterations and manipulations induced by viruses in their hosts and vectors. Different manipulation paradigms are regulated by viruses, that start after acquisition of viruses by corresponding vectors in adaptive manipulation and behavioral manipulation manners, which are generally known as " Host Manipulation Hypothesis " (HMH). Because of these mediated alterations, secondary chemistry of vector's behavior can be affected. In the same way, plants are also extensively influenced by viruses which cause dramatic fluctuations in; genotype, phenotype, metabolism, systemic and hormones of the plants. The combination of viral proteins and host proteins evidenced efficacious viral infection. After viral infection defense system of plants is activated in the way of Induced Systemic Resistance (ISR) that is (1) Rapid/ Extreme resistance (2) Slower host response or (hypersensitive response, HR) also known as programmed death of plant cells. Proteome-level alterations have been reported in phloem sap at the time of virus infection but this phenomenon needs to be investigated. Viruses have also been reported for making alterations in primary phytohormones of plants; Salicylic acid (SA), Abscisic acid (ABA), Jasmonic acid (JA), Ethylene (ET) actively involved in defense mechanism of the plant.

"Detection of Potato virus S by serological and molecular methods in Khorasan Razavi and Hamedan provinces Pakbaz, S1. Jafarpour, B2. Falahati Rastegar, M2 1M.Sc. student of College of Agriculture, Ferdowsi University of Mashhad... more

- by Samira Pakbaz
- •
- Plant Molecular Virology
- by Augustine Gubba
- •
- Technology, Africa, Plant Virology, Plant Molecular Virology

The complete genome sequences for two variant isolates of groundnut rosette assistor virus (GRAV) have been
determined from symptomatic groundnut plants in western Kenya. The sequences of the two GRAV isolates
(sc7.1 and sc7.2) are 84.2% identical at the nucleotide level and 98.5% identical at the coat protein level. The
variants sc7.1 and sc7.2 comprise 5850 and 5879 nucleotides respectively, and show similar genome organizations
with 7 predicted ORFs (P0, P1, P2, P3a, P3 (coat protein, CP), P4 (movement protein, MP) and P5 (coat
protein-readthrough protein, CP-RT). Currently, GRAV is an unassigned virus in the Luteoviridae family, due to
the fact that only the sequence of the coat protein was previously obtained. The presence of both ORF0 and ORF
4 within the genome sequence determined in the current work suggest that GRAV should be classified as a
member of the genus Polerovirus.

Bean common mosaic necrosis virus (BCMNV) is one of the most common and most destructive viruses of common bean and can cause a yield loss as high as 100%. The common bean (Phaseolus vulgaris L) is an important legume crop for food and cash in Kenya. In Kenya, there is inadequate documentation on the strains of the virus infecting common bean. This information is crucial in devising control measures. This study therefore, sought to characterize BCMNV isolates from western Kenya. Leafy samples showing virus-like symptoms were collected and analysed by Enzyme linked immunosorbent Assay (ELISA) and or next generation sequencing (NGS). Extraction of total RNA from ELISA positive samples was done using RNeasy Plant Mini Kit and NGS carried out following Illumina protocol to determine diversity of the virus. NGS data was trimmed and the sequence reads assembled into contigs, which were analyzed against virus sequence database. Phylogenetic analyses and comparisons were performed using MEGA7 program. The first complete genome sequence of Bean common mosaic virus (BCMNV) is reported from a Kenyan isolate. NGS technology revealed full-length sequence of BCMNV from an isolate BG 12 from Bungoma County with a genome of 9584 nt in length. Phylogenetic analysis of full-length sequences available through the Genbank clustered the isolate with the Tanzanian isolate strain TN-1 and two USA isolates, TN1a and NL-3K.

Iris yellow spot virus (IYSV) is an important pathogen of Allium species worldwide. It has a tripartite genome consisting of the large (L), medium (M) and small (S) RNA segments. Despite its worldwide distribution, very few complete gene and genome sequences are available in public databases. The aim of this study was to obtain full gene sequences of a garlic-infecting IYSV isolate by next-generation sequencing (NGS) for understanding its evolution. Total RNA was extracted from an IYSV-positive garlic leaf and sequenced on the Illumina HiSeq platform using paired-end chemistry 125 × 125 bp reads. The quality of raw reads was assessed using FastQC software before trimming with Trimmomatic version 0.36. The resultant paired-end sequences were used for both de novo and reference-based genome assembly. The resultant consensus gene sequences were analyzed using SIAS (for sequence identity and composition), ExPASy (for protein molecular weight) and ORF Finder (for open reading frame identification). Three full gene sequences, that is, nucleocapsid (N), nonstructural protein (NSs) and movement protein (NSm) were recovered. The N gene did not display any distinct clustering patterns based on geographical locations and was most identical to an onion-infecting isolate from Serbia (Accession KT272878). The NSs and NSm genes clustered closely with homologous sequences of IYSV isolates that were retrieved from GenBank and EMBL. This study lays the foundation for complete genome studies of IYSV in Zimbabwe.

- by Jacques D Ibaba and +1
- •
- Africa, Plant Virology, Plant Molecular Virology, Zimbabwe

- by Benard Mukoye and +4
- •
- Plant Molecular Virology, Plant pathology (Virology)
- by Siju Senan
- •
- Molecular Virology (Biology), Plant Biology, Virology, Molecular virology